The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045522	Shigella flexneri strain 5908.2 chromosome, complete genome	4549591	932033	1011263	4549591	plate,transposase,tRNA	Shigella_phage(33.33%)	61	NA	NA
WP_161550544.1|932033_933332_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|933380_933641_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|933627_933828_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|933993_934539_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635531.1|934535_934958_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239155.1|934971_935682_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_025759217.1|935836_936661_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|936713_938432_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094029.1|938542_939250_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202325.1|939246_939651_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|939768_940584_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|940623_941277_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593997.1|941269_942301_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|942488_943064_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_152030441.1|948821_949625_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.1e-38
WP_001230983.1|952198_952999_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211684.1|953076_953847_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|953894_955253_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052755.1|955324_956080_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_025759002.1|956113_956836_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|956832_957300_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001366128.1|957364_958096_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000402248.1|958435_959482_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_075288131.1|959492_960368_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001276640.1|962383_962878_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000183809.1|962874_963705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000950657.1|963691_964069_-	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000804009.1|964305_964605_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_173020723.1|964702_965915_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.7e-169
WP_025757874.1|967313_967700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005053237.1|970426_970834_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_128567422.1|974263_974467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152061091.1|975305_975581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139559.1|975988_976759_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532697.1|976912_977386_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_161550546.1|977428_979873_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|980111_980690_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333379.1|980895_981663_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225676.1|981633_982374_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000006251.1|983454_983952_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000952758.1|984168_985908_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207560.1|985852_986638_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226172.1|986708_987764_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554759.1|987815_988109_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263492.1|988111_988531_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059862.1|989295_989748_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025759252.1|991770_993228_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|993489_993948_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189558.1|994039_995284_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|995341_995743_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749862.1|995781_996837_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.5e-118
WP_001285280.1|997124_998228_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	8.2e-62
WP_000893267.1|998239_999493_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_000747032.1|1000736_1001905_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000287051.1|1002954_1003215_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	96.5	1.8e-36
WP_024261189.1|1004425_1005049_+	hypothetical protein	NA	A0A088CQ58	Enterobacteria_phage	74.9	2.3e-77
WP_000688544.1|1005115_1006381_-	hypothetical protein	NA	Q05056	Shigella_phage	100.0	1.9e-235
WP_000703648.1|1006393_1007311_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	96.7	3.5e-167
WP_000915539.1|1007307_1007670_-	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	90.0	2.1e-54
WP_000747032.1|1009073_1010242_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_001524120.1|1010345_1011263_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	99.7	4.4e-170
>prophage 2
NZ_CP045522	Shigella flexneri strain 5908.2 chromosome, complete genome	4549591	1179148	1250852	4549591	transposase,tail,tRNA	Shigella_phage(43.75%)	54	NA	NA
WP_001158007.1|1179148_1180243_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460142.1|1180311_1181238_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|1181467_1181950_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1182027_1182843_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096884.1|1182932_1184714_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	6.0e-38
WP_024260233.1|1186443_1187676_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000855389.1|1188322_1189216_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815547.1|1189352_1190420_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_005052935.1|1190416_1190926_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|1191043_1191766_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256011.1|1191768_1192263_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|1192436_1193822_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143547.1|1193857_1194379_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1194486_1194699_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|1194700_1195567_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1196047_1196590_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988387.1|1196790_1197483_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_025758772.1|1199116_1199878_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224555.1|1200060_1200951_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_119182149.1|1200951_1203924_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_040236460.1|1203910_1206148_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_025757980.1|1207074_1208517_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770953.1|1208506_1209190_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_171763885.1|1210543_1211772_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.9e-176
WP_025758469.1|1215750_1217127_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_025758468.1|1217194_1218442_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_025758467.1|1218549_1219203_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360957.1|1219296_1219665_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682518.1|1219729_1219978_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_025758466.1|1220043_1221162_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_173020725.1|1222072_1223229_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.7	7.5e-66
WP_094110470.1|1223587_1224756_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	8.9e-184
WP_000002447.1|1227519_1228422_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005073221.1|1228631_1229378_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_000052796.1|1229749_1230313_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_001313644.1|1230557_1232123_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	7.6e-45
WP_000276167.1|1232243_1232672_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.9e-19
WP_000089727.1|1234360_1234771_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_005066726.1|1234999_1235806_-	ribonuclease I	NA	NA	NA	NA	NA
WP_000050319.1|1235919_1237383_-	citrate/succinate antiporter CitT	NA	NA	NA	NA	NA
WP_000062460.1|1237433_1238312_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_000550398.1|1238286_1238838_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_005066735.1|1238841_1240374_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_000622357.1|1240384_1241293_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_000700703.1|1241289_1241586_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_000497905.1|1241600_1242659_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_000126490.1|1244665_1245049_+	response regulator	NA	NA	NA	NA	NA
WP_000514021.1|1245124_1245820_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	98.3	5.2e-131
WP_001311352.1|1245770_1245959_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	98.4	3.7e-31
WP_071993817.1|1246052_1246250_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	100.0	2.0e-24
WP_005066757.1|1246343_1247099_+	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	91.0	3.7e-130
WP_000972106.1|1248106_1248634_+|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	92.6	7.1e-88
WP_000972124.1|1248662_1249196_-|tail	tail fiber assembly protein	tail	A0A0C4UQZ5	Shigella_phage	97.7	3.5e-95
WP_173020726.1|1249695_1250852_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	1.2e-66
>prophage 3
NZ_CP045522	Shigella flexneri strain 5908.2 chromosome, complete genome	4549591	1386661	1443414	4549591	integrase,transposase,tail,terminase	Enterobacteria_phage(37.5%)	38	1400575:1400634	1443409:1444719
WP_075328310.1|1386661_1387105_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	48.7	8.4e-34
WP_001277359.1|1388840_1389137_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	83.5	6.2e-41
WP_005066385.1|1389114_1390476_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	83.1	2.7e-171
WP_171763907.1|1390983_1392196_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	9.3e-168
WP_025757756.1|1394659_1394938_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	94.5	4.6e-46
WP_000814621.1|1394934_1395345_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	8.0e-71
WP_001254220.1|1395341_1395518_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_000147081.1|1395559_1395868_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	98.0	3.5e-47
WP_032156969.1|1395857_1396187_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	94.3	1.6e-42
WP_119176018.1|1396211_1397069_+	Rha family phage regulatory protein	NA	S5MQL6	Escherichia_phage	77.0	6.5e-115
WP_000618004.1|1397065_1397299_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	51.4	5.1e-14
WP_000988187.1|1398203_1399082_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	7.8e-140
1400575:1400634	attL	TGAACCGCCCCGGGAATCCTGGAGACTAAACTTCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_171763904.1|1400628_1401841_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.9e-168
WP_161550562.1|1403632_1404307_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.1	9.9e-10
WP_011069285.1|1404645_1405158_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_152030432.1|1405352_1406117_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	53.8	5.9e-11
WP_005073316.1|1406067_1406751_+|terminase	PBSX family phage terminase large subunit	terminase	K4NXU1	Acinetobacter_phage	73.4	3.1e-96
WP_088895425.1|1406826_1408054_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000586905.1|1408091_1408217_+	DUF2737 family protein	NA	A0A1V0E5L8	Salmonella_phage	100.0	8.4e-16
WP_000034209.1|1408213_1408438_+	ead/Ea22-like family protein	NA	A0A1I9LJV0	Stx_converting_phage	93.8	2.8e-30
WP_000747032.1|1408412_1409581_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_025758499.1|1409763_1410834_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.1e-201
WP_001091541.1|1410968_1412252_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_000593939.1|1412392_1414573_-	hydratase	NA	NA	NA	NA	NA
WP_025759641.1|1417089_1418142_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_119182165.1|1420096_1421092_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_161550563.1|1423389_1424007_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	4.5e-78
WP_094099498.1|1424072_1425228_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	3.0e-67
WP_000447263.1|1425979_1426309_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	96.3	8.9e-57
WP_025758205.1|1426308_1427007_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.2	1.9e-120
WP_000194737.1|1427011_1427755_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_152030413.1|1431901_1432501_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.4e-103
WP_161550566.1|1433926_1434550_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	7.8e-78
WP_000805588.1|1434729_1436493_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_047563448.1|1438477_1439884_+	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	56.3	2.4e-130
WP_005067134.1|1439883_1441725_+	hypothetical protein	NA	A0A192Y934	Salmonella_phage	74.2	4.5e-246
WP_047563444.1|1441856_1442198_+|tail	tail protein	tail	A0A088CQ58	Enterobacteria_phage	96.0	5.4e-49
WP_171763904.1|1442200_1443414_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.9e-168
1443409:1444719	attR	AGTCATCCTGTTTACCTCTTTCTCAGGAAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCAGTTCTATTTTCCGAATTTGCTGAAGTATGACCCTGATCAGTTCGGTCCGGATTTAATTGAGCAACTAGCTCAATCCGGTAAGTATTCGCAGGATAACACCAAAGGCGATGCCATGATTGGCGTCAAGCAGCCTTTACCAAAAGCAGTTTTAAGAACTCAGCATGACAAAAATAAAGAAGCAATAAGTATCCTGGATTTTGGTGTTATTGATGATGGTGTGACAGATAATTACCAGGCAATACAAAATGCAATAGATGCCGTTGCTTCACTACCCTCCGGCGGGGAGCTGTTTATCCCTGCGAGCAACCAAGCGGTGGGGTATATTGTTGGATCCACTTTGCTTATTCCTGGCGGTGTTAACATCAGAGGGGTTGGTAAGGCATCGCAACTCCGAGCAAAAAGCGGACTTACAGGATCTGTGTTAAGGCTGTCTTATGATTCAGACACTATCGGCCGTTATCTGAGAAATATACGAGTAACTGGTAATAACACCTGCAATGGTATTGACACAAACATTACAGCAGAAGACTCTGTCATCAGACAGGTTTATGGCTGGGTATTTGATAATGTAATGGTGAATGAAGTTGAAACCGCTTATTTAATGCAAGGGCTCTGGCACTCAAAATTTATAGCATGTCAGGCTGGAACCTGTAGAGTCGGTCTTCACTTTTTAGGCCAGTGCGTAAGTGTTAGTGTCAGCTCCTGCCATTTCAGCAGAGGAAATTATTCTGCTGATGAAAGCTTTGGCATCAGGATTCAGCCTCAAACGTATGCGTGGTCGTCAGAGGCAGTTAGGTCAGAAGCAATAATTTTAGACAGTGAGACCATGTGCATTGGTTTTAAAAATGCCGTCTATGTTCATGATTGCCTTGATTTGCATATGGAACAACCGGATTTAGATTATTGCGGTTCAACAGGCGTGGTTATAGAGAATGTAAACGGAGGATTTTCTTTCTCAAACTCATGGATAGCAGCAGATGCCGATGGCACTGAACAATTTACGGGGATATATTTTAGAACGCCGACCTCAACGCAGTCACATAAAATTGTCAGTGGTGTTCATATCAACACTGCAAACAAAAACACGGCTGCAAACAATCAAAGTATAGCGATAGAACAGTCGGCGATCTTCGTCTTTGTAAGTGGTTGTACGTTAACTGGTGATGAATGGGCTGTAAATATTGTCGACATCAATGAATGTGTTTCTTTCGATAAGTGCATATTCAATAAGCCTCTATGCTATCTTCGTAG	NA	NA	NA	NA
>prophage 4
NZ_CP045522	Shigella flexneri strain 5908.2 chromosome, complete genome	4549591	1640505	1708196	4549591	protease,transposase,holin,tRNA	Stx2-converting_phage(38.46%)	55	NA	NA
WP_000117881.1|1640505_1641906_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|1642074_1643277_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193850.1|1643542_1646155_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_119182121.1|1646361_1647129_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	3.7e-29
WP_000055960.1|1647784_1648930_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_025758719.1|1648926_1649886_-	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_001263928.1|1649878_1650454_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_171803710.1|1651282_1651753_-	fimbrial protein	NA	NA	NA	NA	NA
WP_025758228.1|1655825_1656896_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000730630.1|1656907_1657450_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000919489.1|1657457_1657973_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001111451.1|1657938_1658676_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_001370288.1|1658786_1659797_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_004991542.1|1659970_1660513_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224274.1|1660509_1661619_-	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_025758232.1|1661862_1663971_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_025758233.1|1666019_1667273_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000445541.1|1667277_1668918_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759120.1|1668914_1669478_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000828648.1|1669733_1669901_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_005074171.1|1669970_1670489_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156487.1|1670557_1672318_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1672502_1672955_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_005047463.1|1673030_1674077_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288715.1|1674432_1674942_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1675160_1675790_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875052.1|1675752_1677915_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1677924_1678371_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420536.1|1678493_1680548_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_000424181.1|1680579_1681038_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1681133_1681796_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1681968_1682382_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1682426_1682744_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1682801_1683992_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048219.1|1684086_1684365_+	acylphosphatase	NA	NA	NA	NA	NA
WP_025758239.1|1684361_1684691_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1684781_1685441_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_025758242.1|1686160_1687279_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001186413.1|1689069_1689777_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003657.1|1689773_1690361_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063973.1|1690357_1690756_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004911.1|1690752_1691610_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263563.1|1691743_1693288_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460803.1|1693299_1694436_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270304.1|1694447_1694540_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_005061766.1|1694619_1695918_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_001088287.1|1696346_1697021_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_161550575.1|1697017_1697365_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	1.6e-43
WP_161550577.1|1699079_1700247_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	7.6e-183
WP_047563296.1|1700480_1700978_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	3.2e-90
WP_005067459.1|1700977_1701193_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	90.1	9.4e-31
WP_000111770.1|1703385_1703577_-	protein ninH	NA	A0A088CC23	Shigella_phage	73.3	4.3e-19
WP_001088287.1|1703939_1704614_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_000631709.1|1704610_1704958_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	4.1e-44
WP_161550639.1|1707008_1708196_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP045522	Shigella flexneri strain 5908.2 chromosome, complete genome	4549591	1721672	1781874	4549591	integrase,transposase	Stx2-converting_phage(23.08%)	50	1774358:1774417	1784607:1785374
WP_161550640.1|1721672_1722860_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000124119.1|1722859_1723225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611845.1|1723422_1724409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279879.1|1724775_1725993_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	1.7e-44
WP_005067490.1|1726162_1727692_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000070931.1|1727663_1727951_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001258873.1|1728051_1729887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000282110.1|1731261_1731825_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_042196155.1|1731931_1732138_+	helicase	NA	NA	NA	NA	NA
WP_001189109.1|1733875_1735384_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	1.4e-43
WP_001415943.1|1737280_1737436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053884943.1|1737540_1738611_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203522.1|1738607_1739513_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000544701.1|1739509_1741894_-	dynamin family protein	NA	NA	NA	NA	NA
WP_005061994.1|1742111_1742984_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000250228.1|1743068_1743986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813456.1|1745185_1745788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235221.1|1745882_1746089_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840364.1|1746229_1746496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001344112.1|1746796_1746973_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_088895425.1|1747439_1748667_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000221544.1|1749053_1749623_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270978.1|1749882_1750284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|1750271_1750706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001282144.1|1751051_1751441_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	98.4	3.9e-67
WP_000612632.1|1751437_1751785_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
WP_000998091.1|1751834_1753220_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.0e-258
WP_000823243.1|1753458_1754817_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|1755549_1755807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|1756724_1757246_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|1757242_1758196_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188248.1|1758282_1760607_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879153.1|1760651_1761554_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125175.1|1761550_1762549_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|1762545_1763502_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|1763502_1764270_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|1764827_1765085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160371899.1|1766549_1767392_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000428546.1|1770445_1771039_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|1771151_1772357_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088605.1|1772438_1773062_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|1773039_1773726_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|1773733_1774120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049802299.1|1774112_1774376_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
1774358:1774417	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_000412211.1|1775348_1776008_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|1776208_1776586_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|1776652_1779619_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|1779621_1780182_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|1780307_1780658_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|1780860_1781874_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
1784607:1785374	attR	GACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCCGAATTTATGTTGAATTTACTGTTCCATTTAAAAATGAATGGACGACAGTTCTGTTGGTTGATTGTGGGGTCTGGTTCACCTGAACTGCGGGAACATTTACAGTATCAGATTGACAGTATGGGCATGCATGATGATGTTTTTATTGCTGACAATGTTTTTCCTGCCGCCCCCGTATATCGGGTTGCCAGTCTGGTGGTTCTGCCTTCAGAAAACGAATCTTTTGGTATGGTGCTGGCAGAAGCATCGGCATTTTCTGTGCCTGTAGTGGCCACTCAGATTGGTGGAATCCCTGAGGTTATTCAGAACAACCAGACCGGGACATTGTTACCAGCAAGTAATAAGCACGCATGGATGTGCGCCCTGAATGATTTTTTTAATGACCCTGGGCGTTTTTATCAGATGGCTCGCCTGGCAAAACAGGATATAGAAGAGCGGTTTGATATTAATAAAACTGCGTTAAAAATACTCACATTAGCGAAGCAAAAGTAACAATATGTTTTCTATAAGTAACTTATCATTTATCGGTTTCCTTAAAAGGATTATTTTTTCCTCAGATTCACTACCGGGGAAGTGGGAACACAGAAAATTTCGGTTCATGTACATTTTGCGATGTTCTATAAATCCGGTTGTCAGTATTCGATATTATTATGAACTGCGTTCCTTGCCGTGCATTGAGGATATTCTGGCAATACACCCCACGTTGCCAG	NA	NA	NA	NA
>prophage 6
NZ_CP045522	Shigella flexneri strain 5908.2 chromosome, complete genome	4549591	1892294	1905423	4549591	head,terminase,capsid,integrase,tail,portal,protease	uncultured_Caudovirales_phage(91.67%)	20	1882573:1882587	1901254:1901268
1882573:1882587	attL	ACTGAATAACCGCAT	NA	NA	NA	NA
WP_000085257.1|1892294_1893524_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_000953271.1|1893898_1894087_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_005067819.1|1894144_1894891_+	hypothetical protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	51.0	1.4e-12
WP_024260618.1|1894899_1895100_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_005005155.1|1895089_1895311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204964.1|1895525_1895759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770157.1|1895764_1896064_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761799.1|1896060_1897809_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.3	7.3e-89
WP_000557476.1|1898088_1898367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294165.1|1898363_1898669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126701.1|1898678_1898840_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_025758364.1|1899142_1900300_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	6.2e-137
WP_000504059.1|1900339_1900912_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	2.3e-60
WP_000267614.1|1900913_1902125_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.0	1.8e-187
1901254:1901268	attR	ATGCGGTTATTCAGT	NA	NA	NA	NA
WP_001020662.1|1902121_1902460_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000134108.1|1902456_1902753_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	63.3	4.4e-31
WP_001145905.1|1902752_1903193_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|1903176_1903359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025758361.1|1903481_1903838_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.5	2.1e-51
WP_025758359.1|1903821_1905423_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.3	1.2e-268
>prophage 7
NZ_CP045522	Shigella flexneri strain 5908.2 chromosome, complete genome	4549591	2150682	2313436	4549591	transposase,holin	Escherichia_phage(29.79%)	121	NA	NA
WP_173020731.1|2150682_2151838_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_025760003.1|2156195_2157836_+	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_025760001.1|2157873_2158797_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000375966.1|2160580_2162236_+	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001296778.1|2162375_2162600_+	YdcH family protein	NA	NA	NA	NA	NA
WP_000140884.1|2162662_2163199_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001234070.1|2163193_2164174_-	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_005047890.1|2164297_2165290_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586723.1|2165286_2165880_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001261020.1|2166182_2166851_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000555458.1|2170493_2171288_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000867989.1|2172944_2173754_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	5.9e-17
WP_001303494.1|2174155_2174251_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_000061178.1|2174445_2174619_+	orphan toxin OrtT	NA	NA	NA	NA	NA
WP_001076539.1|2174937_2175387_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000027563.1|2175383_2175902_-	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
WP_162943461.1|2176060_2177288_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	1.9e-176
WP_025758818.1|2177418_2178456_+	NADPH-dependent curcumin/dihydrocurcumin reductase	NA	NA	NA	NA	NA
WP_005068010.1|2178653_2179319_+	colanic acid/biofilm transcriptional regulator McbR	NA	NA	NA	NA	NA
WP_000631709.1|2180501_2180849_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	4.1e-44
WP_005065617.1|2180868_2182470_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.2e-147
WP_000124119.1|2183371_2183737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119182145.1|2190127_2191459_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_064734200.1|2191568_2191970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000768386.1|2192994_2194095_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	64.8	3.5e-137
WP_000198219.1|2194353_2195235_-	aromatic amino acid efflux DMT transporter YddG	NA	NA	NA	NA	NA
WP_094099508.1|2195466_2198514_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_001240582.1|2198526_2199411_+	formate dehydrogenase N subunit beta	NA	NA	NA	NA	NA
WP_000045648.1|2199403_2200057_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_005050353.1|2200106_2200391_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	50.0	2.2e-19
WP_000845078.1|2200536_2201547_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	7.3e-25
WP_000433464.1|2201680_2203378_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_000152305.1|2204434_2204866_+	peroxiredoxin OsmC	NA	NA	NA	NA	NA
WP_000193536.1|2205840_2206827_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.2e-18
WP_000979624.1|2206823_2207720_-	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_005062918.1|2208865_2210011_-	diguanylate cyclase DosC	NA	A0A127AWB9	Bacillus_phage	41.9	1.9e-05
WP_000350395.1|2210375_2211695_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_000246019.1|2211825_2213361_-	acid resistance gamma-aminobutyrate antiporter GadC	NA	NA	NA	NA	NA
WP_000358930.1|2213516_2214917_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_001245022.1|2215278_2218062_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.5	1.7e-18
WP_000832421.1|2218118_2220491_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_120795387.1|2222416_2222539_+	protein YneP	NA	NA	NA	NA	NA
WP_000060475.1|2225796_2226558_-	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_000543382.1|2226631_2226829_-	two-component system connector SafA	NA	NA	NA	NA	NA
WP_000726665.1|2227076_2229356_-	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_173020720.1|2230494_2230770_+|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	92.3	4.2e-44
WP_173020721.1|2230688_2231012_+	hypothetical protein	NA	U5P0U6	Shigella_phage	87.1	1.5e-43
WP_000747032.1|2233442_2234610_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_173020732.1|2234647_2235803_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.6e-66
WP_071818640.1|2235800_2236106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2236130_2236370_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2236369_2236657_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2236728_2236884_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_024258459.1|2237418_2237697_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_025759563.1|2237698_2238748_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	3.6e-107
WP_000904111.1|2238760_2239117_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_000762884.1|2239131_2239953_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.6e-78
WP_005068100.1|2240849_2240981_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.8e-05
WP_000871291.1|2241261_2241597_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|2241856_2242045_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001323614.1|2242041_2242203_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
WP_000372593.1|2242352_2242532_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	93.0	2.7e-23
WP_173020733.1|2242556_2243713_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
WP_088895425.1|2244240_2245469_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000788996.1|2246307_2247054_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	89.2	2.1e-122
WP_001118171.1|2247068_2247491_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	1.0e-52
WP_000403784.1|2247548_2247905_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_000256997.1|2247997_2248216_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	6.8e-29
WP_000610655.1|2249244_2249610_+	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	53.7	6.1e-30
WP_000018421.1|2250007_2250220_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_000940329.1|2251556_2252156_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	94.5	1.4e-108
WP_000228038.1|2252155_2252446_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000640143.1|2252442_2252997_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	3.7e-71
WP_000124119.1|2254595_2254961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775779.1|2256544_2257204_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_000057968.1|2257217_2258300_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
WP_021577276.1|2258344_2259250_+	monomeric porin OmpG	NA	NA	NA	NA	NA
WP_000075372.1|2259360_2260359_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000825773.1|2260513_2261911_+	YcjX family protein	NA	NA	NA	NA	NA
WP_000138744.1|2261907_2262969_+	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_001306544.1|2263116_2264658_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_000084385.1|2264701_2265208_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_005062222.1|2265326_2266286_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_005068481.1|2266260_2266989_-	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_161550600.1|2268745_2269942_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_119182169.1|2270317_2271229_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_025759889.1|2272034_2273495_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.1	7.3e-42
WP_000214712.1|2273530_2273734_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000636575.1|2274711_2275458_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_005068122.1|2275594_2277640_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000901367.1|2278159_2278255_-	protein MgtS	NA	NA	NA	NA	NA
WP_000087214.1|2279762_2280662_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803659.1|2280692_2280911_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2280942_2281326_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|2281345_2281780_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|2281991_2282657_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210809.1|2282681_2283872_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000257409.1|2287148_2288075_+	glutaminase B	NA	NA	NA	NA	NA
WP_001735245.1|2288074_2288434_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000558039.1|2288572_2289991_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	1.1e-18
WP_000854633.1|2290217_2291669_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_161550602.1|2291965_2293165_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957853.1|2293174_2293363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025759140.1|2293563_2294478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286595.1|2294481_2295240_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_025759137.1|2295278_2295569_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774196.1|2295592_2296468_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_025759135.1|2297529_2298522_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911162.1|2298521_2299550_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_119182139.1|2299543_2301079_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	1.2e-21
WP_000154339.1|2301327_2302281_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_025759131.1|2302401_2303262_+	autoinducer kinase	NA	NA	NA	NA	NA
WP_000705197.1|2305642_2305984_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001321287.1|2306581_2307292_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_005050191.1|2307399_2307705_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_077697513.1|2307903_2309025_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.3	1.6e-89
WP_077697514.1|2309058_2309382_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	45.2	6.0e-13
WP_000177820.1|2309974_2310964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025759878.1|2311038_2311548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040235573.1|2311649_2311871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087880099.1|2312268_2313436_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
>prophage 8
NZ_CP045522	Shigella flexneri strain 5908.2 chromosome, complete genome	4549591	2561545	2687254	4549591	lysis,head,terminase,holin,capsid,transposase,integrase,tail,portal,protease	Enterobacteria_phage(28.26%)	97	2631800:2631859	2641127:2641896
WP_000984517.1|2561545_2562427_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_025757849.1|2562618_2564667_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	5.7e-85
WP_000431370.1|2564686_2565385_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043881.1|2565481_2565979_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_025757846.1|2570074_2571514_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2571631_2571868_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2571972_2572164_+	YebW family protein	NA	NA	NA	NA	NA
WP_077128820.1|2574828_2576544_+	T3SS effector E3 ubiquitin-protein ligase IpaH3	NA	NA	NA	NA	NA
WP_152030437.1|2576723_2577347_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	71.1	9.9e-73
WP_005127484.1|2579182_2579464_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	9.8e-12
WP_025758140.1|2579429_2580506_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_000976476.1|2580898_2581240_-	YebY family protein	NA	NA	NA	NA	NA
WP_025758141.1|2582128_2582503_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2582641_2582872_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011667.1|2582973_2583630_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944269.1|2583653_2584316_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	3.5e-07
WP_025758144.1|2584312_2586373_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024749.1|2586581_2587241_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_005068964.1|2587567_2587924_-	protein YebF	NA	NA	NA	NA	NA
WP_000173488.1|2588414_2589593_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_152030404.1|2589647_2590289_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069457.1|2590325_2592137_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301720.1|2592371_2593847_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001056694.1|2594185_2595055_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000044414.1|2595182_2596625_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448385.1|2596755_2597727_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2597846_2599169_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|2599184_2600117_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202992.1|2600195_2600951_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	3.8e-18
WP_000571470.1|2600947_2601733_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568525.1|2601879_2602890_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.2	2.8e-08
WP_000580323.1|2602898_2603510_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|2603648_2603714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005079859.1|2607664_2607964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2608135_2608465_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_005115548.1|2610020_2610698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025759760.1|2610833_2611904_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_021528432.1|2611900_2612806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069642.1|2617381_2617825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000711882.1|2618339_2619182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973202.1|2620178_2620724_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_025759701.1|2620720_2621464_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001165578.1|2621475_2622555_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_128861733.1|2622616_2623552_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_119182152.1|2624009_2624894_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000747040.1|2624868_2626037_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.7	1.1e-184
WP_001010995.1|2627228_2628179_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532920.1|2630555_2631272_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
2631800:2631859	attL	GGGTAATGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGT	NA	NA	NA	NA
WP_086558215.1|2633771_2635001_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_171769178.1|2635042_2635183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747032.1|2635552_2636721_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_025759341.1|2636891_2638154_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	1.1e-73
WP_001325918.1|2638491_2639289_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_004974968.1|2639499_2640537_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_025759339.1|2640536_2640740_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001317924.1|2640798_2641113_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	62.6	2.1e-31
WP_005069274.1|2641910_2642327_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.0	1.5e-24
2641127:2641896	attR	GGGTAATGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGTGACTTCCGTCCCAGCCTTGCCAGATGTTGTCTCAGATTCAGATTATGTCGCTCAATGCGCTGAGTGTAACGCTTGCTGATAACGTGCAGCTTTCCCTTCAGGCGTGATTCATACAGCGGCCAGCCATCCGTCATCCATACCACGACCTCAAAGGCCGACAGCAGGCTCAGAAGACGCTCCAGTGTGGCCAGAGTGCGTTCACCGAAGACGTGCGCCACAACCGTCCTCCGTATCCTGTCATACGCGTAAAACAGCCAGCGCTGACGTGATTTAGCACCGACGTAGCCCCAATGTTCGTCCATTTCAGCGCAGACAATCACATCACTGCCCGGTTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAGTGACGTAAAACCGTGTTGAGGCCAACGCCCATAATGCGTGCACTGGCGCGACATCCGACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGCTGAGAGGCGGTGTAAGTGAACTGTAGTTGCCATGTTTTACGGCAATGAGAGCAGAGATAGCGCTGATGTCCGGCAGTGCTTTTGCCGTTACGCACCACGCCTTCAGTAGCGGAGCAGGAAGGACATCTGATGGAAATGGAAGCCACGCAAGCACCTTAAAATCACCATCATACACTAAATCAGTAAGTTGGCAGCATTACCA	NA	NA	NA	NA
WP_000935258.1|2642921_2643134_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_000929754.1|2643301_2643580_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	43.8	2.4e-10
WP_025759819.1|2643581_2644640_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	7.5e-89
WP_000140020.1|2644640_2645006_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.1	7.1e-39
WP_025759817.1|2645002_2645713_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.3	6.7e-57
WP_000839572.1|2646513_2646729_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_001088287.1|2646827_2647502_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_000631709.1|2647498_2647846_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	4.1e-44
WP_000092290.1|2651252_2651717_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	90.8	1.2e-67
WP_001139556.1|2651759_2652110_+	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	99.1	4.7e-64
WP_024166447.1|2652257_2652740_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_040235539.1|2652739_2654497_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_000478600.1|2654508_2654691_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	80.0	1.4e-19
WP_000466011.1|2654690_2655932_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	93.5	2.2e-228
WP_025759107.1|2655909_2657640_+|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	99.2	5.5e-198
WP_000924704.1|2657684_2658008_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8W626	Enterobacteria_phage	99.1	9.7e-56
WP_000702444.1|2658004_2658421_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	69.1	9.0e-46
WP_025759103.1|2658386_2658911_+	hypothetical protein	NA	Q8W625	Enterobacteria_phage	97.1	3.3e-93
WP_000497744.1|2659479_2659641_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	76.6	9.2e-15
WP_000155744.1|2659637_2661134_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8W623	Enterobacteria_phage	97.4	5.9e-273
WP_001062338.1|2661133_2661490_+|tail	phage tail tube protein	tail	Q8W622	Enterobacteria_phage	98.3	5.3e-63
WP_025759099.1|2661910_2663860_+|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	97.8	0.0e+00
WP_040234363.1|2664968_2665592_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	74.9	7.3e-76
WP_032156999.1|2665771_2667415_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_161550607.1|2667730_2668399_-	methyltransferase	NA	NA	NA	NA	NA
WP_000937511.1|2668455_2668725_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.2e-19
WP_001007781.1|2669802_2670453_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000920127.1|2672458_2672872_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001347103.1|2673004_2673676_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_025759261.1|2673675_2675034_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218218.1|2675141_2675993_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_152030430.1|2677363_2677576_-	porin	NA	NA	NA	NA	NA
WP_171763895.1|2677635_2678863_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	4.1e-171
WP_032155863.1|2680848_2681106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025758774.1|2681752_2683171_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.8e-101
WP_000228688.1|2683151_2683622_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	7.6e-33
WP_025758775.1|2683610_2684531_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_152030428.1|2684703_2685621_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009302.1|2685699_2685882_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_173020735.1|2686040_2687254_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	5.5e-168
>prophage 9
NZ_CP045522	Shigella flexneri strain 5908.2 chromosome, complete genome	4549591	2708676	2772082	4549591	transposase,tail,tRNA	Enterobacteria_phage(53.33%)	55	NA	NA
WP_005079763.1|2708676_2709447_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1W6JP07	Morganella_phage	97.3	3.7e-130
WP_000790504.1|2710263_2710497_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118897.1|2710493_2711699_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001392280.1|2711885_2712299_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245691.1|2712332_2713820_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001057836.1|2713897_2714263_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000270672.1|2714262_2714673_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000146784.1|2714697_2716104_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_025759942.1|2716369_2718022_+	flagellin FliC	NA	NA	NA	NA	NA
WP_025759941.1|2718186_2718906_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_005048734.1|2718951_2719503_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_005069139.1|2719590_2720391_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001128248.1|2720495_2721482_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|2721496_2722165_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001272995.1|2722161_2722914_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	6.0e-32
WP_000106474.1|2723796_2724021_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_000590347.1|2724007_2724184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611335.1|2724479_2725136_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283406.1|2725132_2726965_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|2727021_2727570_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000847902.1|2728219_2728885_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_025759935.1|2728946_2730158_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|2730347_2730587_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|2730623_2731121_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237866.1|2731291_2731615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|2731877_2731964_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082120.1|2732078_2732330_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|2732409_2732913_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_025759934.1|2733709_2734699_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_025759932.1|2734768_2734909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025758825.1|2736117_2737851_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	2.6e-86
WP_005048653.1|2738066_2738633_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185715.1|2738646_2739393_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214307.1|2739780_2740881_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_119182133.1|2740905_2743335_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564755.1|2743499_2744471_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_025758823.1|2744467_2745211_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_000252980.1|2745251_2745647_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_050544124.1|2745699_2746470_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_040234742.1|2749174_2749864_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.9	1.1e-56
WP_000140459.1|2751049_2752246_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001074424.1|2752509_2752911_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	66.9	8.7e-38
WP_000753026.1|2752922_2753294_+|tail	tail attachment protein	tail	NA	NA	NA	NA
WP_000677116.1|2753280_2753871_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	78.2	7.4e-78
WP_005067061.1|2754277_2755018_+	Ig-like domain-containing protein	NA	A5LH35	Enterobacteria_phage	94.3	3.5e-125
WP_000478925.1|2755076_2755463_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	91.4	9.2e-61
WP_001161002.1|2755471_2755801_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	98.2	3.8e-55
WP_000447263.1|2758813_2759143_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	96.3	8.9e-57
WP_025758205.1|2759142_2759841_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.2	1.9e-120
WP_001233104.1|2764733_2765333_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	3.6e-104
WP_173020736.1|2765396_2766683_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	59.2	6.7e-39
WP_005140132.1|2767556_2769308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217553.1|2769908_2770157_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000530007.1|2770253_2770430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134799987.1|2770885_2772082_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP045522	Shigella flexneri strain 5908.2 chromosome, complete genome	4549591	2856483	2913831	4549591	transposase,tail,tRNA	Enterobacteria_phage(43.75%)	45	NA	NA
WP_000140459.1|2856483_2857680_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_025759052.1|2858655_2861778_+	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000130874.1|2864844_2866260_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675135.1|2866256_2867660_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	9.2e-34
WP_025759047.1|2867656_2868379_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	1.3e-31
WP_005049106.1|2869038_2870400_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	7.1e-217
WP_001295425.1|2870741_2871059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807346.1|2871464_2872364_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	9.8e-13
WP_119182064.1|2872445_2873225_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844249.1|2873324_2874365_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000823288.1|2875772_2876057_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182919.1|2876087_2876540_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_025759044.1|2876549_2877812_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_025759041.1|2877840_2878695_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129573.1|2879002_2880055_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_025759039.1|2880208_2880685_+	MFS transporter	NA	NA	NA	NA	NA
WP_000011983.1|2881681_2882647_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2882620_2883367_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005069468.1|2883418_2884237_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.1	2.5e-23
WP_024222623.1|2884301_2885102_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195611.1|2885098_2885887_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2886109_2886382_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_025759034.1|2886502_2887351_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153074.1|2887569_2887908_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_025759032.1|2889038_2891519_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677392.1|2891534_2892209_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2892289_2892832_-	fimbrial protein	NA	NA	NA	NA	NA
WP_011110605.1|2893124_2893406_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2893667_2894777_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_040234817.1|2894908_2896942_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	3.0e-54
WP_086020934.1|2897337_2898493_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_005063603.1|2898518_2898710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161550645.1|2898846_2900274_+|tail	tail fiber protein	tail	Q7Y4D4	Escherichia_virus	63.6	3.4e-169
WP_000902877.1|2900276_2900822_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	73.1	2.5e-72
WP_161550612.1|2902210_2902834_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	71.1	9.9e-73
WP_032156999.1|2903013_2904657_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_161550607.1|2904972_2905641_-	methyltransferase	NA	NA	NA	NA	NA
WP_000937511.1|2905697_2905967_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.2e-19
WP_001261936.1|2906082_2906331_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	97.6	4.1e-38
WP_161550613.1|2906728_2908075_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001295431.1|2908282_2909968_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_005048999.1|2909964_2910684_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_005063442.1|2910730_2911201_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	98.7	2.6e-81
WP_005049020.1|2911241_2911703_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	1.6e-75
WP_025759950.1|2911827_2913831_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
>prophage 11
NZ_CP045522	Shigella flexneri strain 5908.2 chromosome, complete genome	4549591	3366675	3436496	4549591	integrase,transposase,tail,tRNA	Enterobacteria_phage(15.79%)	51	3387611:3387628	3403445:3403462
WP_094099486.1|3366675_3367371_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	92.2	8.9e-123
WP_040234980.1|3367364_3370484_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_000189282.1|3370490_3370664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025758211.1|3370781_3371975_+	ROK family protein	NA	NA	NA	NA	NA
WP_000919159.1|3372172_3373426_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883129.1|3373752_3374943_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|3374987_3375326_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_005047323.1|3375386_3376721_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|3376710_3377424_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_005047325.1|3377588_3379016_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_000970142.1|3379573_3383461_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.6	2.2e-130
WP_000734212.1|3383718_3385275_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001295367.1|3385271_3385808_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190655.1|3385832_3386468_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_025758216.1|3386676_3387525_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
3387611:3387628	attL	AATTGTGATATGTGTGAA	NA	NA	NA	NA
WP_161550620.1|3391486_3392716_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	40.8	2.7e-74
WP_000902877.1|3392739_3393285_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	73.1	2.5e-72
WP_011069472.1|3393287_3393806_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	53.0	3.5e-39
WP_173020739.1|3393869_3395097_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	3.2e-176
WP_000631709.1|3398537_3398885_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	4.1e-44
WP_001088287.1|3398881_3399556_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_001138333.1|3402099_3403200_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000054752.1|3403414_3403675_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
3403445:3403462	attR	AATTGTGATATGTGTGAA	NA	NA	NA	NA
WP_000128776.1|3403868_3403949_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000986029.1|3404368_3404749_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004969731.1|3404748_3405480_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_161550623.1|3405491_3406220_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020748.1|3406231_3407137_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|3407133_3407814_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|3408085_3409060_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|3409075_3410875_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589070.1|3411072_3411552_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_025759265.1|3411548_3412505_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168466.1|3412504_3413155_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_005070454.1|3413187_3413763_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_032157127.1|3413759_3413915_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001094509.1|3414170_3415793_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001298974.1|3415777_3416515_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3416646_3417981_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_005070459.1|3418015_3418897_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000187873.1|3418999_3419587_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3419642_3420026_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3420330_3421020_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997396.1|3421067_3422105_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3422311_3422731_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_025759270.1|3422799_3423498_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_119182095.1|3423529_3426190_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_005051257.1|3426303_3427659_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005105704.1|3427704_3428028_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3428024_3429323_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_000483770.1|3435149_3436496_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP045522	Shigella flexneri strain 5908.2 chromosome, complete genome	4549591	3528705	3547909	4549591	transposase	Escherichia_phage(33.33%)	17	NA	NA
WP_001272898.1|3528705_3531267_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_000613355.1|3532075_3532843_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847961.1|3533038_3533947_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	6.6e-118
WP_001278995.1|3535202_3535841_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.5	3.5e-81
WP_161550624.1|3535874_3536570_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	92.2	1.5e-122
WP_000987799.1|3536627_3536855_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	92.0	2.5e-34
WP_000606608.1|3536870_3537782_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	41.2	6.1e-55
WP_094099499.1|3537867_3539023_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	4.0e-67
WP_119182078.1|3539163_3541260_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	48.9	8.0e-175
WP_001249841.1|3541261_3541513_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	53.0	1.1e-17
WP_001224023.1|3541665_3542229_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	55.8	1.1e-35
WP_000767712.1|3542926_3543520_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_001208075.1|3543666_3544074_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000081550.1|3544193_3545186_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_119182077.1|3545248_3546388_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3546527_3547154_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_024260645.1|3547147_3547909_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	2.9e-58
>prophage 1
NZ_CP045523	Shigella flexneri strain 5908.2 plasmid p5908-2	137368	39302	46202	137368		Salmonella_phage(16.67%)	9	NA	NA
WP_000239590.1|39302_40178_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001245884.1|40730_41033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587689.1|41029_41656_-	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_000457515.1|41859_43131_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	2.2e-143
WP_000109071.1|43130_43568_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|43564_43813_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_001134370.1|44207_45134_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_001310011.1|45130_45442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086153.1|45518_46202_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	5.1e-30
>prophage 2
NZ_CP045523	Shigella flexneri strain 5908.2 plasmid p5908-2	137368	50610	58215	137368		Pseudomonas_phage(16.67%)	8	NA	NA
WP_000936285.1|50610_52512_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.1	3.1e-32
WP_031222835.1|52661_53147_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	72.8	6.0e-41
WP_000006020.1|53204_53438_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.7e-06
WP_001145488.1|53496_55455_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.6	9.5e-21
WP_001387500.1|55509_55944_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276270.1|55940_56660_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000977995.1|56656_57253_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
WP_000117611.1|57714_58215_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
