The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034938	Pectobacterium odoriferum strain JK2.1 chromosome, complete genome	4997932	2703151	2748552	4997932	plate,terminase,tail,holin,integrase	Escherichia_phage(39.47%)	55	2695076:2695091	2753338:2753353
2695076:2695091	attL	TGCGGTCGATCGCTAT	NA	NA	NA	NA
WP_005967874.1|2703151_2703364_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	75.7	7.1e-23
WP_161529078.1|2703942_2704164_+	hypothetical protein	NA	H9C151	Pectobacterium_phage	89.0	3.3e-31
WP_161529079.1|2704164_2704779_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	39.2	9.2e-31
WP_167521858.1|2704778_2705993_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	55.6	3.1e-38
WP_161530381.1|2706339_2707155_-	hypothetical protein	NA	G9L6D8	Escherichia_phage	50.0	3.8e-56
WP_161529081.1|2707228_2707402_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	78.6	3.1e-16
WP_161529082.1|2707820_2708447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529083.1|2708492_2709197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529084.1|2709198_2710617_-|plate	baseplate J-like family protein	plate	A0A0U2RJZ0	Escherichia_phage	36.6	3.7e-67
WP_161529085.1|2710613_2710946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529086.1|2710942_2711659_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	31.0	1.4e-22
WP_161529087.1|2711655_2712681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529088.1|2712680_2712956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529089.1|2712952_2713669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529090.1|2713668_2715552_-	transglycosylase SLT domain-containing protein	NA	A0A291LAJ1	Bordetella_phage	39.5	5.4e-05
WP_161529091.1|2715675_2716263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529092.1|2716266_2716704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529093.1|2716706_2718101_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	35.5	5.0e-64
WP_161529094.1|2718105_2719041_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.0	1.1e-51
WP_161529095.1|2719024_2719459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529096.1|2719455_2719884_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	44.2	1.8e-25
WP_161529097.1|2719880_2720363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529098.1|2720430_2721462_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	47.5	2.9e-77
WP_161529099.1|2721478_2722348_-	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	43.9	3.7e-25
WP_161529100.1|2722363_2724031_-	NUDIX domain-containing protein	NA	Q6IWU4	Burkholderia_phage	38.0	4.8e-13
WP_161529101.1|2724043_2724865_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.6	1.0e-53
WP_161529102.1|2724861_2726280_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	36.8	7.2e-87
WP_161529103.1|2726292_2727624_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.0	1.3e-151
WP_161529104.1|2727625_2728669_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	52.1	1.7e-69
WP_161529105.1|2728731_2728917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529106.1|2728945_2729497_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	58.9	3.6e-42
WP_161529107.1|2729475_2730024_-	glycoside hydrolase family protein	NA	Q71TF3	Escherichia_phage	68.7	1.4e-70
WP_161529108.1|2730023_2730239_-|holin	holin	holin	A5LH82	Enterobacteria_phage	73.9	3.2e-23
WP_161529109.1|2730403_2730559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529110.1|2730539_2731109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137742613.1|2731228_2731603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161530382.1|2731720_2732197_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	41.3	7.4e-28
WP_161529111.1|2732324_2732909_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	56.2	2.7e-40
WP_161529112.1|2732901_2733345_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	42.9	1.2e-27
WP_044209424.1|2733879_2734278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161530383.1|2734813_2735251_-	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	38.2	1.1e-14
WP_161529113.1|2735299_2735659_-	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	45.7	1.4e-18
WP_161529114.1|2735797_2736103_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161529115.1|2736122_2736665_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	62.1	6.2e-55
WP_161529116.1|2736573_2737551_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	53.3	2.9e-79
WP_161529117.1|2737550_2738177_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	39.7	1.6e-38
WP_161529118.1|2738451_2739015_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	31.5	6.1e-13
WP_161529119.1|2739017_2739245_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	60.3	2.7e-20
WP_161529120.1|2739347_2739740_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	53.1	4.1e-32
WP_102117847.1|2739862_2740762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529121.1|2742035_2742530_+	HNH endonuclease	NA	Q7Y5K0	Xanthomonas_virus	45.6	2.4e-37
WP_161529122.1|2742668_2745995_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	51.0	6.4e-251
WP_161529123.1|2746004_2747138_+	hypothetical protein	NA	A0A2I7RQF1	Vibrio_phage	48.0	5.6e-58
WP_161529124.1|2747213_2747486_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.5	5.2e-10
WP_161529125.1|2747460_2748552_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.1	3.2e-103
2753338:2753353	attR	TGCGGTCGATCGCTAT	NA	NA	NA	NA
>prophage 2
NZ_CP034938	Pectobacterium odoriferum strain JK2.1 chromosome, complete genome	4997932	2997225	3082199	4997932	plate,transposase,tRNA,protease,tail,integrase	Burkholderia_phage(23.33%)	92	3017626:3017640	3025733:3025747
WP_161529234.1|2997225_2997813_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	38.2	4.7e-24
WP_161529235.1|2997854_2998460_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	54.5	9.3e-60
WP_161529236.1|2998596_2999718_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_039490017.1|3000084_3000717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529237.1|3000943_3001210_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_167521831.1|3001273_3002498_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	46.2	1.5e-59
WP_161529238.1|3002484_3002745_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_161529239.1|3003097_3003313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529240.1|3003386_3004100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529241.1|3004089_3005052_-	hypothetical protein	NA	S5VKI3	Leptospira_phage	37.5	1.1e-51
WP_161529242.1|3005064_3005514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010305181.1|3005845_3006040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167521842.1|3006282_3006459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103161092.1|3006576_3007233_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_161529243.1|3007229_3008342_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_161529244.1|3008334_3009729_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.3	1.2e-49
WP_161529245.1|3009725_3010001_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_161530392.1|3010205_3010589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103199472.1|3010874_3011126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103199471.1|3011144_3011423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529246.1|3012202_3013138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529247.1|3013393_3013771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529248.1|3015436_3016240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103161085.1|3016276_3016651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161530393.1|3016690_3017014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529249.1|3017426_3018263_+	hypothetical protein	NA	NA	NA	NA	NA
3017626:3017640	attL	AAAAAATATCGTTAT	NA	NA	NA	NA
WP_161529250.1|3018500_3019058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529251.1|3019362_3020082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103199400.1|3020472_3020883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529252.1|3021007_3021397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529253.1|3021412_3023113_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_161529254.1|3023105_3024410_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_161530394.1|3024406_3025570_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_038911511.1|3025897_3026095_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
3025733:3025747	attR	ATAACGATATTTTTT	NA	NA	NA	NA
WP_039493522.1|3026179_3027031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529255.1|3027357_3028236_-	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
WP_161529256.1|3028355_3028664_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	72.3	1.0e-33
WP_161530395.1|3028737_3028959_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	57.7	1.1e-15
WP_161529257.1|3029764_3030094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529258.1|3030160_3030697_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_161529259.1|3031103_3032504_+	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_161529260.1|3032547_3033717_-	MFS transporter	NA	NA	NA	NA	NA
WP_039493514.1|3034003_3034519_-	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	34.8	3.2e-16
WP_161529261.1|3034896_3035784_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_161529262.1|3035771_3036323_-	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	34.4	1.0e-12
WP_015839848.1|3036665_3037169_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.9	1.8e-08
WP_039493511.1|3037581_3038328_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_010294864.1|3038354_3039014_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_161529263.1|3039010_3039733_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.3	5.6e-35
WP_161529264.1|3039784_3041653_-	peptidase M3	NA	NA	NA	NA	NA
WP_161529265.1|3041738_3042707_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_161529266.1|3042816_3043392_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	77.3	1.8e-73
WP_161529267.1|3043470_3044109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044203625.1|3046175_3046757_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	63.3	6.6e-63
WP_161529268.1|3046749_3047853_-|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	54.0	1.5e-103
WP_161529269.1|3047843_3048191_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.1	1.2e-32
WP_161529270.1|3048249_3048831_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	44.2	8.8e-23
WP_161529271.1|3048827_3049988_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	49.3	1.3e-86
WP_161529272.1|3049975_3050188_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	58.6	5.3e-18
WP_161529273.1|3050177_3051107_-	hypothetical protein	NA	Q6QIA4	Burkholderia_phage	43.7	1.1e-46
WP_161530396.1|3051106_3053584_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.1	2.5e-87
WP_108723452.1|3053808_3053928_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_103164394.1|3053896_3054217_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_161529274.1|3054356_3054653_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	C7BUZ5	Synechococcus_phage	62.4	1.6e-20
WP_005972713.1|3054709_3055234_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	66.7	9.5e-69
WP_130633475.1|3055233_3056661_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	73.2	1.6e-203
WP_010281040.1|3056650_3056848_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	58.5	2.4e-09
WP_039536940.1|3056844_3057312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103941275.1|3057573_3057885_-	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	45.5	3.7e-20
WP_010294923.1|3057877_3058207_-	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	45.8	1.5e-19
WP_161529275.1|3058196_3058871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529276.1|3058860_3059472_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	56.8	1.0e-58
WP_010281025.1|3059473_3059803_-	membrane protein	NA	A4JWP3	Burkholderia_virus	58.3	1.2e-24
WP_161529277.1|3060022_3061390_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_161529278.1|3061392_3062721_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_161529279.1|3062748_3064476_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	33.2	1.5e-25
WP_044203704.1|3064493_3064805_-|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_039493473.1|3064910_3066341_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_161529280.1|3066862_3068962_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.6e-44
WP_161529281.1|3069126_3069972_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161529282.1|3070024_3070672_+	LysE family transporter	NA	NA	NA	NA	NA
WP_161529283.1|3071028_3071604_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_161529284.1|3071704_3074011_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_161529285.1|3074404_3075091_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_103157182.1|3075166_3076114_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_161529286.1|3076264_3076774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161530397.1|3076852_3077209_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_161529287.1|3077270_3077813_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_161530398.1|3078189_3078738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167521860.1|3078754_3079678_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_161529289.1|3079694_3081107_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_039493450.1|3081266_3082199_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP034938	Pectobacterium odoriferum strain JK2.1 chromosome, complete genome	4997932	3293906	3362284	4997932	plate,transposase,coat,tRNA,integrase	Brazilian_cedratvirus(11.11%)	57	3332397:3332423	3362286:3362312
WP_095700066.1|3293906_3294758_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_161529403.1|3294757_3295768_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_161530411.1|3295898_3297035_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.3	4.5e-15
WP_161529404.1|3297147_3298119_+	EamA family transporter	NA	NA	NA	NA	NA
WP_161529405.1|3298224_3299481_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_039491500.1|3299642_3300860_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_161529406.1|3301032_3303060_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_161529407.1|3303128_3303413_-	YfcL family protein	NA	NA	NA	NA	NA
WP_161529408.1|3303446_3303992_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_161529409.1|3304020_3304821_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_161529410.1|3304853_3305699_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_161529411.1|3305705_3306791_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	1.2e-86
WP_161529412.1|3307025_3307967_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_161529413.1|3308138_3308681_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_161529414.1|3308768_3309251_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_161529415.1|3310379_3310931_+	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_161529416.1|3311114_3311651_+	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_161529417.1|3311686_3312460_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_161529418.1|3312518_3314885_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_039491488.1|3314889_3315900_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_167521863.1|3315892_3318088_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_161529420.1|3318126_3319440_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_161529421.1|3319649_3320849_-	amidohydrolase	NA	NA	NA	NA	NA
WP_039491483.1|3320944_3321799_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039491480.1|3321853_3322516_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_161529422.1|3322505_3323531_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.5	1.5e-30
WP_010298581.1|3323795_3324092_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_161529423.1|3324606_3325908_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_161529424.1|3326046_3326799_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.8	7.1e-09
WP_161529425.1|3326941_3327844_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039491474.1|3327915_3329499_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_039491472.1|3329861_3330623_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_161529426.1|3331230_3332169_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	64.4	6.9e-94
3332397:3332423	attL	ATCTGTCCCTGAAATTACTCCCACCTA	NA	NA	NA	NA
WP_161529427.1|3332424_3332817_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	38.3	1.1e-13
WP_161530412.1|3333035_3334409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529428.1|3335121_3335592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161530413.1|3335606_3336062_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_161529429.1|3336061_3336607_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_161529430.1|3336584_3337670_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_161529431.1|3337633_3339388_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_161529432.1|3339429_3341031_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_161529433.1|3341030_3344480_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_161529434.1|3344476_3345601_-	DUF4282 domain-containing protein	NA	NA	NA	NA	NA
WP_161529435.1|3345749_3346094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529436.1|3346157_3346457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529437.1|3346549_3346828_-	PAAR domain-containing protein	NA	A4PE23	Ralstonia_virus	44.4	8.8e-05
WP_161529438.1|3346894_3347995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529439.1|3347985_3348225_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_161529440.1|3349105_3350230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529441.1|3350273_3351404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529442.1|3351396_3353019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529443.1|3353022_3355524_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	35.6	1.9e-05
WP_161529444.1|3355520_3358175_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.8	1.6e-95
WP_103184900.1|3358347_3358839_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_161528221.1|3359440_3360988_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_161529445.1|3361020_3361518_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_161529446.1|3362110_3362284_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
3362286:3362312	attR	TAGGTGGGAGTAATTTCAGGGACAGAT	NA	NA	NA	NA
>prophage 4
NZ_CP034938	Pectobacterium odoriferum strain JK2.1 chromosome, complete genome	4997932	3647211	3740141	4997932	plate,terminase,portal,transposase,head,tRNA,capsid,tail,lysis,integrase	Escherichia_phage(20.83%)	92	3692372:3692422	3727953:3728003
WP_161529590.1|3647211_3648144_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_072037286.1|3648247_3649696_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	36.3	1.9e-26
WP_161529591.1|3649695_3650238_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_161529592.1|3650346_3651144_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_161529593.1|3651481_3652336_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_010299570.1|3652353_3652734_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_039360891.1|3652794_3653565_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_161529594.1|3653561_3654500_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.5	5.4e-22
WP_010280785.1|3654762_3655404_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_010308846.1|3655463_3656000_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	34.0	6.6e-17
WP_161529595.1|3656149_3656584_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_161529596.1|3656584_3657670_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_161529597.1|3657674_3659297_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011094845.1|3659591_3659939_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_161529598.1|3660046_3660910_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_125232994.1|3660955_3661750_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_010280810.1|3662606_3663014_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A220BYR7	Staphylococcus_phage	26.5	1.1e-06
WP_161530422.1|3663010_3665173_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	6.1e-202
WP_161529599.1|3666518_3667256_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	37.6	9.4e-38
WP_161529600.1|3667312_3667777_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.4	6.9e-47
WP_161529601.1|3670807_3671605_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_161529602.1|3671741_3672134_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	47.0	5.0e-22
WP_161530423.1|3672253_3672379_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167521831.1|3672457_3673683_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	46.2	1.5e-59
WP_161529603.1|3679703_3682280_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.3	2.0e-127
WP_161529604.1|3682413_3683139_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_039475975.1|3683182_3684160_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_161529605.1|3684294_3685029_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_010306175.1|3685355_3685694_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_161529606.1|3686042_3687203_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_161529607.1|3687284_3688406_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_161529608.1|3688412_3689486_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	1.9e-87
WP_010306189.1|3689735_3690452_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_103158077.1|3690498_3690846_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_161529609.1|3691108_3692047_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
3692372:3692422	attL	AATAACAACTTTCGGATGTTGCGAAAGCGCTATCTTAGTTAAGACGCTCTT	NA	NA	NA	NA
WP_161529610.1|3692550_3693546_-	(p)ppGpp synthetase	NA	NA	NA	NA	NA
WP_161529611.1|3693542_3694580_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	71.2	4.5e-147
WP_161529612.1|3694598_3695462_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	42.9	7.6e-63
WP_161529613.1|3695580_3695805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529614.1|3695843_3696353_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	57.1	4.3e-50
WP_039491335.1|3696577_3696829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165708442.1|3696961_3697138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529615.1|3697134_3697635_+	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	57.2	5.4e-53
WP_161529616.1|3697697_3697946_+	DUF2732 family protein	NA	A0A0F7LBR4	Escherichia_phage	53.7	2.2e-07
WP_161529617.1|3697945_3698251_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_161529618.1|3698253_3698679_+	hypothetical protein	NA	S5M403	Pseudoalteromonas_phage	44.9	3.5e-13
WP_167521827.1|3698675_3698960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039491325.1|3698956_3699706_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	70.8	3.5e-109
WP_161529619.1|3701953_3702307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529620.1|3702499_3702838_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	63.6	4.0e-36
WP_044208969.1|3702996_3703218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529621.1|3703496_3704750_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_161529622.1|3704784_3705798_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	75.2	1.6e-152
WP_161529623.1|3705794_3707564_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.2	1.2e-283
WP_161530425.1|3707703_3708558_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	65.3	1.8e-96
WP_161529624.1|3708608_3709736_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	69.7	6.7e-144
WP_161529625.1|3709739_3710399_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	64.3	8.3e-70
WP_161529626.1|3710490_3710994_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	57.1	1.2e-47
WP_161529627.1|3710993_3711197_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	73.1	2.6e-22
WP_039537277.1|3711187_3711406_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	56.9	6.8e-13
WP_161529628.1|3711389_3711899_+	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	70.1	3.5e-60
WP_161529629.1|3711895_3712339_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	37.6	1.0e-15
WP_161529630.1|3712428_3712884_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	65.2	2.0e-51
WP_161529631.1|3712876_3713326_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	60.4	2.4e-44
WP_103161044.1|3713354_3713696_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	1.4e-41
WP_103161045.1|3713774_3714089_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	66.0	5.6e-32
WP_103161046.1|3714432_3715071_+	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	57.6	1.9e-47
WP_103161047.1|3715115_3716174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529632.1|3716272_3716914_+|plate	phage baseplate assembly protein V	plate	S4TUB5	Salmonella_phage	74.6	1.2e-86
WP_039475889.1|3716910_3717255_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	65.8	1.2e-35
WP_161529633.1|3717259_3718168_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	77.5	1.5e-125
WP_161529634.1|3718160_3718772_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.5	6.5e-77
WP_161529635.1|3720840_3722010_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.9	4.1e-189
WP_039512476.1|3722022_3722544_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	79.1	1.6e-76
WP_116167077.1|3722611_3722908_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	67.4	3.9e-27
WP_010310409.1|3722922_3723045_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	81.6	4.2e-12
WP_161529636.1|3723037_3725866_+|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	56.5	2.2e-159
WP_161502206.1|3725867_3726353_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	60.2	5.4e-50
WP_161529637.1|3726349_3727513_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	66.6	3.9e-147
WP_072010066.1|3727595_3727814_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	68.1	7.0e-26
WP_010285987.1|3727986_3728334_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
3727953:3728003	attR	AATAACAACTTTCGGATGTTGCGAAAGCGCTATCTTAGTTAAGACGCTCTT	NA	NA	NA	NA
WP_039360953.1|3728397_3729153_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_010308358.1|3729191_3729740_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_010285998.1|3729758_3730007_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_161529638.1|3730164_3731526_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_161529639.1|3731695_3732490_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_010286009.1|3732559_3733075_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_161529640.1|3733228_3734782_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_161529641.1|3734864_3735293_-	DedA family protein	NA	NA	NA	NA	NA
WP_039494482.1|3735289_3735856_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_005972168.1|3736994_3737180_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_103199359.1|3737513_3740141_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.0	2.3e-78
>prophage 5
NZ_CP034938	Pectobacterium odoriferum strain JK2.1 chromosome, complete genome	4997932	3793352	3822315	4997932	plate,transposase,integrase	Acanthocystis_turfacea_Chlorella_virus(20.0%)	25	3813725:3813743	3822497:3822515
WP_010282513.1|3793352_3794690_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_010303144.1|3794692_3795214_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_161529676.1|3795213_3796434_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_039547063.1|3796436_3797435_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_039494780.1|3797398_3799165_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_161529677.1|3799167_3799599_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_010303163.1|3799604_3801083_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_010282535.1|3801105_3801609_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_161529678.1|3803633_3804575_-	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_161529679.1|3804781_3806149_+	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_161529680.1|3806158_3807622_+	xylulokinase	NA	NA	NA	NA	NA
WP_161529681.1|3807694_3808975_+	MFS transporter	NA	NA	NA	NA	NA
WP_161529682.1|3809022_3809706_+	HAD-IA family hydrolase	NA	M1H491	Acanthocystis_turfacea_Chlorella_virus	28.6	7.4e-13
WP_161529683.1|3809763_3810717_+	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	34.4	3.1e-09
WP_161529684.1|3810728_3812156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529685.1|3812307_3813342_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
3813725:3813743	attL	CGATAATAGGAGTCGAACC	NA	NA	NA	NA
WP_161529686.1|3814072_3814564_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161529687.1|3814556_3815141_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_167521847.1|3815425_3816651_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	46.2	1.5e-59
WP_167521848.1|3816688_3817803_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.2	2.2e-46
WP_161530429.1|3817889_3818213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529691.1|3818471_3819167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161529692.1|3819380_3819860_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_161529693.1|3820050_3820461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161529694.1|3821088_3822315_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.4	4.6e-130
3822497:3822515	attR	CGATAATAGGAGTCGAACC	NA	NA	NA	NA
>prophage 6
NZ_CP034938	Pectobacterium odoriferum strain JK2.1 chromosome, complete genome	4997932	4826271	4911827	4997932	plate,terminase,transposase,head,capsid,tRNA,tail,integrase	Pseudomonas_phage(33.33%)	84	4821397:4821413	4836260:4836276
4821397:4821413	attL	CTTCGGCTATCTGCGCC	NA	NA	NA	NA
WP_039474412.1|4826271_4827963_-	molecular chaperone HscC	NA	G8DDB7	Micromonas_pusilla_virus	34.9	3.5e-72
WP_005968196.1|4828182_4828476_+	DUF2623 domain-containing protein	NA	NA	NA	NA	NA
WP_161530464.1|4829142_4829739_-	phage repressor protein C	NA	A5X9F5	Aeromonas_virus	37.5	9.0e-23
WP_039493654.1|4830031_4830277_+	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	60.6	2.1e-18
WP_161530192.1|4830288_4832313_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	48.5	8.8e-179
WP_161530193.1|4832334_4833228_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	60.8	8.0e-100
WP_039295049.1|4833245_4833479_+	hypothetical protein	NA	A0A2D1GNI5	Pseudomonas_phage	52.6	2.2e-17
WP_161530194.1|4833482_4833686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161530195.1|4833675_4834314_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	64.7	1.4e-69
WP_161530196.1|4834315_4834504_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	47.4	7.4e-08
WP_161530197.1|4834907_4835123_+	hypothetical protein	NA	A0A2D1GNI2	Pseudomonas_phage	55.2	1.5e-15
WP_161530198.1|4835119_4835569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161530199.1|4836170_4836674_+	hypothetical protein	NA	NA	NA	NA	NA
4836260:4836276	attR	GGCGCAGATAGCCGAAG	NA	NA	NA	NA
WP_161530200.1|4836660_4837062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161530201.1|4837058_4837475_+	DUF1018 domain-containing protein	NA	A0A2D1GNN4	Pseudomonas_phage	55.2	4.2e-35
WP_161530202.1|4837477_4837912_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	41.0	2.7e-21
WP_161530203.1|4837921_4838446_+	hypothetical protein	NA	A0A1I9KF52	Aeromonas_phage	37.5	9.0e-19
WP_161530204.1|4838529_4838883_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	53.2	7.9e-19
WP_161530205.1|4838885_4839500_+	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	55.3	1.8e-58
WP_161530206.1|4839483_4840092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161530207.1|4840088_4840331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104209444.1|4840327_4840624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161530208.1|4840623_4841124_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	57.2	4.7e-49
WP_161530209.1|4841116_4841320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161530210.1|4841323_4841518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161530211.1|4841504_4841699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161530212.1|4841775_4843425_+|terminase	phage terminase large subunit	terminase	A0A0A1IW02	Pseudomonas_phage	65.6	4.9e-212
WP_161530213.1|4843428_4844997_+	DUF935 family protein	NA	A0A0M5MS00	Ralstonia_phage	47.7	3.2e-128
WP_161530214.1|4844983_4846318_+|capsid	minor capsid protein	capsid	H6V8N8	Pseudomonas_phage	38.0	6.0e-59
WP_161530215.1|4846436_4846979_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	39.8	1.1e-24
WP_161530216.1|4847001_4847379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161530217.1|4847613_4848759_+	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	45.1	2.8e-65
WP_161530218.1|4848751_4849147_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	46.9	1.7e-22
WP_161530219.1|4849158_4850067_+|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	60.5	1.6e-100
WP_161530220.1|4850066_4850495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161530221.1|4850494_4850926_+	DUF1320 family protein	NA	A0A219VH93	Ochrobactrum_phage	38.2	9.4e-14
WP_161530222.1|4850922_4851585_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	36.2	1.4e-19
WP_167521851.1|4851568_4851778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161530223.1|4851764_4853186_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	45.8	3.5e-97
WP_161530224.1|4853197_4853575_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	53.7	6.9e-29
WP_161530225.1|4853580_4853961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161530226.1|4856497_4857895_+	multidrug DMT transporter permease	NA	A0A0M3LQ21	Mannheimia_phage	28.8	9.8e-36
WP_161530227.1|4857878_4859066_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	36.3	1.6e-71
WP_161530228.1|4859055_4859706_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	39.2	1.6e-36
WP_161530229.1|4859763_4860114_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.5	7.6e-30
WP_161530230.1|4860113_4861175_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	45.1	3.2e-79
WP_161530231.1|4861171_4861744_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_167521868.1|4862289_4863378_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	57.6	1.7e-40
WP_161530232.1|4863377_4864019_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	40.2	4.6e-33
WP_161530233.1|4864833_4865823_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_010296516.1|4865819_4866332_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_161530234.1|4866513_4869063_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_161530235.1|4869383_4871426_+	oligopeptidase A	NA	NA	NA	NA	NA
WP_103862845.1|4871422_4872169_+	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_161530236.1|4872319_4874215_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_161530237.1|4874403_4875717_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039474396.1|4875891_4877235_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_010298197.1|4877526_4877964_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_039493737.1|4878521_4878857_+	universal stress protein UspB	NA	NA	NA	NA	NA
WP_161530238.1|4879040_4880546_-	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_161530239.1|4880823_4882044_+	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
WP_161530240.1|4882107_4882317_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_161530241.1|4882656_4883322_+	endonuclease III	NA	NA	NA	NA	NA
WP_161530242.1|4883348_4884878_+	deoxyribodipyrimidine photolyase	NA	A0A1V0CPD8	Kaumoebavirus	25.6	8.5e-25
WP_161530243.1|4884950_4885511_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161530244.1|4885643_4886735_+	N-ethylmaleimide reductase	NA	NA	NA	NA	NA
WP_161530245.1|4886810_4887593_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_161530246.1|4887725_4888544_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_167521829.1|4889072_4889219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161530247.1|4890995_4892303_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_161530248.1|4892503_4893331_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161530249.1|4894070_4895675_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_161530250.1|4895718_4896198_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	38.4	2.7e-22
WP_161530251.1|4896853_4898533_-	kdo(2)-lipid A phosphoethanolamine 7''-transferase	NA	NA	NA	NA	NA
WP_161530252.1|4898789_4900478_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.9	6.7e-31
WP_161530253.1|4900799_4901423_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.2	6.7e-21
WP_005968230.1|4901476_4901752_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_010281663.1|4901770_4903870_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_161530254.1|4903875_4904568_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_161530467.1|4904567_4906649_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_161530255.1|4906855_4908244_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	81.7	1.4e-55
WP_161530256.1|4908401_4910093_+	AsmA family protein	NA	NA	NA	NA	NA
WP_161530257.1|4910309_4911251_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_161530258.1|4911389_4911827_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
