The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047141	Lactobacillus sp. P38 chromosome, complete genome	1906794	413054	420003	1906794		Enterococcus_phage(66.67%)	7	NA	NA
WP_010688506.1|413054_414005_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	68.4	4.1e-126
WP_066023502.1|414020_416192_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	62.1	1.3e-257
WP_035448459.1|416181_416556_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1W6JK40	Lactococcus_phage	43.7	6.2e-14
WP_004051414.1|416552_416783_-	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	39.0	8.0e-12
WP_035448457.1|416951_417539_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	50.9	5.4e-28
WP_066023497.1|417778_418954_+	acetate kinase	NA	NA	NA	NA	NA
WP_035448453.1|419031_420003_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SKK7	Klosneuvirus	31.5	1.1e-33
>prophage 2
NZ_CP047141	Lactobacillus sp. P38 chromosome, complete genome	1906794	1055767	1064900	1906794	integrase	Streptococcus_phage(50.0%)	13	1055670:1055708	1071330:1071368
1055670:1055708	attL	CTATTCAGCATAATATTAACCAGCTTCAAAGTCAAGCCT	NA	NA	NA	NA
WP_066023948.1|1055767_1056898_-|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	36.0	1.5e-55
WP_066023949.1|1057435_1058272_-	helix-turn-helix transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	39.4	1.8e-05
WP_066023950.1|1058402_1058594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066023951.1|1058615_1059398_+	hypothetical protein	NA	Q9AZJ5	Lactococcus_phage	30.0	5.3e-15
WP_066023952.1|1059381_1059669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066023953.1|1059741_1060581_+	helix-turn-helix domain-containing protein	NA	E9LUL6	Lactobacillus_phage	37.8	1.3e-14
WP_066023955.1|1060965_1061331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066023956.1|1061311_1061620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066023957.1|1061714_1062092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066023958.1|1062094_1062337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066023959.1|1062356_1062707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066023960.1|1062703_1063507_+	hypothetical protein	NA	I7A9C3	Enterococcus_phage	30.6	7.4e-20
WP_066023961.1|1063487_1064900_+	DNA primase	NA	A7J282	Streptococcus_phage	25.4	2.8e-38
1071330:1071368	attR	CTATTCAGCATAATATTAACCAGCTTCAAAGTCAAGCCT	NA	NA	NA	NA
>prophage 3
NZ_CP047141	Lactobacillus sp. P38 chromosome, complete genome	1906794	1295768	1354597	1906794	protease,tail,head,capsid,portal,holin,terminase	Erysipelothrix_phage(62.07%)	58	NA	NA
WP_066024040.1|1295768_1296644_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_066024041.1|1296811_1297648_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_066024042.1|1297707_1298715_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	45.2	4.4e-62
WP_066024043.1|1298903_1299551_+	nitrobenzoate reductase	NA	NA	NA	NA	NA
WP_066024044.1|1299606_1300032_-	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	42.0	3.3e-27
WP_066024045.1|1300099_1300462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005922582.1|1301277_1301544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143452063.1|1301637_1301805_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_033193012.1|1302184_1302487_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_010689503.1|1302455_1302716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010689504.1|1302978_1303404_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_035447435.1|1303418_1304408_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_143452064.1|1304404_1305403_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_035447438.1|1305412_1306330_-	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035447624.1|1306342_1307128_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	30.6	1.8e-18
WP_083213898.1|1308140_1308731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052006330.1|1308974_1309250_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016174972.1|1309494_1309728_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_066024046.1|1309790_1311638_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.1	6.3e-99
WP_005917836.1|1311688_1311991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066024047.1|1312176_1312926_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_066024048.1|1315050_1318170_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.4	4.4e-68
WP_000691721.1|1318578_1320498_-	tetracycline resistance ribosomal protection protein Tet(W)	NA	E4ZFJ7	Streptococcus_phage	100.0	0.0e+00
WP_066024049.1|1321980_1322943_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_066024050.1|1322932_1324465_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	30.0	3.2e-56
WP_066024051.1|1324492_1326316_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_066024052.1|1326308_1326752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066024053.1|1326741_1327773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066024054.1|1328156_1328687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066024055.1|1328763_1328964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066024056.1|1328950_1329259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066024057.1|1329258_1330398_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	52.8	7.5e-111
WP_066024116.1|1330378_1330963_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	63.4	1.2e-59
WP_066024058.1|1331017_1332952_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	61.0	7.7e-233
WP_066024059.1|1333052_1333481_+	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	35.4	1.2e-21
WP_066024060.1|1333477_1335736_+	DNA primase	NA	A0A1X9I6B6	Streptococcus_phage	48.7	1.5e-211
WP_066024061.1|1335980_1336262_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	60.0	1.1e-23
WP_066024062.1|1336242_1337601_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	67.8	1.3e-157
WP_066024063.1|1337597_1338068_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_083213901.1|1338210_1338588_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	56.4	1.3e-35
WP_066024064.1|1338730_1339273_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	62.1	1.9e-59
WP_066024065.1|1339272_1340514_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	64.1	9.3e-155
WP_066024066.1|1340576_1341227_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	42.9	1.6e-41
WP_066024067.1|1341247_1341454_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_083213904.1|1341555_1343121_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	78.2	9.6e-250
WP_083213902.1|1343117_1344377_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	64.6	1.6e-154
WP_066024069.1|1344373_1345048_+|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	55.1	9.1e-56
WP_066024070.1|1345067_1346258_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	58.5	2.6e-130
WP_066024071.1|1346268_1346565_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1X9I695	Streptococcus_phage	40.9	1.3e-06
WP_066024072.1|1346564_1346954_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_066024073.1|1346958_1347366_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	62.3	1.2e-37
WP_143452067.1|1347377_1348277_+	1,4-beta-N-acetylmuramidase	NA	Q0SPG7	Clostridium_phage	34.7	2.3e-14
WP_161517660.1|1348378_1348546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066024074.1|1348608_1350126_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	40.8	4.8e-105
WP_066024075.1|1350131_1350545_+	hypothetical protein	NA	A0A2K5B2B3	Erysipelothrix_phage	37.7	4.3e-16
WP_066024076.1|1350545_1352126_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	49.0	3.1e-131
WP_066024077.1|1352175_1353033_-	Mrr restriction system protein	NA	NA	NA	NA	NA
WP_066024078.1|1353217_1354597_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	48.9	1.4e-122
