The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019312	Chromobacterium haemolyticum strain CH06-BL	5307994	830939	840651	5307994	tRNA	Bacillus_phage(33.33%)	8	NA	NA
WP_043592742.1|830939_833750_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	32.3	2.3e-12
WP_052052155.1|833780_834722_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.8	2.5e-11
WP_043592740.1|834735_835653_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.3	8.7e-09
WP_043592738.1|835756_836746_+	aldo/keto reductase	NA	A0A2I2L334	Orpheovirus	23.0	3.3e-06
WP_161523192.1|836754_837204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523193.1|837351_837675_-	monooxygenase	NA	NA	NA	NA	NA
WP_161523194.1|837968_839474_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	35.7	3.3e-82
WP_114152232.1|839546_840651_-	peptide chain release factor 2	NA	W8EDB3	Pseudomonas_phage	37.2	7.5e-07
>prophage 2
NZ_AP019312	Chromobacterium haemolyticum strain CH06-BL	5307994	1022057	1088533	5307994	coat,holin,tRNA,tail,terminase,transposase,plate	Pseudomonas_phage(25.0%)	84	NA	NA
WP_161523231.1|1022057_1022948_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_019103518.1|1022986_1023418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161523232.1|1023432_1025493_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_019103520.1|1025542_1026088_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_019103521.1|1026114_1026891_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_161524555.1|1026871_1027561_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_043591907.1|1027725_1028106_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_043591905.1|1028627_1030037_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_081551101.1|1030167_1031547_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_019101048.1|1031626_1032181_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_019101049.1|1032435_1033734_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_043591903.1|1034197_1034746_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_019101051.1|1034862_1036794_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.9e-147
WP_081554279.1|1036937_1038062_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.6	8.7e-35
WP_081575372.1|1038335_1039847_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_043591896.1|1039999_1041004_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_019101557.1|1041065_1041254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081575374.1|1041250_1042030_-	dioxygenase	NA	NA	NA	NA	NA
WP_141113204.1|1042182_1042530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081575375.1|1042646_1043639_-	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	39.2	8.4e-50
WP_019104307.1|1044534_1045287_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_019104308.1|1045425_1045839_-	DUF2721 domain-containing protein	NA	NA	NA	NA	NA
WP_081575376.1|1045838_1046495_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_081575377.1|1046499_1047267_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	32.3	5.0e-10
WP_161523233.1|1047338_1048316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081575379.1|1048316_1048598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043591881.1|1048594_1048984_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_019103538.1|1048987_1049305_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_081575380.1|1049441_1050749_-	MFS transporter	NA	NA	NA	NA	NA
WP_161523234.1|1051105_1051438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523235.1|1051593_1051989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523236.1|1051985_1052267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174243656.1|1052266_1052872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523238.1|1053031_1053646_-	glycoside hydrolase family 19 protein	NA	A0A0U4JP23	Pseudomonas_phage	52.3	3.2e-47
WP_161523239.1|1053710_1054136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523240.1|1054156_1054582_-|tail	tail fiber assembly protein	tail	A0A291LAV4	Bordetella_phage	55.2	1.5e-32
WP_161523241.1|1054592_1056425_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	25.3	8.1e-14
WP_161523242.1|1056484_1057147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523243.1|1057148_1058273_-|plate	baseplate J/gp47 family protein	plate	B3GAJ9	uncultured_virus	40.4	3.6e-49
WP_161523244.1|1058274_1058640_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_161523245.1|1058636_1059269_-|plate	phage baseplate assembly protein V	plate	B3GAJ7	uncultured_virus	38.7	1.0e-16
WP_161523246.1|1059265_1060648_-	rhs element Vgr protein	NA	NA	NA	NA	NA
WP_161523247.1|1060647_1061631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523248.1|1061634_1063656_-	hypothetical protein	NA	A4PE52	Ralstonia_virus	27.9	3.4e-37
WP_161523249.1|1063885_1064470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161523250.1|1064507_1064753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523251.1|1064864_1065347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523252.1|1065524_1065929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523253.1|1066018_1066456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523254.1|1066465_1068025_-|tail	phage tail protein	tail	B3GAJ6	uncultured_virus	44.7	8.2e-100
WP_162897041.1|1068082_1068244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523255.1|1068252_1069074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523256.1|1069076_1069721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523257.1|1069723_1070119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523258.1|1070129_1070303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523259.1|1070344_1071469_-|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	51.7	5.7e-95
WP_161523260.1|1071559_1072345_-	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	56.1	1.5e-57
WP_161524556.1|1072448_1073768_-	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	43.0	2.2e-82
WP_161523261.1|1073867_1075157_-|terminase	terminase	terminase	A0A059VG01	Pseudomonas_phage	70.8	5.4e-166
WP_161523262.1|1075131_1075926_-|terminase	terminase small subunit	terminase	H2DE31	Erwinia_phage	40.5	8.6e-37
WP_161523263.1|1075950_1076190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523264.1|1076186_1076390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523265.1|1076412_1076640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523266.1|1076732_1076948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019104412.1|1076944_1077169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162533436.1|1077551_1077800_-	hypothetical protein	NA	A0A0M7REG7	Escherichia_phage	51.8	2.6e-08
WP_161523267.1|1078243_1078642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523268.1|1079377_1079878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523269.1|1079891_1080347_-	crossover junction endodeoxyribonuclease RuvC	NA	G9BW80	Planktothrix_phage	39.7	7.1e-20
WP_161523270.1|1080343_1080685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523271.1|1080681_1082184_-|transposase	IS1 family transposase	transposase	A0A292GAH2	Xanthomonas_phage	43.1	7.1e-101
WP_161523272.1|1082281_1082662_-	DUF1364 family protein	NA	A0A2K8HR56	Pseudomonas_phage	58.3	4.5e-28
WP_161523273.1|1082655_1082808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523274.1|1082804_1083188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523275.1|1083184_1083616_-	recombination protein NinB	NA	A0A1I9KFA6	Aeromonas_phage	43.0	3.2e-22
WP_161523276.1|1083612_1083816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523277.1|1083812_1084046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523278.1|1084146_1085520_-	replicative DNA helicase	NA	H2BD70	Pseudomonas_phage	42.3	2.7e-78
WP_161523279.1|1085516_1086293_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161523280.1|1086289_1086478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523281.1|1086474_1086828_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161523282.1|1086914_1087415_-	adenine methyltransferase	NA	A0A1W6JQI9	Staphylococcus_phage	54.7	1.7e-43
WP_161523283.1|1087380_1088004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523284.1|1088068_1088533_+	hypothetical protein	NA	B7SYH4	Stenotrophomonas_phage	40.8	5.0e-05
>prophage 3
NZ_AP019312	Chromobacterium haemolyticum strain CH06-BL	5307994	1114003	1123499	5307994		Hokovirus(16.67%)	10	NA	NA
WP_085951926.1|1114003_1115587_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.3	6.7e-17
WP_019103541.1|1115673_1116027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019103542.1|1116026_1116482_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.0	8.1e-24
WP_019103543.1|1116687_1117125_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_019103544.1|1117117_1117426_+	RnfH family protein	NA	NA	NA	NA	NA
WP_019103545.1|1117455_1119264_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	2.2e-16
WP_019103546.1|1119343_1119634_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_043591876.1|1119638_1120922_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	63.1	3.2e-150
WP_019103548.1|1121004_1121856_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.7	1.8e-48
WP_019103549.1|1121852_1123499_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.9	1.0e-156
>prophage 4
NZ_AP019312	Chromobacterium haemolyticum strain CH06-BL	5307994	1550970	1559676	5307994	tRNA	uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_019103235.1|1550970_1551297_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	41.2	1.0e-12
WP_019103236.1|1551428_1552544_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.5	1.4e-85
WP_019103237.1|1552956_1554858_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	38.7	3.6e-126
WP_081556240.1|1554899_1555424_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	28.3	2.6e-05
WP_019103239.1|1555591_1555789_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_019103240.1|1555801_1556161_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_019103241.1|1556313_1557297_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.8	1.9e-33
WP_161523436.1|1557318_1559676_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.2	4.0e-05
>prophage 5
NZ_AP019312	Chromobacterium haemolyticum strain CH06-BL	5307994	2382597	2396337	5307994	capsid,terminase	Pseudomonas_phage(20.0%)	14	NA	NA
WP_161523706.1|2382597_2386482_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	22.4	2.0e-38
WP_161524581.1|2386823_2386931_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_161523707.1|2386976_2387804_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	47.7	4.3e-47
WP_162533439.1|2387988_2388519_+	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	48.6	5.4e-27
WP_161523708.1|2388515_2390075_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	73.7	2.8e-233
WP_161523709.1|2390118_2391453_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	38.9	1.2e-78
WP_161523710.1|2391449_2392466_+|capsid	minor capsid protein	capsid	R9TH43	Synechococcus_phage	41.6	6.9e-39
WP_161523711.1|2392462_2392816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161523712.1|2392914_2393700_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	32.0	1.6e-14
WP_161523713.1|2393762_2394707_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	68.2	2.3e-121
WP_161523714.1|2394752_2395082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161523715.1|2395086_2395557_+	hypothetical protein	NA	W6B0V7	Acinetobacter_phage	34.1	1.3e-05
WP_161523716.1|2395558_2395948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161523717.1|2395950_2396337_+	HK97 gp10 family phage protein	NA	A0A088FBW9	Salmonella_phage	41.9	6.9e-16
>prophage 6
NZ_AP019312	Chromobacterium haemolyticum strain CH06-BL	5307994	2873780	2884785	5307994		Hokovirus(14.29%)	9	NA	NA
WP_161523887.1|2873780_2876879_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.9	1.4e-63
WP_081575626.1|2876875_2877976_+	two-component system response regulator	NA	A0A220YL79	Alteromonas_virus	32.3	3.6e-09
WP_146176120.1|2878238_2878682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523888.1|2879860_2880247_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	50.0	2.7e-28
WP_161523889.1|2880246_2881503_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	46.3	4.7e-98
WP_161523890.1|2881499_2881922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523891.1|2881914_2882565_-	SOS response-associated peptidase family protein	NA	C7BGE4	Burkholderia_phage	44.8	2.6e-47
WP_161523892.1|2882612_2883944_+	hypothetical protein	NA	R9TRQ8	Vibrio_phage	31.0	1.8e-34
WP_161523893.1|2884014_2884785_-	phage antirepressor KilAC domain-containing protein	NA	A0A192Y918	Salmonella_phage	55.8	3.1e-23
>prophage 7
NZ_AP019312	Chromobacterium haemolyticum strain CH06-BL	5307994	2900397	2911773	5307994	head,tail,terminase,portal,capsid	Burkholderia_virus(50.0%)	19	NA	NA
WP_161523915.1|2900397_2900748_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_161523916.1|2900744_2901323_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_161523917.1|2901325_2901541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523918.1|2901592_2902915_-|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	60.2	3.6e-141
WP_161523919.1|2903015_2903978_-	S49 family peptidase	NA	A4JX00	Burkholderia_virus	45.1	5.1e-68
WP_161523920.1|2903974_2905240_-|portal	phage portal protein	portal	Q8W6U7	Burkholderia_virus	57.9	3.0e-132
WP_162533440.1|2905239_2905407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523921.1|2905403_2907110_-|terminase	terminase large subunit	terminase	G3EN96	Psychrobacter_phage	50.2	2.8e-162
WP_161523922.1|2907114_2907600_-|terminase	phage terminase small subunit P27 family	terminase	Q8W6V0	Burkholderia_virus	54.4	1.5e-39
WP_161523923.1|2907738_2907933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523924.1|2907932_2908316_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	44.6	1.2e-23
WP_019100044.1|2908315_2908513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523925.1|2908659_2908917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523926.1|2908937_2909186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523927.1|2909187_2909574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523928.1|2909581_2910022_-	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	57.5	3.3e-38
WP_161523929.1|2910021_2910228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161523930.1|2910224_2910827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161524593.1|2910813_2911773_-	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	60.0	6.5e-39
>prophage 8
NZ_AP019312	Chromobacterium haemolyticum strain CH06-BL	5307994	4161711	4206993	5307994	holin,head,tRNA,tail,plate,portal,capsid,integrase	Burkholderia_phage(29.03%)	60	4169399:4169426	4207767:4207794
WP_161524262.1|4161711_4163118_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_043640044.1|4163100_4163433_-	GlpM family protein	NA	NA	NA	NA	NA
WP_161524263.1|4163599_4164529_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_161524264.1|4164599_4166483_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	28.7	5.2e-16
WP_019100624.1|4166479_4168234_-	response regulator	NA	B5LWN0	Feldmannia_species_virus	30.0	1.4e-26
WP_039753958.1|4168266_4168767_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
4169399:4169426	attL	GCAGGTTCGACTCCTGTTCTCTTCCGCC	NA	NA	NA	NA
WP_052052022.1|4169912_4170977_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	61.0	9.8e-121
WP_043591216.1|4170976_4172743_-	oxidoreductase	NA	A0A077K8Q7	Ralstonia_phage	58.9	3.4e-203
WP_043591219.1|4172891_4173701_+|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	50.5	4.2e-63
WP_043591220.1|4173732_4174767_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	57.8	1.1e-108
WP_043591221.1|4174763_4175438_+	hypothetical protein	NA	E5E3S3	Burkholderia_phage	52.9	1.5e-50
WP_043591222.1|4175533_4176007_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	54.2	3.0e-37
WP_152596910.1|4176003_4176222_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	60.6	2.7e-17
WP_043591226.1|4176224_4176605_+	hypothetical protein	NA	A0A1S5NRL1	Burkholderia_phage	52.4	7.0e-21
WP_043591227.1|4176601_4176910_+|holin	phage holin family protein	holin	A0A077KER0	Ralstonia_phage	51.6	4.1e-11
WP_043591230.1|4176924_4177332_+	M15 family metallopeptidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	35.5	5.8e-13
WP_043591233.1|4177331_4177832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043591235.1|4177876_4178080_+	TraR/DksA family transcriptional regulator	NA	A0A193GYU8	Escherichia_phage	47.5	4.9e-05
WP_043591238.1|4178076_4178493_+|tail	phage tail protein	tail	E5E3R4	Burkholderia_phage	40.2	1.8e-22
WP_043591241.1|4178492_4178945_+	phage virion morphogenesis protein	NA	A0A1S5NPT5	Burkholderia_phage	52.7	4.7e-32
WP_052052023.1|4179013_4180153_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_152596901.1|4180278_4181361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043591409.1|4181461_4182106_+|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	42.6	3.7e-22
WP_043591243.1|4182102_4182462_+	GPW/gp25 family protein	NA	A0A077K8R5	Ralstonia_phage	47.4	8.9e-18
WP_043591245.1|4182458_4183373_+|plate	baseplate J/gp47 family protein	plate	F1BUP3	Erwinia_phage	48.6	1.3e-60
WP_043591247.1|4183365_4183929_+|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	41.5	4.8e-10
WP_052052025.1|4183944_4185264_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	47.7	9.3e-20
WP_052052026.1|4185278_4185728_+	hypothetical protein	NA	A0A291LAV4	Bordetella_phage	59.1	1.6e-11
WP_152596902.1|4185788_4185995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081950313.1|4186055_4186592_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043591416.1|4186621_4187794_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	67.9	6.5e-150
WP_043591418.1|4187812_4188322_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	51.5	1.3e-41
WP_043591249.1|4188367_4188676_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	57.0	4.5e-18
WP_174243650.1|4188594_4188804_+|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	54.0	2.8e-11
WP_043591251.1|4188800_4191563_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	46.0	7.8e-170
WP_052052028.1|4191562_4192006_+|tail	phage tail protein	tail	E5E3P8	Burkholderia_phage	61.2	2.7e-40
WP_052052039.1|4192074_4193220_+	phage late control D family protein	NA	A4PE54	Ralstonia_virus	50.4	7.1e-93
WP_043591254.1|4193300_4193579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019101111.1|4193740_4193962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043591422.1|4193985_4194213_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_043591256.1|4194307_4195027_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_043591424.1|4196100_4196754_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_019101107.1|4196785_4197349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152596903.1|4197483_4197690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043591429.1|4198109_4198295_+	CsbD family protein	NA	NA	NA	NA	NA
WP_043591258.1|4198365_4198683_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_019103438.1|4198777_4198939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161524265.1|4199088_4199565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152596904.1|4199792_4200170_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_052052031.1|4200272_4200647_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052052032.1|4200647_4200962_-	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	45.3	8.1e-15
WP_043591259.1|4201046_4201262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081950316.1|4201323_4201770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019102738.1|4201773_4201998_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_019102739.1|4202085_4202232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043591261.1|4202246_4202624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081950317.1|4202620_4204894_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	35.1	1.4e-71
WP_043591265.1|4205131_4205491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043591267.1|4205608_4205842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043591269.1|4205796_4206993_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	40.1	4.4e-69
4207767:4207794	attR	GCAGGTTCGACTCCTGTTCTCTTCCGCC	NA	NA	NA	NA
>prophage 9
NZ_AP019312	Chromobacterium haemolyticum strain CH06-BL	5307994	4237680	4246756	5307994		Caulobacter_phage(16.67%)	11	NA	NA
WP_043591294.1|4237680_4239465_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.0	2.8e-72
WP_039756348.1|4239511_4239958_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	3.2e-25
WP_039756346.1|4240147_4240360_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_019103872.1|4240489_4241284_-	thiazole synthase	NA	NA	NA	NA	NA
WP_019103871.1|4241310_4241514_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_019103870.1|4241515_4243672_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9L285	Tupanvirus	36.2	2.1e-08
WP_019103869.1|4243692_4243899_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_081574132.1|4244016_4244643_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.8	1.8e-21
WP_161524270.1|4244639_4244810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114155119.1|4244808_4246104_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.4	1.2e-59
WP_019103866.1|4246207_4246756_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.9	5.2e-33
>prophage 10
NZ_AP019312	Chromobacterium haemolyticum strain CH06-BL	5307994	4854259	4914471	5307994	plate,tRNA,tail,protease	Burkholderia_phage(25.0%)	56	NA	NA
WP_081574757.1|4854259_4855303_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_019100934.1|4856001_4859181_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_019100935.1|4859219_4860518_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.3	7.9e-56
WP_019100936.1|4860514_4861702_-	amidohydrolase	NA	NA	NA	NA	NA
WP_019100937.1|4861866_4862814_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161524421.1|4862871_4866684_-	translocation/assembly module TamB domain-containing protein	NA	NA	NA	NA	NA
WP_039754324.1|4866697_4868440_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_081544961.1|4868773_4870573_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.3	1.0e-37
WP_043636764.1|4870687_4872331_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_043589451.1|4872451_4875115_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_161524422.1|4875427_4876864_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_019101324.1|4876921_4878646_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_039754728.1|4878642_4879071_-	membrane protein	NA	NA	NA	NA	NA
WP_107732102.1|4879073_4879505_-	YeeE/YedE	NA	NA	NA	NA	NA
WP_043636749.1|4879501_4879819_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039754726.1|4880023_4881016_+	DUF2804 domain-containing protein	NA	NA	NA	NA	NA
WP_039754719.1|4881277_4881856_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_051002610.1|4881824_4882499_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_019101317.1|4882672_4883041_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_019101316.1|4883259_4883730_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_019101315.1|4883749_4883905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019101314.1|4883901_4884198_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_019101313.1|4884531_4885845_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_174243674.1|4885867_4886077_+	SlyX family protein	NA	NA	NA	NA	NA
WP_039754717.1|4886089_4886662_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_019101310.1|4886658_4887573_-	EamA family transporter	NA	NA	NA	NA	NA
WP_161524423.1|4887631_4888834_+	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_039754722.1|4888918_4889740_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_019101307.1|4890073_4890892_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	1.5e-23
WP_107732104.1|4890884_4891670_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_019103827.1|4891681_4892155_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_019103826.1|4892244_4892874_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019103825.1|4892873_4893173_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_118268442.1|4893189_4893999_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_043589429.1|4894071_4894407_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_019103822.1|4894478_4895732_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_081574739.1|4895738_4895987_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_019103820.1|4896008_4896764_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_161524424.1|4896760_4897666_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	33.5	9.8e-21
WP_039754261.1|4897752_4898400_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081574821.1|4898602_4899787_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_043589423.1|4899806_4902953_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_161524425.1|4902945_4904346_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_161524426.1|4904410_4904704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043589418.1|4904719_4905463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052051910.1|4905717_4905936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161524427.1|4906048_4906738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161524428.1|4906932_4907619_-|tail	phage tail protein	tail	B0ZSG1	Halomonas_phage	44.4	1.0e-22
WP_052051867.1|4907615_4908272_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	54.2	5.8e-23
WP_161524429.1|4908264_4909410_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	47.4	1.4e-85
WP_161524430.1|4909516_4910104_-|tail	phage tail protein	tail	A4PE47	Ralstonia_virus	45.8	8.9e-23
WP_052370664.1|4910134_4911691_-|tail	phage tail protein	tail	A0A0A7RTP0	Clostridium_phage	53.6	8.6e-41
WP_161524431.1|4911721_4912351_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	45.7	1.9e-18
WP_043589406.1|4912347_4912731_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	58.4	1.4e-32
WP_118268450.1|4913113_4913563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081950238.1|4913667_4914471_-	nucleotidyltransferase domain-containing protein	NA	Q8SCS5	Pseudomonas_phage	40.2	1.3e-32
>prophage 11
NZ_AP019312	Chromobacterium haemolyticum strain CH06-BL	5307994	4992031	5016626	5307994	plate,tRNA,tail	Mannheimia_phage(22.73%)	29	NA	NA
WP_161524457.1|4992031_4992679_+|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_161524458.1|4992888_4993473_-|tail	tail fiber assembly protein	tail	A4PE47	Ralstonia_virus	47.4	1.3e-21
WP_161524459.1|4993483_4994515_-|tail	tail fiber protein	tail	A0A077K818	Ralstonia_phage	37.6	5.9e-38
WP_161524460.1|4994754_4995339_-|tail	tail fiber assembly protein	tail	A0A067ZI91	Vibrio_phage	35.8	3.3e-09
WP_174243676.1|4995349_4995781_-|tail	tail fiber protein	tail	A0A077K818	Ralstonia_phage	43.2	4.7e-21
WP_161524462.1|4996417_4997425_-	hypothetical protein	NA	A0A0M3LRW6	Mannheimia_phage	42.7	1.0e-10
WP_019100230.1|4997588_4997915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161524463.1|4998371_4999778_-	hypothetical protein	NA	A0A0M3LRW6	Mannheimia_phage	48.0	3.8e-11
WP_019102046.1|4999805_4999958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161524464.1|5000060_5000639_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	43.6	1.5e-35
WP_161524465.1|5000635_5001700_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	45.9	6.0e-78
WP_019102042.1|5001699_5002050_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	58.6	7.1e-28
WP_081575098.1|5002159_5002783_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	52.1	3.6e-38
WP_081575109.1|5002803_5003817_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	39.1	1.7e-61
WP_019102039.1|5003845_5005153_-	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	29.4	1.8e-36
WP_161524466.1|5005152_5007021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019104097.1|5007257_5007632_-	hypothetical protein	NA	F6MIK8	Haemophilus_phage	55.0	1.5e-28
WP_161524467.1|5007785_5009207_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	46.9	9.1e-98
WP_161524468.1|5009282_5009981_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_019102037.1|5010097_5011345_-|tail	tail fiber protein	tail	A0A088FQW7	Escherichia_phage	35.8	2.8e-10
WP_019102036.1|5011502_5011718_-	hypothetical protein	NA	A0A0M4TUU4	Ralstonia_phage	51.7	5.9e-09
WP_043589247.1|5011732_5011930_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_052051851.1|5011926_5012505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043589930.1|5012504_5012726_-	hypothetical protein	NA	A0A0M4UKB4	Ralstonia_phage	50.0	2.3e-08
WP_019102032.1|5012725_5013148_-	M15 family metallopeptidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	34.7	1.3e-12
WP_019102031.1|5013287_5013701_-	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	38.5	9.6e-16
WP_043589245.1|5014030_5014750_+	helix-turn-helix transcriptional regulator	NA	A0SML1	Pseudomonas_virus	28.4	1.1e-19
WP_043589243.1|5014943_5015528_+	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	32.9	1.7e-10
WP_043589241.1|5015690_5016626_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.4	1.4e-22
>prophage 12
NZ_AP019312	Chromobacterium haemolyticum strain CH06-BL	5307994	5188031	5243837	5307994	transposase,tail,protease	Burkholderia_virus(30.77%)	43	NA	NA
WP_161524507.1|5188031_5188601_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	40.6	2.4e-25
WP_161524508.1|5189305_5190037_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_043593407.1|5190220_5190901_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_161524509.1|5190917_5191610_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_161524510.1|5191645_5194114_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_019099931.1|5194284_5194839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043593345.1|5194981_5195635_-	response regulator	NA	NA	NA	NA	NA
WP_161524511.1|5195709_5198937_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.2	2.5e-34
WP_161524512.1|5199070_5201881_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	31.1	1.9e-46
WP_043593342.1|5202551_5203376_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161524513.1|5203512_5204715_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_039753121.1|5204751_5206377_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_043593401.1|5206776_5207283_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_019099904.1|5207351_5207609_-	YjhX family toxin	NA	NA	NA	NA	NA
WP_043593337.1|5207812_5208382_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_019103120.1|5209014_5210631_+	YadA-like family protein	NA	NA	NA	NA	NA
WP_019103121.1|5210674_5211109_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_161524514.1|5211256_5213467_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_043641048.1|5213809_5214043_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043593326.1|5214052_5214613_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_019103998.1|5215212_5215638_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_019103999.1|5215787_5217389_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_161524515.1|5217473_5217719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019104001.1|5217852_5219133_+	enterobactin transporter EntS	NA	NA	NA	NA	NA
WP_161524516.1|5220222_5220672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161524517.1|5220939_5222376_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.2e-14
WP_019102317.1|5222372_5222930_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.3	1.0e-28
WP_161524518.1|5223140_5224982_-	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_161524519.1|5225194_5225875_-	Fe2+-dependent dioxygenase	NA	A0A1D8KIR1	Synechococcus_phage	27.5	4.6e-07
WP_161524520.1|5226076_5228269_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_019101956.1|5228611_5229022_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_039755192.1|5229008_5229686_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_161524521.1|5229682_5230390_-	TonB family protein	NA	NA	NA	NA	NA
WP_043593311.1|5230615_5231191_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_161524522.1|5231244_5232588_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	32.2	5.9e-46
WP_161524523.1|5232648_5233971_-	MFS transporter	NA	NA	NA	NA	NA
WP_141113190.1|5239524_5239893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019103893.1|5240158_5240506_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	68.6	3.3e-33
WP_161524524.1|5240746_5241208_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	40.9	7.7e-22
WP_043639092.1|5241204_5241402_+	hypothetical protein	NA	A4JWK4	Burkholderia_virus	58.7	2.2e-10
WP_043639095.1|5241404_5242841_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	72.2	3.0e-197
WP_043592621.1|5242843_5243368_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	79.9	8.6e-78
WP_019101636.1|5243582_5243837_+|tail	phage tail assembly protein	tail	A4JWK7	Burkholderia_virus	48.8	1.2e-13
