The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034432	Bradyrhizobium sp. LCT2 chromosome, complete genome	9434376	508	40536	9434376	transposase	Caulobacter_phage(40.0%)	25	NA	NA
WP_161532335.1|508_1852_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_161532336.1|3358_3595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161532337.1|6245_6569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536885.1|6790_7855_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0K1LM33	Caulobacter_phage	55.9	4.1e-103
WP_161532338.1|7854_10035_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0K1LMZ5	Caulobacter_phage	66.3	5.5e-227
WP_161532339.1|10929_12273_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_014490248.1|12747_13254_-	GNAT family N-acetyltransferase	NA	C5MKY6	Human_cytomegalovirus	30.8	1.6e-12
WP_161532340.1|15583_15955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125459292.1|17860_18157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011082852.1|19566_20799_-	cytochrome P450	NA	NA	NA	NA	NA
WP_011082853.1|20924_22925_-	cytochrome c	NA	NA	NA	NA	NA
WP_011082854.1|23951_24242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038952271.1|25120_26389_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	3.9e-92
WP_161532339.1|27620_28964_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_161536886.1|29143_30208_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161532341.1|30464_32225_-	oleate hydratase	NA	NA	NA	NA	NA
WP_161532342.1|32270_33029_-	glucose 1-dehydrogenase	NA	A0A0K0KVL6	Prochlorococcus_phage	44.3	1.5e-06
WP_161532241.1|34445_35567_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_126262178.1|35605_35887_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011082861.1|36637_36925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161532343.1|37017_38598_+	recombinase family protein	NA	NA	NA	NA	NA
WP_071916957.1|38650_38902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011082864.1|38984_39170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011082865.1|39464_39698_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_161536887.1|40122_40536_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP034432	Bradyrhizobium sp. LCT2 chromosome, complete genome	9434376	1883982	1943659	9434376	protease,transposase	uncultured_Mediterranean_phage(27.27%)	48	NA	NA
WP_161532241.1|1883982_1885104_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161533206.1|1886353_1886842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097669670.1|1892623_1892833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533207.1|1894463_1895552_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_161536949.1|1895838_1896696_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_161533208.1|1896692_1897421_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.5	9.9e-24
WP_161533209.1|1897438_1898443_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161533210.1|1898544_1899210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536950.1|1899222_1899501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533211.1|1899657_1900329_-	mobile mystery protein B	NA	NA	NA	NA	NA
WP_161533212.1|1900682_1901126_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011087993.1|1901353_1901770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011087992.1|1901994_1902459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533213.1|1902522_1903638_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	4.2e-21
WP_161533214.1|1904294_1904756_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	39.4	4.8e-24
WP_161533215.1|1905285_1906212_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	33.8	1.0e-33
WP_011087986.1|1906378_1906837_-	Hsp20 family protein	NA	E3SM62	Prochlorococcus_phage	37.1	1.5e-17
WP_161536951.1|1906988_1908425_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_161533216.1|1908447_1908792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533217.1|1908791_1909883_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_161533218.1|1910479_1910827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533219.1|1911029_1912652_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	59.2	4.0e-174
WP_028171493.1|1912700_1913015_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	57.6	4.7e-23
WP_097669666.1|1913280_1913484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533220.1|1915147_1915600_-	Hsp20 family protein	NA	A0A2L0V0Y9	Agrobacterium_phage	40.2	7.8e-19
WP_028160472.1|1916081_1916537_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	41.2	6.0e-27
WP_011087974.1|1916604_1916934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028160473.1|1916944_1917166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011087973.1|1917162_1918395_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_028171496.1|1918588_1918780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028171497.1|1918883_1919222_+	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_161533221.1|1919726_1919960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097669664.1|1920052_1920235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533222.1|1922859_1923066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533223.1|1923566_1923857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533224.1|1924242_1924509_+	DUF3551 domain-containing protein	NA	NA	NA	NA	NA
WP_161536952.1|1927139_1928780_-	recombinase family protein	NA	E5DV73	Deep-sea_thermophilic_phage	26.3	5.0e-07
WP_097669500.1|1929944_1930223_+	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_161533225.1|1930376_1931285_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_161536953.1|1931824_1932946_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161533226.1|1932989_1933247_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161533227.1|1936080_1936722_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161536954.1|1936842_1937895_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_161533228.1|1939097_1939730_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_161533229.1|1939729_1940992_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.8	5.8e-11
WP_161533230.1|1941241_1941673_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_161533231.1|1941669_1942521_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_161532241.1|1942537_1943659_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP034432	Bradyrhizobium sp. LCT2 chromosome, complete genome	9434376	2019766	2223584	9434376	integrase,transposase	Stx2-converting_phage(12.5%)	148	2059702:2059716	2109805:2109819
WP_161533254.1|2019766_2020540_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.2	3.3e-09
WP_038952109.1|2021665_2022433_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	27.4	2.7e-19
WP_161532270.1|2022437_2024195_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_161533255.1|2025962_2027087_-	molybdenum ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_161536959.1|2028072_2029113_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_161533256.1|2029823_2030450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536960.1|2030907_2031210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533257.1|2032049_2032226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533258.1|2032439_2032730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536961.1|2033256_2033370_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161536962.1|2033721_2035110_+	peptidase S10	NA	NA	NA	NA	NA
WP_161533259.1|2038077_2038728_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_161533260.1|2038699_2040886_-	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_161533261.1|2042322_2043975_+	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_161533262.1|2043984_2045196_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_161533263.1|2045217_2045730_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_161533264.1|2045722_2046184_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_161533265.1|2046176_2046566_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_161533266.1|2046565_2047294_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_161533267.1|2047293_2048232_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_161533268.1|2048228_2049296_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_161533269.1|2049292_2049856_+	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_161533270.1|2049869_2050499_+	general secretion pathway protein GspN	NA	NA	NA	NA	NA
WP_161532335.1|2050861_2052205_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_161533271.1|2052550_2053036_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_161533272.1|2054422_2055700_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_161532339.1|2056377_2057721_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_161533273.1|2058028_2059423_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
2059702:2059716	attL	CGCTTGGCGCGATGA	NA	NA	NA	NA
WP_161533274.1|2060072_2060228_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161533275.1|2060308_2060575_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161533276.1|2061757_2063140_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	8.6e-109
WP_157158178.1|2063553_2063925_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011084591.1|2063921_2064275_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_161533277.1|2064347_2065952_+|transposase	IS66-like element ISBj7 family transposase	transposase	A0A218MNE7	uncultured_virus	33.5	1.0e-65
WP_038379303.1|2066518_2066869_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_060912650.1|2066994_2068551_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	6.5e-89
WP_060908463.1|2068551_2068989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533278.1|2069296_2069965_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_161533279.1|2070305_2071190_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.8	9.2e-32
WP_161533280.1|2071201_2072407_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_161536963.1|2072795_2072981_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	54.7	7.8e-10
WP_161533281.1|2076101_2076821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533282.1|2076880_2077630_-	hypothetical protein	NA	A0A1X9SH03	Bradyrhizobium_phage	43.8	7.5e-43
WP_097669898.1|2079072_2079663_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_097669897.1|2079694_2081812_-	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_097669896.1|2081821_2082250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097669895.1|2082253_2082787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097669894.1|2082820_2083714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533283.1|2083831_2084023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097669892.1|2084067_2084373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533284.1|2085132_2086626_+	DUF1521 domain-containing protein	NA	NA	NA	NA	NA
WP_097669890.1|2087325_2087529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097669889.1|2088320_2089274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533285.1|2089862_2090819_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0K1LM33	Caulobacter_phage	53.9	1.7e-84
WP_161533286.1|2092597_2093281_-	nodulation protein NolW	NA	NA	NA	NA	NA
WP_161533287.1|2093484_2093991_+	nodulation protein NolB	NA	NA	NA	NA	NA
WP_097669638.1|2094000_2094867_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_097669617.1|2094878_2095511_+	nodulation protein NolU	NA	NA	NA	NA	NA
WP_097669618.1|2095507_2096131_+	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_161533288.1|2096127_2097483_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_097669639.1|2097458_2097995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533289.1|2097991_2099110_+	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_097669621.1|2099102_2099768_+	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_097669622.1|2099770_2100046_+	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_097669623.1|2100056_2100878_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_161533290.1|2100874_2101912_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_097669625.1|2101948_2102614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533291.1|2102933_2104388_-	type II and III secretion system protein family protein	NA	NA	NA	NA	NA
WP_161533292.1|2104415_2105105_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_161533293.1|2108777_2109998_+	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
2109805:2109819	attR	CGCTTGGCGCGATGA	NA	NA	NA	NA
WP_161533294.1|2111131_2112613_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_097669630.1|2112817_2113699_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_161533295.1|2114022_2115264_+	cytochrome P450	NA	NA	NA	NA	NA
WP_161532315.1|2115327_2116674_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.6	2.2e-45
WP_161533296.1|2118306_2120010_-	porin family protein	NA	NA	NA	NA	NA
WP_097669633.1|2120405_2120612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533297.1|2120621_2120855_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_161533298.1|2121327_2121660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533299.1|2121656_2121887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533300.1|2121883_2124130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533301.1|2124421_2125786_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_161533302.1|2125808_2126210_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	59.1	1.1e-05
WP_038937265.1|2126206_2126554_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	56.6	4.3e-33
WP_161533303.1|2127677_2128682_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_097669454.1|2131400_2131985_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	49.2	4.2e-49
WP_161533304.1|2131981_2133376_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	40.6	8.2e-43
WP_161533305.1|2133489_2133849_-	Dabb family protein	NA	NA	NA	NA	NA
WP_097669451.1|2134694_2135330_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_161533306.1|2135324_2135738_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161533307.1|2136635_2136839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533308.1|2137077_2137422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533309.1|2137535_2137733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533310.1|2137721_2138687_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_161533311.1|2140518_2141707_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	4.3e-48
WP_038952271.1|2142096_2143365_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	3.9e-92
WP_039183785.1|2144058_2144922_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	36.7	1.1e-32
WP_039187468.1|2144921_2146421_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.1	6.0e-15
WP_161536964.1|2147075_2147192_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_161533312.1|2147711_2148914_+	cytochrome P450	NA	NA	NA	NA	NA
WP_161533313.1|2149008_2150298_+	cytochrome P450	NA	NA	NA	NA	NA
WP_097669443.1|2150299_2150608_+	ferredoxin	NA	NA	NA	NA	NA
WP_097669442.1|2150594_2151440_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_161533314.1|2151439_2152783_+	cytochrome P450	NA	S4VQU1	Pandoravirus	35.4	5.5e-12
WP_161536965.1|2152937_2153936_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_161533315.1|2154245_2155796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533316.1|2155792_2156695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533317.1|2157960_2158362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533318.1|2158634_2159618_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_161533319.1|2160094_2161249_+	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	28.7	7.3e-21
WP_161533320.1|2161245_2161881_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_161533321.1|2164113_2164302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533322.1|2165116_2165989_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_161533323.1|2166002_2166821_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_161532315.1|2171780_2173127_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.6	2.2e-45
WP_161533324.1|2173807_2175802_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.2	9.7e-13
WP_161532315.1|2175945_2177292_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.6	2.2e-45
WP_161532241.1|2178111_2179233_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161533325.1|2180646_2181504_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_161533326.1|2182026_2183331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533327.1|2183463_2184747_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_161533328.1|2184743_2185028_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161533329.1|2185363_2185885_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_161533330.1|2186996_2187461_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_161533331.1|2188494_2188695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533332.1|2188875_2190111_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_161536966.1|2190765_2192160_+	hypothetical protein	NA	A0A0M3SGR2	Mollivirus	26.1	7.3e-15
WP_161533333.1|2192169_2192856_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_161533334.1|2192930_2193758_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_161533335.1|2194859_2195198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533336.1|2196428_2196833_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_161533337.1|2198799_2199252_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_161533338.1|2199254_2201576_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_161533339.1|2201663_2203451_+	PQQ-dependent dehydrogenase, methanol/ethanol family	NA	NA	NA	NA	NA
WP_161533340.1|2203516_2204134_+	cytochrome c	NA	NA	NA	NA	NA
WP_161533341.1|2204130_2204778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533342.1|2205114_2206122_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_161533343.1|2206203_2207652_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_161533344.1|2207745_2208675_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_161533345.1|2208941_2209994_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_161533346.1|2210307_2211906_+	3-oxoacid CoA-transferase	NA	NA	NA	NA	NA
WP_161533347.1|2211918_2212683_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_161533348.1|2212734_2213520_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_161533349.1|2213639_2214986_+	MFS transporter	NA	NA	NA	NA	NA
WP_161533350.1|2215050_2216202_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_161533351.1|2217108_2218065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533352.1|2218758_2218926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536967.1|2220521_2221421_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_161533353.1|2222519_2223584_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP034432	Bradyrhizobium sp. LCT2 chromosome, complete genome	9434376	2233116	2347009	9434376	integrase,tRNA,transposase	Leptospira_phage(25.0%)	55	2248130:2248152	2285034:2285056
WP_161533355.1|2233116_2234694_+|tRNA	class I tRNA ligase family protein	tRNA	NA	NA	NA	NA
WP_161533356.1|2234713_2235847_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_011084591.1|2238478_2238832_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_161533357.1|2238828_2239200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161533358.1|2240454_2241078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533276.1|2242177_2243560_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	8.6e-109
WP_161536969.1|2244170_2246084_+	hypothetical protein	NA	NA	NA	NA	NA
2248130:2248152	attL	TGCACCAAATATGCGGAAGAACC	NA	NA	NA	NA
WP_161536970.1|2251736_2252522_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.2	1.7e-24
WP_161533359.1|2258960_2260307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533360.1|2260593_2261064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097669982.1|2261477_2262101_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_161533361.1|2265167_2265941_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.2	1.5e-09
WP_161533362.1|2269386_2269590_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_161533363.1|2270210_2271902_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_161536971.1|2273263_2273545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533364.1|2274704_2274893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533365.1|2274895_2275090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533366.1|2275550_2275943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533367.1|2281028_2283131_-	recombinase family protein	NA	NA	NA	NA	NA
WP_161533368.1|2293384_2293594_+	hypothetical protein	NA	NA	NA	NA	NA
2285034:2285056	attR	GGTTCTTCCGCATATTTGGTGCA	NA	NA	NA	NA
WP_161533369.1|2294457_2294946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536972.1|2294965_2295253_-	cytochrome c	NA	NA	NA	NA	NA
WP_161533370.1|2295372_2296950_-	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_161533371.1|2299568_2302715_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_161533372.1|2305792_2306074_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161533373.1|2306722_2306995_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_161533374.1|2307160_2307355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533375.1|2307401_2308010_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_161533376.1|2308267_2309203_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161533377.1|2309344_2309626_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161533378.1|2310050_2310923_-	phosphoenolpyruvate phosphomutase	NA	NA	NA	NA	NA
WP_161533379.1|2312204_2313383_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	32.5	3.0e-22
WP_161533380.1|2313379_2314345_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_161533381.1|2314341_2315190_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_161533382.1|2315259_2316177_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_161533383.1|2316433_2317504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533384.1|2317857_2319111_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_161536973.1|2319823_2320399_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_161532301.1|2320405_2321636_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	65.6	6.7e-105
WP_161533385.1|2321600_2322704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533386.1|2323581_2324415_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_161533387.1|2324899_2325814_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_039187468.1|2325958_2327458_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.1	6.0e-15
WP_039183785.1|2327457_2328321_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	36.7	1.1e-32
WP_161533388.1|2328913_2330099_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	6.1e-47
WP_161533389.1|2331531_2332008_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_161533277.1|2332431_2334036_-|transposase	IS66-like element ISBj7 family transposase	transposase	A0A218MNE7	uncultured_virus	33.5	1.0e-65
WP_011084591.1|2334108_2334462_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_161533390.1|2334458_2334830_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161533391.1|2337946_2338438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533392.1|2339082_2339475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533393.1|2340118_2342245_+	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	31.2	1.3e-39
WP_161533311.1|2342677_2343866_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	4.3e-48
WP_161533394.1|2344269_2344476_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	52.7	6.7e-10
WP_161532270.1|2345251_2347009_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP034432	Bradyrhizobium sp. LCT2 chromosome, complete genome	9434376	2352018	2445366	9434376	transposase	Acidithiobacillus_phage(22.22%)	56	NA	NA
WP_161533396.1|2352018_2353044_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_161533397.1|2353204_2353477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533398.1|2355234_2356581_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.6	2.2e-45
WP_161533399.1|2358548_2360225_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_161533400.1|2362191_2363511_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_161533401.1|2363510_2363762_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161533402.1|2364255_2365812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533403.1|2365801_2366440_+	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_161533404.1|2366436_2369871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533405.1|2369873_2371043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533406.1|2371280_2371547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533407.1|2373735_2374062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533408.1|2374113_2374389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533409.1|2374595_2375942_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	43.0	1.0e-45
WP_161533276.1|2376449_2377832_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	8.6e-109
WP_161533410.1|2379649_2380948_+	polygalacturonase	NA	NA	NA	NA	NA
WP_161533411.1|2381166_2382207_+	pectin esterase	NA	NA	NA	NA	NA
WP_161533412.1|2382967_2384794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533413.1|2385689_2387447_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_161536974.1|2387753_2388206_-	GNAT family N-acetyltransferase	NA	C5MKY6	Human_cytomegalovirus	27.2	6.6e-10
WP_161533276.1|2389536_2390919_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	8.6e-109
WP_161536975.1|2392060_2393536_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_028343822.1|2395386_2395689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533414.1|2395685_2396135_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_161536976.1|2396570_2397692_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161533226.1|2397735_2397993_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161533415.1|2399582_2400548_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_161536977.1|2400833_2401703_-	phosphoenolpyruvate mutase	NA	NA	NA	NA	NA
WP_161533416.1|2402363_2402927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533417.1|2403035_2403365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533418.1|2403504_2403852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533419.1|2403773_2404601_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_161533420.1|2404735_2406088_-	radical SAM protein	NA	NA	NA	NA	NA
WP_161533421.1|2407078_2407852_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_161533422.1|2408218_2409454_+	glycoside hydrolase family 18 protein	NA	B7SVP5	Spodoptera_litura_nucleopolyhedrovirus	32.2	2.9e-39
WP_161533423.1|2409988_2410198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533424.1|2411460_2411610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533425.1|2413275_2413536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533426.1|2415327_2415714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533427.1|2416712_2416961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536978.1|2417036_2417375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533428.1|2418215_2419538_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.3	3.6e-32
WP_161533429.1|2420390_2421128_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_161533430.1|2423055_2423277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533431.1|2423770_2424271_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161533216.1|2426882_2427227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533217.1|2427226_2428318_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_161533432.1|2430254_2430515_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161533433.1|2433112_2434075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533434.1|2434547_2434793_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_161533435.1|2435775_2436189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028176056.1|2436994_2438194_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_028176057.1|2438870_2440211_+	adenylate/guanylate cyclase domain-containing protein	NA	W5S556	Pithovirus	27.3	1.5e-09
WP_028176058.1|2440528_2442325_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_161533436.1|2442621_2442990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161532247.1|2444135_2445366_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	66.3	1.5e-104
>prophage 6
NZ_CP034432	Bradyrhizobium sp. LCT2 chromosome, complete genome	9434376	2456347	2523808	9434376	transposase	Escherichia_phage(33.33%)	58	NA	NA
WP_039187468.1|2456347_2457847_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.1	6.0e-15
WP_161533443.1|2457969_2459178_-	MFS transporter	NA	NA	NA	NA	NA
WP_161533444.1|2459550_2460855_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_161533445.1|2460790_2461387_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_161533446.1|2461383_2463606_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_161536980.1|2463787_2464453_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_126262178.1|2465039_2465321_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161532241.1|2465359_2466481_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161536981.1|2467408_2467708_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_161533447.1|2467704_2469363_+	sodium/solute symporter	NA	NA	NA	NA	NA
WP_161533448.1|2469394_2469808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533449.1|2470662_2471280_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_161533450.1|2471462_2472164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536982.1|2472665_2473049_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_161533451.1|2472925_2473399_+	response regulator	NA	NA	NA	NA	NA
WP_161533452.1|2474682_2474904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533453.1|2474915_2475335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536983.1|2475992_2476631_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_161533454.1|2477261_2477453_-	CsbD family protein	NA	NA	NA	NA	NA
WP_161533455.1|2477865_2478102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135173112.1|2478388_2478769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533456.1|2479682_2479925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533457.1|2480036_2480300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533458.1|2481534_2482020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533459.1|2482468_2483230_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.9	9.4e-25
WP_161533460.1|2483465_2484362_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161533461.1|2485403_2485814_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_161536984.1|2485894_2486488_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_161533462.1|2486624_2487257_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_161533463.1|2487615_2488089_-	Phasin protein	NA	NA	NA	NA	NA
WP_161533464.1|2488999_2489314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533465.1|2490381_2490645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536985.1|2490885_2491395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533466.1|2492512_2492878_+	CsbD family protein	NA	NA	NA	NA	NA
WP_161533467.1|2492965_2493214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533468.1|2493736_2495518_+	exonuclease VII large subunit	NA	NA	NA	NA	NA
WP_161533469.1|2495731_2497669_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_161533470.1|2498398_2498929_-	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_161532247.1|2499229_2500461_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	66.3	1.5e-104
WP_161536986.1|2500703_2501036_+	phasin family protein	NA	NA	NA	NA	NA
WP_041955327.1|2501161_2501407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161533471.1|2501865_2502093_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_060912692.1|2502379_2502559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536987.1|2503313_2503871_+	DUF1236 domain-containing protein	NA	NA	NA	NA	NA
WP_129557372.1|2504536_2504779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129557371.1|2504993_2506169_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_161533472.1|2508719_2510102_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_161533473.1|2510098_2512042_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_060912691.1|2513899_2514340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060908802.1|2514463_2514835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060908801.1|2515812_2516343_-	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_161533474.1|2516639_2518004_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_060908798.1|2518311_2518560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533475.1|2518760_2519036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129557370.1|2520076_2520334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082755440.1|2520528_2520693_-	DUF3309 family protein	NA	NA	NA	NA	NA
WP_161533476.1|2520929_2522210_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_161536988.1|2522368_2523808_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP034432	Bradyrhizobium sp. LCT2 chromosome, complete genome	9434376	4976063	4983481	9434376		uncultured_Mediterranean_phage(100.0%)	8	NA	NA
WP_161534844.1|4976063_4977092_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	41.2	1.0e-21
WP_011087521.1|4977088_4977928_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	37.1	1.1e-31
WP_028171841.1|4977949_4978702_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	49.7	4.0e-44
WP_011087519.1|4978868_4979102_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	63.6	5.4e-08
WP_161534845.1|4979191_4979719_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_027546595.1|4979715_4980528_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	48.4	4.2e-55
WP_028171843.1|4982162_4982525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028171844.1|4982713_4983481_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	37.6	1.8e-36
>prophage 8
NZ_CP034432	Bradyrhizobium sp. LCT2 chromosome, complete genome	9434376	7021750	7031340	9434376		Escherichia_phage(42.86%)	8	NA	NA
WP_161535847.1|7021750_7023943_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.1	6.3e-13
WP_161535848.1|7024122_7025814_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	1.8e-12
WP_161535849.1|7025985_7027260_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	42.0	4.8e-74
WP_028172388.1|7027256_7028039_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_161535850.1|7028055_7028973_-	NAD-binding protein	NA	A0A077SLF7	Escherichia_phage	48.3	2.4e-67
WP_161535851.1|7029079_7029760_+	aldolase	NA	A0A077SK32	Escherichia_phage	50.2	5.4e-48
WP_161535852.1|7029920_7030625_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	3.8e-12
WP_011085709.1|7030608_7031340_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.6	3.9e-12
>prophage 9
NZ_CP034432	Bradyrhizobium sp. LCT2 chromosome, complete genome	9434376	8084505	8140679	9434376	integrase,transposase	Enterobacter_phage(10.0%)	37	8077756:8077771	8092953:8092968
8077756:8077771	attL	GGATGCCGACGCCGTG	NA	NA	NA	NA
WP_161536338.1|8084505_8085750_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	27.0	6.9e-17
WP_161536339.1|8085922_8086513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536340.1|8086580_8087672_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	31.4	4.2e-34
WP_161536341.1|8087668_8088085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161537152.1|8089918_8090677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536342.1|8090836_8092654_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_161536343.1|8092640_8094425_-	AAA family ATPase	NA	NA	NA	NA	NA
8092953:8092968	attR	CACGGCGTCGGCATCC	NA	NA	NA	NA
WP_161536344.1|8100192_8101011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536345.1|8101487_8102000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126262178.1|8102043_8102325_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161532241.1|8102363_8103485_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161536346.1|8103457_8103805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536347.1|8103937_8104783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536348.1|8104779_8107785_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	24.4	1.7e-13
WP_161536349.1|8107966_8109391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536350.1|8110120_8111191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536351.1|8111496_8112651_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_161536352.1|8112653_8114522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536353.1|8114526_8116197_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_161536354.1|8117019_8117772_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.2	2.5e-09
WP_161536355.1|8119822_8121190_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	48.1	2.5e-113
WP_161532247.1|8122189_8123421_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	66.3	1.5e-104
WP_161536356.1|8123650_8124637_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_161536357.1|8124636_8125716_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_161536358.1|8126100_8126328_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161536359.1|8126324_8127584_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_161536360.1|8127769_8128288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161537153.1|8128688_8129015_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_161536361.1|8130001_8130208_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	47.6	6.7e-10
WP_161536362.1|8130698_8131223_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161536363.1|8132264_8133032_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	27.4	4.6e-19
WP_161536364.1|8134609_8135041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536365.1|8135037_8135478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536366.1|8135776_8136742_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_161536367.1|8136846_8137692_+	hypothetical protein	NA	K4NYC2	Heliothis_virescens_ascovirus	24.1	1.1e-05
WP_039183785.1|8139500_8140364_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	36.7	1.1e-32
WP_161537154.1|8140373_8140679_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP034432	Bradyrhizobium sp. LCT2 chromosome, complete genome	9434376	8175424	8337844	9434376	integrase,protease,transposase	Acidithiobacillus_phage(13.64%)	107	8247886:8247905	8255036:8255055
WP_148770279.1|8175424_8175985_+|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	NA	NA	NA	NA
WP_028154436.1|8176654_8176957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536392.1|8177130_8177340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536393.1|8178175_8178415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536394.1|8178782_8179244_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	37.9	6.3e-24
WP_161536395.1|8179327_8179819_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	38.2	2.8e-14
WP_161536396.1|8179891_8180212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038958306.1|8180594_8180951_+	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_161536397.1|8181052_8181406_+	response regulator	NA	W8CYM9	Bacillus_phage	31.0	2.2e-05
WP_161536398.1|8182692_8183133_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_161537157.1|8183151_8184267_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_161536399.1|8184408_8184618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071911000.1|8185776_8186094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536400.1|8186118_8187225_-	DUF1236 domain-containing protein	NA	NA	NA	NA	NA
WP_071910996.1|8187438_8187666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536401.1|8188137_8188338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536402.1|8189907_8190060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011084519.1|8192414_8193260_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.0	1.1e-34
WP_161536403.1|8195027_8196527_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_161536404.1|8196564_8198079_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	6.5e-09
WP_161536405.1|8198119_8199046_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_161536406.1|8199049_8200126_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_161537158.1|8200135_8201242_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161536407.1|8201270_8202236_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_161537159.1|8202430_8203222_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161536408.1|8204075_8205512_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161536409.1|8205574_8206498_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_161536410.1|8206494_8207334_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_161536411.1|8207344_8208448_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	5.5e-26
WP_161536412.1|8208482_8209373_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_161536413.1|8209418_8211311_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_161536414.1|8211307_8212375_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161536415.1|8212526_8213579_-	transketolase family protein	NA	NA	NA	NA	NA
WP_161536416.1|8213533_8214385_-	transketolase	NA	NA	NA	NA	NA
WP_161536417.1|8214409_8215159_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_161536418.1|8215267_8216164_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161536419.1|8216213_8217230_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_161536420.1|8218747_8219422_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_161536421.1|8219426_8220209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161537160.1|8223337_8224081_+	host specificity protein	NA	NA	NA	NA	NA
WP_011084591.1|8226826_8227180_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_157158178.1|8227176_8227548_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_097670005.1|8228084_8228477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536422.1|8229365_8229572_+	cold-shock protein	NA	NA	NA	NA	NA
WP_161536423.1|8230509_8232267_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_161533216.1|8233575_8233920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536424.1|8234565_8235849_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_161536425.1|8235835_8236171_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038952271.1|8237155_8238424_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	3.9e-92
WP_161536426.1|8238487_8238670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536427.1|8238799_8240137_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_161536428.1|8240136_8241417_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_097669825.1|8241413_8242316_-	DMT family transporter	NA	NA	NA	NA	NA
WP_161536429.1|8242445_8243264_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_097669827.1|8243260_8244319_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_161536430.1|8244350_8246762_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
8247886:8247905	attL	CTAGGGTCTGTTTGGATTCA	NA	NA	NA	NA
WP_161536431.1|8247902_8248289_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161533276.1|8248731_8250114_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	8.6e-109
WP_161536432.1|8251185_8251434_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161536433.1|8252199_8252490_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_097669770.1|8254053_8254437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536434.1|8255379_8255622_-	hypothetical protein	NA	NA	NA	NA	NA
8255036:8255055	attR	TGAATCCAAACAGACCCTAG	NA	NA	NA	NA
WP_097669771.1|8255804_8255990_-	hypothetical protein	NA	A0A1X9SH55	Bradyrhizobium_phage	62.1	3.5e-10
WP_060908463.1|8257185_8257623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161537155.1|8257623_8259180_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	5.0e-89
WP_038379303.1|8259305_8259656_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_060908461.1|8259652_8260099_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143279399.1|8260451_8260739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097669773.1|8261121_8261349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536435.1|8261645_8262029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536436.1|8262214_8262631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143279401.1|8262777_8263038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161537161.1|8263085_8263271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536437.1|8264791_8265397_+	response regulator	NA	NA	NA	NA	NA
WP_161536438.1|8267515_8267758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161537162.1|8267888_8268146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536439.1|8270531_8272877_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_161537163.1|8274216_8275017_+	nodulate formation efficiency C protein	NA	NA	NA	NA	NA
WP_161536440.1|8277150_8277891_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_038952109.1|8285919_8286687_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	27.4	2.7e-19
WP_161536441.1|8286841_8287489_-	FkbM family methyltransferase	NA	Q58M88	Prochlorococcus_phage	27.9	1.8e-13
WP_161536442.1|8288880_8291034_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	3.7e-42
WP_161536443.1|8291063_8292149_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_161536444.1|8292324_8292468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161533311.1|8293548_8294737_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	4.3e-48
WP_161532315.1|8295219_8296566_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.6	2.2e-45
WP_097669955.1|8297531_8297846_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	58.7	1.8e-22
WP_161536445.1|8297929_8299570_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	58.2	3.9e-169
WP_161536446.1|8300838_8302377_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_161536447.1|8302416_8302635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161537164.1|8302790_8303198_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_161536448.1|8305009_8306554_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_161537165.1|8308495_8309824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536449.1|8313676_8313976_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161537166.1|8315257_8316094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536450.1|8316953_8319392_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_143279288.1|8319562_8319709_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161532315.1|8319930_8321277_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.6	2.2e-45
WP_161536451.1|8322727_8323857_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.8	1.1e-21
WP_161536452.1|8326612_8327959_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.6	2.2e-45
WP_097668606.1|8328298_8328490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536453.1|8331550_8332564_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	5.4e-52
WP_097668530.1|8332819_8333005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536454.1|8333809_8334073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084519.1|8334510_8335356_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.0	1.1e-34
WP_161536455.1|8335316_8336867_-|transposase	IS21-like element ISBj11 family transposase	transposase	NA	NA	NA	NA
WP_161536456.1|8337460_8337844_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP034432	Bradyrhizobium sp. LCT2 chromosome, complete genome	9434376	8370326	8443193	9434376	transposase	Acidithiobacillus_phage(37.5%)	44	NA	NA
WP_161532315.1|8370326_8371673_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.6	2.2e-45
WP_097668512.1|8373481_8373859_+	NolY	NA	NA	NA	NA	NA
WP_161536463.1|8374750_8375485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536464.1|8375592_8376024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536465.1|8377328_8377646_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161533276.1|8378051_8379434_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	8.6e-109
WP_097668612.1|8381093_8381339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097669885.1|8382209_8382935_+	porin family protein	NA	NA	NA	NA	NA
WP_161536466.1|8383192_8384539_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.6	2.2e-45
WP_161537168.1|8384829_8385555_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161536467.1|8386751_8386949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536468.1|8386945_8387488_+	LrgB family protein	NA	NA	NA	NA	NA
WP_161536469.1|8387482_8389084_-	Fic family protein	NA	NA	NA	NA	NA
WP_161536470.1|8389481_8390420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097669882.1|8390416_8390794_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_161536471.1|8391190_8391484_-	DCL family protein	NA	NA	NA	NA	NA
WP_161536472.1|8393950_8394412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097669941.1|8400587_8401925_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_161537169.1|8402337_8402850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536473.1|8402953_8403469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536474.1|8403530_8403833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161537170.1|8407368_8408355_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.5	4.1e-20
WP_161536475.1|8410336_8410621_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161536476.1|8411094_8414082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536477.1|8414787_8415813_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_161536478.1|8416641_8417382_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	49.2	1.8e-60
WP_028176055.1|8419756_8420908_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_052118472.1|8422843_8423512_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161536479.1|8423913_8425074_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_060910340.1|8427749_8428052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011090426.1|8428268_8428460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053815160.1|8428772_8429129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074077358.1|8429555_8430476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053815143.1|8430761_8431181_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_131727850.1|8431446_8431920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082755444.1|8433248_8433854_-	DNA ligase	NA	A0A1X9SH33	Bradyrhizobium_phage	52.8	7.7e-54
WP_038967817.1|8433896_8434136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028176062.1|8434515_8434779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156149849.1|8436884_8437034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027548496.1|8437240_8438278_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_038967815.1|8440192_8440441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039187448.1|8440804_8441176_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_075969263.1|8441172_8441523_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	65.1	2.0e-38
WP_075969262.1|8441582_8443193_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	37.6	1.9e-75
>prophage 12
NZ_CP034432	Bradyrhizobium sp. LCT2 chromosome, complete genome	9434376	9386106	9413742	9434376	integrase,transposase	Acidithiobacillus_phage(40.0%)	23	9385507:9385525	9404349:9404367
9385507:9385525	attL	ATTCCGCTAGGGAGCGCCA	NA	NA	NA	NA
WP_161536867.1|9386106_9386967_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_011090956.1|9387924_9388167_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011090957.1|9388272_9388515_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_161536868.1|9388511_9388751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161532339.1|9389097_9390441_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_161536869.1|9391315_9392539_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_014498624.1|9395066_9395297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011090960.1|9395682_9395886_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	49.2	1.1e-09
WP_161536870.1|9395902_9397333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161537193.1|9397286_9397466_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_011090962.1|9397469_9397922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011090963.1|9397936_9398152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536871.1|9398148_9398427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536872.1|9398591_9399176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536873.1|9399175_9399709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011090967.1|9399906_9400515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536874.1|9402303_9402639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129964954.1|9403305_9403524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161536875.1|9404786_9405650_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	36.7	8.1e-33
9404349:9404367	attR	ATTCCGCTAGGGAGCGCCA	NA	NA	NA	NA
WP_161536876.1|9406824_9408366_+|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	1.3e-126
WP_161532270.1|9408777_9410535_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_038952109.1|9410539_9411307_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	27.4	2.7e-19
WP_161536877.1|9412395_9413742_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.6	1.7e-45
>prophage 1
NZ_CP034431	Bradyrhizobium sp. LCT2 plasmid pLCT2, complete sequence	218234	1107	126098	218234	transposase,integrase	Enterobacteria_phage(24.0%)	56	81621:81637	134523:134539
WP_161532237.1|1107_1674_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_038952109.1|2345_3113_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.1	1.7e-29
WP_161532238.1|6003_6903_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.3	3.8e-33
WP_161532239.1|13569_13836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028182402.1|14077_14359_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161532327.1|17742_18447_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161532240.1|18526_18856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161532241.1|19408_20530_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161532242.1|20590_21739_-	N-methyl-L-tryptophan oxidase	NA	NA	NA	NA	NA
WP_161532243.1|22284_23231_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	23.7	1.2e-13
WP_161532328.1|23533_23896_+	hypothetical protein	NA	Q6H9S6	Enterobacteria_phage	65.9	9.0e-10
WP_126262178.1|24480_24762_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161532244.1|25997_26309_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_161532245.1|26305_26833_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_161532246.1|27956_29060_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_038952109.1|31902_32670_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.1	1.7e-29
WP_161532247.1|35011_36243_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	66.3	1.5e-104
WP_161532248.1|36338_37685_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	43.0	1.0e-45
WP_161532249.1|37943_38264_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161532250.1|38492_39326_-	creatininase family protein	NA	NA	NA	NA	NA
WP_161532251.1|40335_40944_+	phasin family protein	NA	NA	NA	NA	NA
WP_161532252.1|41435_42779_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_161532253.1|43822_44776_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	43.8	1.7e-44
WP_161532254.1|44765_45338_+|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	45.4	8.3e-42
WP_161532255.1|45353_45905_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.5	1.8e-30
WP_161532256.1|45984_47202_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	28.2	5.2e-09
WP_161532257.1|47198_48176_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_161532258.1|48172_49198_+|integrase	tyrosine-type recombinase/integrase	integrase	B3GAN2	uncultured_virus	27.6	4.4e-09
WP_161532259.1|49968_50691_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_161532260.1|50885_56570_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.4	9.7e-82
WP_161532261.1|56609_64481_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.2	1.3e-89
WP_161532262.1|64477_72037_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	24.9	3.1e-67
WP_161532263.1|72033_79326_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.8	8.5e-107
WP_161532264.1|79322_89006_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.1	3.4e-71
81621:81637	attL	TTCGCCGCCGAAGATCA	NA	NA	NA	NA
WP_161532265.1|89204_89534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161532266.1|89904_90678_-	thioesterase	NA	NA	NA	NA	NA
WP_161532267.1|90754_91504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161532268.1|91539_91914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161532269.1|91991_92231_+	MbtH family NRPS accessory protein	NA	NA	NA	NA	NA
WP_038952271.1|93817_95086_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	3.9e-92
WP_161532270.1|96449_98207_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.1	4.5e-14
WP_038952109.1|98211_98979_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.1	1.7e-29
WP_161532241.1|101914_103036_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_126262178.1|103074_103356_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086023025.1|105551_106680_+|transposase	IS3-like element ISRj2 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	34.2	5.3e-16
WP_161532271.1|107371_109249_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	34.1	2.2e-99
WP_161532272.1|110183_112130_-	glycosyltransferase	NA	M1GYM3	Paramecium_bursaria_Chlorella_virus	33.8	1.5e-29
WP_161532273.1|114003_114180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161532274.1|114357_115278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161532275.1|115274_117980_-	DEAD/DEAH box helicase	NA	A0A160DDK8	Gordonia_phage	27.2	4.1e-38
WP_161532276.1|118067_118445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060913170.1|118454_120656_-	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	31.2	2.1e-56
WP_161532277.1|122395_122749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161532278.1|123184_123871_-	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_161532329.1|123888_124830_-	DUF1403 family protein	NA	NA	NA	NA	NA
WP_161532279.1|124952_126098_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
134523:134539	attR	TGATCTTCGGCGGCGAA	NA	NA	NA	NA
