The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043414	Escherichia coli strain EC42405 chromosome, complete genome	5133009	86522	125242	5133009	transposase,integrase	Enterobacteria_phage(21.43%)	33	106483:106512	129497:129526
WP_161524858.1|86522_87389_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.3e-51
WP_161397479.1|87385_87616_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000174035.1|87851_88832_+	thymidylate synthase	NA	A0A218MLB7	uncultured_virus	34.2	7.3e-22
WP_000820616.1|88828_89773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000637420.1|89775_90858_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	38.6	5.5e-10
WP_000676590.1|91324_91588_+	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	71.6	1.0e-26
WP_099356885.1|93012_96426_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.2	8.5e-17
WP_000627727.1|96489_98124_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.9	2.6e-32
WP_099356886.1|98120_99287_+	restriction endonuclease	NA	F2Y1N5	Organic_Lake_phycodnavirus	33.6	6.1e-07
WP_000778955.1|99295_100918_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000499116.1|100917_101814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001275820.1|102497_102866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099356887.1|103083_103830_+	porin family protein	NA	NA	NA	NA	NA
WP_021533886.1|104014_105517_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
106483:106512	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_000429836.1|106507_106942_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|107013_107364_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000027057.1|107639_108500_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001217881.1|108682_109240_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_001143775.1|109401_112407_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_001340589.1|112641_113064_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|113115_114810_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|114827_115190_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|115186_115423_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|115458_116127_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_161395220.1|116165_117881_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000344784.1|117883_118744_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001324342.1|118845_120369_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|120358_121141_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|121316_121817_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|121944_122784_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|122777_123125_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|123288_124080_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000845048.1|124228_125242_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
129497:129526	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
>prophage 2
NZ_CP043414	Escherichia coli strain EC42405 chromosome, complete genome	5133009	1192346	1200366	5133009		Escherichia_phage(83.33%)	7	NA	NA
WP_001279002.1|1192346_1192985_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	3.7e-83
WP_161397388.1|1192981_1194244_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.7	1.3e-135
WP_000847985.1|1194240_1195149_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272546.1|1195314_1196112_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.5e-70
WP_161397389.1|1196162_1196819_-	protein-serine/threonine phosphatase	NA	Q71TJ1	Escherichia_phage	48.1	1.1e-50
WP_161399899.1|1196841_1197696_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_105276647.1|1197804_1200366_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 3
NZ_CP043414	Escherichia coli strain EC42405 chromosome, complete genome	5133009	1303624	1387897	5133009	capsid,tRNA,head,holin,protease,tail,integrase,portal,terminase	Enterobacteria_phage(33.33%)	89	1311842:1311858	1391418:1391434
WP_105288495.1|1303624_1304854_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.1	3.3e-205
WP_000162574.1|1305595_1306078_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600189.1|1306209_1306686_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117842.1|1306675_1306966_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1307028_1307370_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880951.1|1307518_1309180_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1309265_1310144_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1310267_1310861_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1310915_1312202_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
1311842:1311858	attL	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_001189257.1|1312222_1313089_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1313180_1314542_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1314678_1314927_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_105277833.1|1314945_1315494_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264781.1|1315524_1316292_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1316333_1316681_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_039021299.1|1316757_1317240_-	OmpA family protein	NA	NA	NA	NA	NA
WP_077757002.1|1317255_1318482_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212405.1|1318471_1318990_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001353010.1|1319139_1319505_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|1319714_1320785_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225210.1|1320795_1321917_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_032184936.1|1321959_1323120_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1323218_1323266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032218640.1|1323433_1324423_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	2.0e-99
WP_001242988.1|1324489_1324792_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_032218642.1|1325232_1325574_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	6.6e-55
WP_000158971.1|1325584_1325872_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|1325883_1326126_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021656.1|1326122_1326236_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000543036.1|1326329_1326740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|1326763_1326967_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|1326963_1327230_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_021514993.1|1327226_1327526_+	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.1e-40
WP_001036814.1|1327537_1327750_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	86.6	7.6e-25
WP_021514992.1|1327746_1328571_+|protease	serine protease	protease	A0A0A7NPW9	Enterobacteria_phage	96.3	8.7e-125
WP_106884340.1|1328626_1329247_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	40.4	2.6e-09
WP_021563452.1|1329243_1329609_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	2.5e-60
WP_063082813.1|1329615_1332438_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.9	0.0e+00
WP_033806518.1|1332514_1333474_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	9.9e-181
WP_000211287.1|1333478_1333793_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.4	2.3e-17
WP_000104418.1|1333807_1334095_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	69.5	1.8e-16
WP_000974052.1|1334106_1334466_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300959.1|1334534_1334849_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	45.1	7.3e-16
WP_000038285.1|1334857_1335892_-|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	54.1	1.8e-90
WP_063082812.1|1335884_1337672_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	55.8	9.5e-193
WP_000040310.1|1337866_1338757_+|capsid	phage capsid protein	capsid	A0A1D9CA10	Salinivibrio_phage	34.1	4.9e-33
WP_063082811.1|1338771_1339785_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	58.5	4.6e-104
WP_001142999.1|1339802_1340513_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	47.0	7.4e-56
WP_063082810.1|1340611_1341106_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	41.9	1.1e-26
WP_000192587.1|1341115_1341589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063082809.1|1341585_1342299_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	41.6	1.1e-32
WP_061336266.1|1342318_1343467_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	55.0	9.3e-109
WP_000213187.1|1343463_1343919_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	54.3	9.5e-41
WP_001155241.1|1343922_1344219_+|holin	holin	holin	C7BGD7	Burkholderia_phage	44.7	2.6e-15
WP_000777017.1|1344328_1344670_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	78.2	1.9e-41
WP_000998379.1|1344740_1345028_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	47.6	7.4e-15
WP_063082808.1|1345215_1347312_+|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	37.5	7.9e-106
WP_000556623.1|1347301_1347652_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.3	3.0e-26
WP_161399915.1|1347644_1348829_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	61.9	1.2e-138
WP_061336263.1|1348825_1349461_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	54.2	7.0e-50
WP_032218673.1|1349457_1351158_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	78.7	7.3e-102
WP_032218675.1|1351160_1351712_+|tail	tail assembly protein	tail	Q8W612	Enterobacteria_phage	69.8	1.9e-67
WP_050484014.1|1351718_1353758_+	hypothetical protein	NA	A0A0U2SH60	Escherichia_phage	47.7	3.1e-107
WP_161399917.1|1353757_1354330_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	56.5	7.2e-54
WP_057108819.1|1354326_1355040_+	hypothetical protein	NA	Q1I0X8	Pasteurella_virus	24.0	2.0e-05
WP_000192892.1|1355011_1355587_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	43.4	5.1e-31
WP_032218678.1|1355583_1357281_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	41.0	1.2e-109
WP_057108822.1|1357880_1358507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157344.1|1358506_1358887_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_057108823.1|1359329_1360799_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_074152386.1|1361094_1361346_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	60.3	1.8e-12
WP_000178456.1|1361495_1361837_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1362930_1363668_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079112.1|1363802_1364783_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_032184934.1|1364779_1365511_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002431841.1|1365640_1368214_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000841107.1|1374178_1375477_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	1.6e-45
WP_072004035.1|1375473_1375797_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_032184926.1|1375841_1377197_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_105277567.1|1377310_1379971_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_032184923.1|1380002_1380701_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1380769_1381189_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997419.1|1381395_1382433_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_032184921.1|1382480_1383170_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.3	7.1e-56
WP_000627804.1|1383474_1383858_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_032184919.1|1383913_1384501_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_088541190.1|1384603_1385485_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1385693_1387028_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_105288188.1|1387159_1387897_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
1391418:1391434	attR	GGTACAGCGCGGCAATG	NA	NA	NA	NA
>prophage 4
NZ_CP043414	Escherichia coli strain EC42405 chromosome, complete genome	5133009	1896162	1905604	5133009		Enterobacteria_phage(85.71%)	10	NA	NA
WP_032184583.1|1896162_1897089_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	3.7e-23
WP_032184582.1|1897093_1897825_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1897805_1897913_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1897972_1898704_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001354765.1|1898925_1900611_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_001353101.1|1900607_1901327_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1901373_1901844_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001353103.1|1901886_1902348_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_105287803.1|1902479_1904471_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	91.3	0.0e+00
WP_105287804.1|1904467_1905604_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.7	9.0e-165
>prophage 5
NZ_CP043414	Escherichia coli strain EC42405 chromosome, complete genome	5133009	2469717	2577827	5133009	transposase,lysis,protease,tail,integrase,portal,terminase	Enterobacteria_phage(44.26%)	116	2469612:2469627	2517449:2517464
2469612:2469627	attL	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_088541874.1|2469717_2472144_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	3.5e-214
WP_105272232.1|2472342_2472648_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_074496925.1|2472755_2473466_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2473468_2474029_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_088541876.1|2474063_2474405_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001314753.1|2474539_2474866_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_001354684.1|2475071_2476286_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	2.4e-46
WP_000836045.1|2476297_2477317_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001389342.1|2477374_2477503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|2477504_2478785_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001296941.1|2478819_2479056_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_161524862.1|2479143_2481615_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.0	4.2e-58
WP_001090200.1|2481707_2481899_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2481895_2482084_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001700701.1|2482484_2482649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171966.1|2482652_2482871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001384640.1|2483030_2483186_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	3.4e-06
WP_000362155.1|2483451_2483871_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|2483971_2484253_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693832.1|2484236_2484662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105287961.1|2484733_2485804_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	1.1e-63
WP_105287962.1|2485844_2486270_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.8	2.9e-60
WP_105287963.1|2486497_2487523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122653604.1|2487900_2488008_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	93.1	7.2e-08
WP_001013637.1|2488052_2488265_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_001332495.1|2488723_2489002_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_105287964.1|2489003_2490053_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	5.1e-114
WP_001047135.1|2490066_2490819_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2491096_2491186_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2491240_2491453_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2491753_2491969_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2492722_2492938_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189915.1|2492942_2493254_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2493250_2493784_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2493780_2494278_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2494641_2494854_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2494864_2495053_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|2495055_2495121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2495200_2495356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2495527_2495701_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035574.1|2495852_2496263_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.0	2.1e-63
WP_001031431.1|2496563_2496770_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000421825.1|2497330_2497870_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_161399959.1|2497944_2498871_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.4	1.2e-183
WP_047090441.1|2499032_2500271_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	34.5	1.9e-59
WP_001095275.1|2500283_2500487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021516098.1|2500545_2501124_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	63.6	1.2e-56
WP_047090440.1|2502784_2503045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047090439.1|2503017_2503251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047090438.1|2503457_2503757_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_047090437.1|2503753_2505169_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	58.8	1.1e-114
WP_021525665.1|2505369_2505621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047090436.1|2505617_2506040_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_047090435.1|2506465_2506675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047090434.1|2506671_2508588_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	57.1	4.0e-213
WP_047090433.1|2508836_2509322_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	65.2	7.8e-49
WP_001072973.1|2510677_2510890_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_123010598.1|2510817_2512398_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.8	4.8e-289
WP_001136587.1|2512342_2514370_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|2514456_2514780_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|2514772_2515048_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677131.1|2515059_2515638_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	6.1e-101
WP_001079400.1|2515634_2516036_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	1.1e-72
WP_105287966.1|2516046_2516790_+|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	98.8	6.0e-133
WP_001487852.1|2516850_2517237_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	99.2	4.7e-65
WP_001161009.1|2517245_2517575_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
2517449:2517464	attR	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_105287967.1|2517546_2520612_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
WP_000447253.1|2520611_2520941_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_161524863.1|2520950_2521649_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.9e-133
WP_161403311.1|2521654_2522398_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	1.8e-150
WP_000090928.1|2522334_2522943_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.0	1.4e-103
WP_161524864.1|2523003_2526402_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	91.2	0.0e+00
WP_001752322.1|2526468_2527068_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	4.4e-110
WP_105288534.1|2527132_2530156_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_161399943.1|2530155_2530731_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	3.8e-103
WP_000078178.1|2530828_2531419_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2531735_2531969_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2532037_2532151_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347484.1|2532754_2534038_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_088541878.1|2534127_2535588_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.5	1.5e-42
WP_000214712.1|2535623_2535827_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215540.1|2536003_2536690_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000636571.1|2536778_2537525_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_105288429.1|2537661_2539707_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024558.1|2539751_2540270_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671737.1|2540545_2540938_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_088541879.1|2541192_2542083_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	36.4	4.0e-19
WP_000901364.1|2542302_2542398_-	protein MgtS	NA	NA	NA	NA	NA
WP_032184271.1|2542524_2543712_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_088541880.1|2543906_2544806_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_088541881.1|2544836_2545055_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2545086_2545470_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843424.1|2545490_2545925_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|2546136_2546802_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_088541882.1|2546826_2548017_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_088541883.1|2548164_2549280_-	putative protein YneK	NA	NA	NA	NA	NA
WP_105288419.1|2549357_2550239_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_105288420.1|2550339_2551728_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257402.1|2551791_2552718_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191038.1|2552717_2553077_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_161397289.1|2553215_2554634_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_105272077.1|2554861_2556313_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_039021838.1|2556509_2557424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105288421.1|2557427_2558186_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558527.1|2558242_2558533_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774178.1|2558556_2559432_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_072686653.1|2559458_2560481_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_105288422.1|2560492_2561485_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_021552079.1|2561484_2562513_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000958013.1|2562506_2564042_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.1	7.2e-16
WP_000154346.1|2564291_2565245_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113145.1|2565323_2566916_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001296726.1|2573080_2573347_+	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001125414.1|2573346_2574669_+	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001544475.1|2574867_2576220_-	SIR2 family protein	NA	Q38324	Lactococcus_phage	31.0	2.5e-20
WP_161399942.1|2576426_2577827_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043414	Escherichia coli strain EC42405 chromosome, complete genome	5133009	3116753	3169399	5133009	capsid,head,holin,protease,tail,integrase,portal,terminase	Escherichia_phage(39.53%)	58	3121426:3121485	3168474:3168538
WP_032183885.1|3116753_3117341_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3117337_3118045_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|3118063_3119857_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001353311.1|3119853_3120972_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
3121426:3121485	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_137533043.1|3121976_3122507_-|tail	tail fiber assembly protein	tail	A0A0F7LBP0	Escherichia_phage	74.9	6.0e-71
WP_161399938.1|3122510_3125096_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	50.1	5.5e-125
WP_161524867.1|3125154_3128634_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_057780545.1|3128694_3129297_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	2.3e-87
WP_000194780.1|3129233_3129977_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|3129982_3130681_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3130680_3131010_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_161524868.1|3131006_3133568_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	89.8	0.0e+00
WP_000459457.1|3133560_3133995_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001535872.1|3133976_3134399_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	7.7e-69
WP_044502411.1|3134414_3135155_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	2.5e-131
WP_000683129.1|3135162_3135558_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001595432.1|3135554_3136133_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000785282.1|3136144_3136498_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158878.1|3136509_3136905_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	7.4e-58
WP_073547366.1|3136946_3137972_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_001513196.1|3138027_3138360_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_137533358.1|3138369_3139689_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	5.3e-233
WP_032285279.1|3139669_3141271_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
WP_000198149.1|3141267_3141474_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_161524869.1|3141470_3143396_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	96.9	0.0e+00
WP_000874941.1|3143367_3143874_-	DNA-packaging protein	NA	O64316	Escherichia_phage	48.8	1.6e-33
WP_000958716.1|3144876_3145086_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	60.0	5.4e-15
WP_001233879.1|3145512_3145695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836751.1|3145855_3146401_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	87.3	5.2e-94
WP_000950579.1|3146402_3146681_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	85.9	7.3e-36
WP_001315536.1|3146670_3147060_-|holin	holin	holin	Q8W636	Enterobacteria_phage	83.1	9.6e-42
WP_001315537.1|3147259_3147529_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_001017777.1|3147887_3148166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000228659.1|3148684_3149770_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	86.0	7.5e-177
WP_000917767.1|3149920_3150118_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000342735.1|3150291_3151005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089607034.1|3151259_3151925_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.4	4.2e-61
WP_061355881.1|3151921_3152281_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	3.2e-39
WP_001265268.1|3152293_3153343_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.0e-109
WP_024251420.1|3153344_3153623_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.6e-11
WP_000818168.1|3153738_3154224_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001277774.1|3154242_3154422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|3154637_3154850_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_122986767.1|3154894_3155002_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	89.7	4.6e-07
WP_061360846.1|3158856_3159279_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.1	1.1e-62
WP_040072813.1|3159295_3160090_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	49.6	5.0e-53
WP_000095680.1|3160134_3161097_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	50.8	2.3e-84
WP_001406730.1|3161120_3161546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261751.1|3161542_3161770_-	cell division protein	NA	NA	NA	NA	NA
WP_000444616.1|3161868_3162513_+	LexA family transcriptional regulator	NA	O48389	Streptococcus_phage	36.5	6.8e-08
WP_000379585.1|3162786_3162939_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000394568.1|3162950_3163340_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	39.3	1.9e-21
WP_000449182.1|3164085_3164268_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098749.1|3164270_3164474_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_161524870.1|3164554_3167026_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	3.8e-59
WP_000273158.1|3167092_3167344_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_072300524.1|3167312_3168332_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.0	5.7e-86
WP_000375136.1|3168739_3169399_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
3168474:3168538	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
>prophage 7
NZ_CP043414	Escherichia coli strain EC42405 chromosome, complete genome	5133009	3345020	3372360	5133009	capsid,head,holin,tail,integrase,portal,terminase	Cronobacter_phage(83.87%)	36	3367717:3367731	3373131:3373145
WP_130063169.1|3345020_3346721_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	79.9	1.9e-227
WP_130063130.1|3346723_3347269_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	74.6	2.3e-65
WP_000267962.1|3347240_3347966_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.5	8.6e-60
WP_074519689.1|3347955_3348543_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	48.2	4.8e-45
WP_000083766.1|3348542_3350150_-|tail	tail protein	tail	F1BUK3	Cronobacter_phage	79.4	4.4e-133
WP_001001819.1|3350160_3350748_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	3.8e-90
WP_074519687.1|3350740_3351925_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.6	5.3e-176
WP_001286237.1|3351921_3352251_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.6	1.4e-38
WP_130063126.1|3352247_3354215_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.4	5.6e-271
WP_000435058.1|3354402_3354660_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000094478.1|3354806_3355145_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	62.3	2.4e-28
WP_130063124.1|3355144_3355486_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	92.1	9.9e-51
WP_001155239.1|3355472_3355775_-|holin	holin	holin	Q6K1I2	Salmonella_virus	58.1	4.7e-20
WP_000166744.1|3355784_3356240_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.2	2.5e-57
WP_068891935.1|3356236_3357364_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	80.5	2.9e-171
WP_068891937.1|3357360_3358068_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	78.2	6.8e-102
WP_068891939.1|3358064_3358571_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.6e-65
WP_161399879.1|3358567_3359056_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.5e-63
WP_139454286.1|3359118_3359217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130063122.1|3359223_3359928_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	69.3	2.0e-90
WP_089708981.1|3359931_3360954_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	80.9	6.2e-157
WP_089708983.1|3361015_3361819_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	56.8	4.0e-82
WP_161399872.1|3361980_3363756_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	90.9	8.0e-293
WP_089708988.1|3363752_3364814_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.0	1.0e-162
WP_089708991.1|3364810_3365134_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	93.3	6.1e-50
WP_161399878.1|3365433_3367449_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.0	1.6e-297
WP_071290233.1|3367450_3367651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071290234.1|3367647_3368517_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	81.3	2.5e-130
3367717:3367731	attL	TTTCTGGCTTGCAGC	NA	NA	NA	NA
WP_071290235.1|3368507_3368741_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000974860.1|3368808_3369210_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	2.2e-49
WP_130063120.1|3369209_3369638_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	54.0	3.3e-27
WP_071290236.1|3369647_3369821_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460873.1|3369830_3370334_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.9	1.3e-59
WP_001247709.1|3370364_3370586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102872.1|3370721_3371303_+	phage repressor protein	NA	F1BUS8	Erwinia_phage	40.9	1.4e-33
WP_071290237.1|3371304_3372360_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	62.6	7.0e-119
3373131:3373145	attR	TTTCTGGCTTGCAGC	NA	NA	NA	NA
>prophage 8
NZ_CP043414	Escherichia coli strain EC42405 chromosome, complete genome	5133009	3658546	3706367	5133009	capsid,head,lysis,protease,tail,integrase,portal,terminase	Enterobacteria_phage(64.81%)	63	3658077:3658123	3706381:3706427
3658077:3658123	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|3658546_3659500_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3659749_3660499_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_161399953.1|3661401_3662040_+	methyltransferase	NA	NA	NA	NA	NA
WP_075826127.1|3662094_3662679_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	6.6e-103
WP_075826128.1|3662678_3666080_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_161524871.1|3666813_3670227_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_000090873.1|3670286_3670919_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	6.5e-96
WP_161524872.1|3670855_3671599_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.8e-150
WP_001758855.1|3671604_3672303_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	95.7	1.1e-128
WP_000847379.1|3672302_3672632_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_161524873.1|3672628_3675208_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.6	0.0e+00
WP_000459457.1|3675200_3675635_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001535872.1|3675616_3676039_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	7.7e-69
WP_075826136.1|3676054_3676795_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.8e-129
WP_000683112.1|3676802_3677198_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_000985116.1|3677194_3677773_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000752986.1|3677784_3678138_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	2.6e-62
WP_000158868.1|3678149_3678545_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063217.1|3678586_3679612_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	5.2e-188
WP_001513196.1|3679667_3680000_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123272.1|3680009_3681329_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.5e-232
WP_075826132.1|3681309_3682911_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	3.6e-308
WP_000198149.1|3682907_3683114_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_161524874.1|3683110_3685036_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|3685010_3685556_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001421937.1|3685944_3686139_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_161399886.1|3686303_3686510_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	98.5	2.9e-29
WP_000079503.1|3686795_3687206_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|3687496_3687790_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3687880_3688063_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3688279_3688777_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|3688776_3688992_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737280.1|3689564_3690662_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_001204791.1|3690851_3691235_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3691320_3691461_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3691457_3691820_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|3691816_3692107_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|3692099_3692270_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|3692269_3692725_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|3692721_3692823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3692939_3693737_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|3693746_3694298_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_161399885.1|3694762_3696289_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|3696346_3696496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|3696543_3696876_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145916.1|3696943_3697246_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	98.9	2.7e-44
WP_000788884.1|3697242_3697944_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	100.0	3.4e-130
WP_001397823.1|3697940_3698870_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.6	6.1e-111
WP_001182868.1|3698956_3699496_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	7.5e-61
WP_001067459.1|3699565_3699796_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_000858975.1|3699900_3700590_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001226567.1|3700819_3701200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023148105.1|3701596_3701887_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995455.1|3701962_3702259_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	8.1e-49
WP_000100847.1|3702264_3703050_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|3703046_3703727_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|3703723_3703906_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|3703878_3704070_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|3704080_3704362_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763385.1|3704460_3704679_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3704726_3705005_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|3704976_3705348_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_001350488.1|3705203_3706367_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
3706381:3706427	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 1
NZ_CP043415	Escherichia coli strain EC42405 plasmid pNTEC2-42405, complete sequence	138121	1262	58838	138121	transposase,integrase,protease	Escherichia_phage(53.85%)	31	NA	NA
WP_001066942.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_072147492.1|2754_4242_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063083331.1|4346_5294_-|protease	omptin family outer membrane protease OmpP	protease	NA	NA	NA	NA
WP_047090396.1|7815_8163_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	5.9e-43
WP_040073004.1|8159_8834_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.1e-12
WP_000181224.1|9538_10570_-	F17G fimbrial adhesin	NA	NA	NA	NA	NA
WP_000953871.1|10571_13040_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000680560.1|13123_13846_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_053276410.1|13913_14462_-	F17A fimbrial adhesin	NA	NA	NA	NA	NA
WP_161399925.1|16215_16962_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_001171554.1|17037_17418_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|17414_17762_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000040077.1|19866_21087_+	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_161524880.1|21079_26050_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001396807.1|27485_28334_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001253824.1|31872_32820_+	DMT family transporter	NA	NA	NA	NA	NA
WP_001258285.1|33309_33708_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001315600.1|34532_34784_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_000255944.1|38184_39207_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|39206_39986_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001064278.1|43814_44321_+	alpha-hemolysin-activating lysine-acyltransferase HlyC	NA	NA	NA	NA	NA
WP_001315596.1|45383_46091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102791.1|47127_50172_+	cytotoxic necrotizing factor CNF2	NA	NA	NA	NA	NA
WP_001396821.1|50507_50930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169527.1|51405_51705_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001396823.1|51701_52568_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.3e-51
WP_000182209.1|53915_54692_+	cytolethal distending toxin type III subunit CdtA	NA	G1BEM3	Escherichia_phage	96.9	2.9e-130
WP_000759934.1|54688_55498_+	cytolethal distending toxin type III/V nuclease subunit CdtB	NA	G1BEM4	Escherichia_phage	100.0	4.0e-151
WP_000825549.1|55512_56058_+	cytolethal distending toxin type III subunit CdtC	NA	M1SNM4	Escherichia_phage	96.7	2.3e-97
WP_000865085.1|58239_58527_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	87.4	1.1e-39
WP_000483535.1|58526_58838_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	92.2	7.9e-47
