The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	199890	311987	5554243	protease,tRNA,plate,integrase,tail,transposase	Enterobacteria_phage(20.69%)	99	276169:276183	312403:312417
WP_001295561.1|199890_201243_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|201272_203705_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|203825_204311_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|204314_205340_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|205444_205900_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565963.1|205903_206692_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139661.1|206691_207840_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|207836_208433_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294772.1|208469_211952_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055741.1|211964_212924_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|213022_215164_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|215220_215610_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176537.1|215674_216970_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217022_217283_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217269_217470_-	YaeP family protein	NA	NA	NA	NA	NA
WP_000635546.1|218177_218588_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218601_219312_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219511_220336_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220388_222107_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222217_222925_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222921_223326_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223443_224259_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224298_224952_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224944_225976_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226163_226739_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232496_233300_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233296_234211_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234451_235252_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235329_236100_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236147_237506_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237577_238333_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238366_239089_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239085_239553_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239617_240349_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240886_241687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242164_242614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|242616_243213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|243291_243513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243533_244013_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243978_245388_-	membrane protein	NA	NA	NA	NA	NA
WP_001303798.1|245398_248833_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000088854.1|250385_251129_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614374.1|251125_253897_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	3.6e-82
WP_000343292.1|253905_254667_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|254671_256003_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|256005_256530_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256526_257807_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257831_258914_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258877_260728_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260731_261145_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261235_262627_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262677_262902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262936_263437_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264133_264652_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|264861_267003_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_000509132.1|267078_271293_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_001356493.1|271361_271907_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420837.1|272652_273789_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001145876.1|273791_275552_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000247943.1|275753_276017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|275931_276117_-	protein YncO	NA	NA	NA	NA	NA
276169:276183	attL	AATAACTAAAAAGAT	NA	NA	NA	NA
WP_000027427.1|276197_277370_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_001118031.1|277487_278258_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|278411_278885_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973071.1|278927_281372_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|281611_282190_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001301698.1|282294_283062_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|283032_283773_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001303998.1|283928_284189_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729705.1|284207_284468_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543891.1|284653_285427_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001301901.1|286244_287984_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207556.1|287928_288714_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226188.1|288784_289840_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|289891_290185_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263495.1|290187_290586_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059871.1|290595_291048_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001303804.1|291354_291621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077626217.1|291553_292090_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001291990.1|293863_294322_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189536.1|294413_295658_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174701.1|295715_296117_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|296155_297211_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|297498_298602_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|298613_299867_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|300936_301182_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000708838.1|301421_301811_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001274756.1|301938_302652_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|302752_302953_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|303071_303365_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|304316_304628_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|304627_305422_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|305421_306015_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|305986_306430_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001115553.1|306450_306861_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000904979.1|306890_307445_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|307502_308276_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|309099_309843_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|310805_311987_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
312403:312417	attR	AATAACTAAAAAGAT	NA	NA	NA	NA
>prophage 2
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	409367	450309	5554243	protease,head,plate,integrase,tail,transposase	Shigella_phage(55.0%)	59	405699:405714	422920:422935
405699:405714	attL	CCGGTGCGGCGGGATT	NA	NA	NA	NA
WP_021502881.1|409367_409952_-	phage repressor protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	3.2e-17
WP_001310454.1|410119_410368_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289295.1|410369_412460_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	6.8e-166
WP_000129790.1|412531_413464_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|413466_413688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|413700_413955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|413956_414238_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|414234_414507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049306.1|414511_414805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|414816_415347_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323221.1|415444_415987_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_000578573.1|415990_416524_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000465562.1|416523_417039_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_160124428.1|417042_417594_+	AsnC family protein	NA	NA	NA	NA	NA
WP_000633440.1|417590_417902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145588.1|417898_418267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|418282_418615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|418607_418805_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370521.1|418794_419091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214362.1|419087_419597_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000852378.1|419666_420092_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|420163_420664_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_122994438.1|420698_421127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001122255.1|421110_421329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342749.1|421339_421567_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|421547_421856_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279080.1|421852_422143_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_000360581.1|422145_422727_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057665.1|422726_424391_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
422920:422935	attR	AATCCCGCCGCACCGG	NA	NA	NA	NA
WP_000532590.1|424390_425980_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.9e-168
WP_000046901.1|425963_427295_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000094808.1|427416_427890_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850822.1|428066_429191_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|429190_430138_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002056.1|430181_430580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|430576_430996_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|430992_431553_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|431553_431799_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|431795_433298_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|433306_433672_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|433686_434163_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113523.1|434289_436365_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146116.1|436351_437701_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|437684_438809_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|438798_439413_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|439405_439843_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|439842_440925_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_160124429.1|440915_441476_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
WP_000469162.1|441475_442387_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|442421_442943_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|443022_443226_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|443447_444008_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|444107_446147_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|446293_446476_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|446511_446757_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|446795_447260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|447374_447575_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|447528_448266_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_000010271.1|448422_450309_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 3
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	929789	967886	5554243	protease,portal,integrase,tail,lysis,terminase,holin	Enterobacteria_phage(51.16%)	50	919231:919245	951521:951535
919231:919245	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_024219169.1|929789_930671_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001303849.1|930833_931052_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|931091_931259_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|931501_932104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|932314_932536_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|932634_932916_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|932926_933118_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|933090_933273_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|933269_933950_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|934647_934830_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|934826_934997_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|934989_935610_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|935606_936272_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|936483_937443_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|937780_937903_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|937917_938607_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|938790_939534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|939619_939778_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_012578864.1|939858_940257_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|940399_940615_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|940614_941112_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|941108_941576_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|941563_941716_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|942390_942882_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|942881_944984_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|944980_945193_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|945120_946245_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|946366_946702_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|946646_948674_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|948760_949084_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|949076_949352_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|949363_949942_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|949938_950340_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|950350_951094_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|951154_951541_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
951521:951535	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|951549_951879_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|951850_954916_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|954915_955245_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|955254_955953_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|955958_956702_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|956638_957247_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|957307_960721_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|960791_961391_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741879.1|961450_962767_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|962768_963038_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|963214_964195_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|964228_965248_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|965744_965906_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|966075_966957_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|967187_967886_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	1241716	1406244	5554243	protease,head,portal,bacteriocin,integrase,tail,capsid,terminase,holin,transposase	Escherichia_phage(32.31%)	189	1275562:1275588	1364757:1364783
WP_000156526.1|1241716_1243477_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1243662_1244115_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1244190_1245231_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1245587_1246097_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1246315_1246945_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1246907_1249070_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1249079_1249526_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1249648_1251703_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|1251734_1252193_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1252288_1252951_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1253123_1253537_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1253581_1253899_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1253956_1255147_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1255241_1255520_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1255516_1255846_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1255936_1256596_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1257003_1258023_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1258000_1258243_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1258310_1260782_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1260875_1261067_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1261063_1261252_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1261825_1262011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1262197_1262587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1262728_1262884_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1263161_1263449_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1263448_1263640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1263667_1264069_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1264177_1264450_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1264433_1264859_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1265065_1265521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1265599_1266691_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1266697_1267444_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1267465_1268236_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1268251_1268665_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1269016_1269790_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1270155_1270293_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1270337_1270550_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1270717_1270996_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1270997_1272047_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001217436.1|1272059_1272431_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1272420_1272792_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1272943_1273762_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|1274048_1274288_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|1274382_1275096_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1275562:1275588	attL	TCACCGGGAGGCACCCGGCACCATGCA	NA	NA	NA	NA
WP_000874392.1|1275863_1277714_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_001303878.1|1279070_1279385_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1279912_1280098_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1280319_1280433_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1280653_1281187_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1281346_1281619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1281874_1282081_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1282831_1283107_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1283182_1283563_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1283559_1283907_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1283956_1285495_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|1285544_1285787_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000259002.1|1287669_1287876_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1287872_1289465_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1289454_1290960_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1290996_1291344_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1291401_1291668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1291649_1292390_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1292403_1292835_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1292861_1293275_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082450.1|1293255_1295835_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000847304.1|1295831_1296161_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001151078.1|1296160_1296859_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000194760.1|1296869_1297613_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|1297558_1298191_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649830.1|1298381_1298909_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_000515108.1|1299042_1302516_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_001230444.1|1302583_1303183_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_001023352.1|1304562_1304832_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1307105_1308224_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1308220_1310014_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1310032_1310740_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1310736_1311324_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063969.1|1311320_1311719_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004940.1|1311715_1312573_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263572.1|1312706_1314251_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460778.1|1314262_1315399_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|1315411_1315504_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001301957.1|1315583_1316888_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000208668.1|1317007_1319188_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|1319207_1319654_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|1319641_1320781_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742329.1|1320826_1322923_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038071.1|1322922_1323669_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001301846.1|1323665_1324310_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001299283.1|1324416_1324722_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|1325163_1325376_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|1325661_1325874_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1325884_1326073_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001303885.1|1326047_1326278_+	protein YmcE	NA	NA	NA	NA	NA
WP_050554528.1|1326305_1326440_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818441.1|1326488_1327562_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001264927.1|1330460_1331489_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120119.1|1331461_1332154_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230236.1|1332283_1333456_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063176.1|1333455_1336002_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_000209883.1|1335998_1336598_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|1336751_1337057_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420639.1|1337056_1337977_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_001044286.1|1339784_1341026_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|1341063_1341291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000607020.1|1341311_1341890_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000013654.1|1341886_1343197_-|integrase	site-specific integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_001208773.1|1343249_1343534_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_001303965.1|1343619_1343919_-	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_000212746.1|1344894_1345182_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|1345183_1345402_-	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000951705.1|1345403_1345619_-	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_000797281.1|1345620_1345809_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_021497462.1|1345960_1346734_-	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	100.0	2.3e-143
WP_000763383.1|1346730_1346952_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1347050_1347332_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1347342_1347534_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1347506_1347689_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1347688_1348366_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1348362_1349148_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1349153_1349450_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|1349525_1349669_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198863.1|1349637_1349802_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000065377.1|1349874_1350243_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_000167595.1|1350393_1350864_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000198444.1|1350922_1351306_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000957426.1|1351961_1353008_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|1353001_1353463_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000885203.1|1353530_1353872_-	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_000250473.1|1353932_1354640_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1354718_1354946_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438541.1|1355084_1355381_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_000185454.1|1355413_1356352_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000788928.1|1356348_1357050_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000145931.1|1357046_1357337_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|1357407_1357686_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1357818_1358034_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1358044_1358281_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1358237_1358684_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|1358680_1359208_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000335902.1|1359389_1360439_+	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_001004020.1|1360590_1361313_+	DNA-binding protein	NA	A0A1I9LJQ1	Stx_converting_phage	100.0	7.8e-130
WP_001107955.1|1361312_1361918_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_000144764.1|1361914_1362109_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001507023.1|1362101_1362536_+	phage antitermination Q family protein	NA	A0A0P0ZCW9	Stx2-converting_phage	100.0	2.8e-82
WP_000649753.1|1363319_1364279_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1364290_1364560_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874499.1|1365046_1366984_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
1364757:1364783	attR	TCACCGGGAGGCACCCGGCACCATGCA	NA	NA	NA	NA
WP_000143458.1|1367118_1367298_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|1367338_1367611_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|1367687_1367903_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1367907_1368441_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1368711_1369281_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1369280_1369427_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_015971382.1|1369654_1369840_+	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000738505.1|1369930_1370224_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001086069.1|1370632_1371439_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000143988.1|1371419_1373126_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|1373125_1375270_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|1375427_1376435_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1376458_1377673_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1377728_1378118_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|1378167_1378629_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|1378612_1379176_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207924.1|1379175_1379826_+	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_001024006.1|1381760_1382030_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|1382168_1382357_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146326.1|1382651_1384277_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_000197192.1|1384273_1385542_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|1385556_1385835_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|1385840_1386458_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|1386548_1387283_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|1387515_1387656_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1387712_1388114_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1388207_1388864_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|1388866_1389313_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|1389322_1389574_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|1389584_1390850_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_001507013.1|1390919_1399301_+	hypothetical protein	NA	A0A1I9LJU4	Stx_converting_phage	100.0	0.0e+00
WP_000971668.1|1399583_1399772_+	hypothetical protein	NA	A0A0P0ZAD9	Stx2-converting_phage	100.0	4.1e-30
WP_000756595.1|1399851_1400196_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000935259.1|1400315_1400528_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000426668.1|1400761_1401157_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_001024844.1|1402041_1402326_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_000763353.1|1402322_1402544_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_000203859.1|1402591_1403221_-	phage antirepressor Ant	NA	A0A1I9LJV2	Stx_converting_phage	100.0	1.5e-113
WP_001273654.1|1404210_1404318_+	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_001301708.1|1404400_1405729_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001028088.1|1405749_1406244_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
>prophage 5
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	1465695	1505575	5554243	integrase,protease,transposase	Stx2-converting_phage(36.36%)	36	1459865:1459880	1477765:1477780
1459865:1459880	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
WP_000279869.1|1465695_1466898_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282209.1|1467084_1468902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1470013_1470310_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1470536_1470734_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_160124433.1|1470952_1472338_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|1473158_1473722_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|1473876_1476237_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000998081.1|1476993_1478532_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
1477765:1477780	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
WP_000612591.1|1478581_1478929_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_085948178.1|1479014_1480227_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_032210650.1|1481109_1481964_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	7.0e-69
WP_028913479.1|1482010_1482616_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001303891.1|1482663_1482915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|1482938_1483229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024297.1|1483914_1484274_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591997.1|1484366_1485986_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134927.1|1486210_1486486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010904558.1|1486866_1487565_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|1487655_1487958_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|1487966_1488287_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|1488279_1489983_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966485.1|1489992_1490457_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|1490457_1491132_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021389.1|1491143_1491761_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|1492972_1493236_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001135715.1|1493537_1493678_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000397129.1|1494549_1495221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435663.1|1497558_1497984_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|1497980_1498331_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|1498361_1499975_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000957248.1|1500917_1501259_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042916.1|1501245_1501575_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001176766.1|1501835_1502303_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|1502320_1503529_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|1503539_1504496_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|1504495_1505575_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
>prophage 6
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	1635030	1677152	5554243	head,portal,integrase,tail,terminase,holin,transposase	Escherichia_phage(36.36%)	54	1628354:1628374	1648803:1648823
1628354:1628374	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_000952736.1|1635030_1635852_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1636007_1637054_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1637050_1637845_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1638011_1639130_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1639098_1639368_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1639429_1639819_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1639951_1640467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1640581_1640734_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1641049_1641526_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1641650_1641974_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1641957_1642383_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_160124436.1|1642451_1643489_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	79.0	7.4e-89
WP_072143023.1|1643400_1643943_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|1643977_1644676_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|1644697_1644922_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|1644918_1645275_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|1645307_1645460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|1645456_1645768_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|1645894_1646458_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|1646567_1646672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|1646858_1647071_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|1647238_1647517_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|1647518_1648568_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|1648580_1648940_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
1648803:1648823	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
WP_001059369.1|1648936_1649626_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|1650259_1650688_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|1651165_1653016_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|1653097_1654311_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|1654629_1654836_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|1654840_1655185_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|1655235_1655769_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|1655924_1656107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|1656119_1656251_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|1656478_1656664_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|1657190_1657505_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|1657586_1657811_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|1658205_1658715_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|1658686_1660615_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|1660598_1660805_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1660801_1662394_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1662383_1663889_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1663925_1664273_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1664330_1664597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1664578_1665319_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1665332_1665764_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1665790_1666204_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082450.1|1666184_1668764_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000847298.1|1668760_1669090_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1669089_1669788_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|1669798_1670542_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1670487_1671117_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_001230508.1|1674903_1675503_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_070479928.1|1675567_1676881_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|1676882_1677152_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 7
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	1734731	1754714	5554243	integrase,tail,transposase	Enterobacteria_phage(75.0%)	28	1747850:1747863	1757856:1757869
WP_032161728.1|1734731_1735865_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
WP_000132765.1|1735815_1736139_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|1736296_1737481_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|1737480_1737993_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|1738047_1738413_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|1738448_1738577_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000979955.1|1741379_1741868_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|1742024_1742597_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000257965.1|1742640_1743057_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000211280.1|1744262_1744577_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686531.1|1744581_1745541_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000123463.1|1745617_1748440_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
1747850:1747863	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|1748446_1748812_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001413181.1|1748808_1749426_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
WP_000104305.1|1749437_1749737_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|1749733_1750000_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|1749996_1750200_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|1750223_1750640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|1750732_1750846_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|1750842_1751085_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|1751096_1751375_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|1751385_1751736_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|1751757_1751961_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|1752032_1752170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|1752259_1752664_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|1752679_1753330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|1753359_1753707_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|1753712_1754714_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
1757856:1757869	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 8
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	2075259	2190822	5554243	protease,head,portal,tail,capsid,terminase,holin,transposase	Escherichia_phage(28.7%)	139	NA	NA
WP_001260835.1|2075259_2076081_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2076180_2076264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2076356_2076692_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2077088_2078342_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2078448_2079342_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2079476_2080697_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2080821_2081517_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2081469_2082762_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2082919_2083534_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2083576_2084431_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2084432_2085050_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2085060_2087484_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2087544_2089971_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2090169_2090475_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2090582_2091293_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2091295_2091856_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2091890_2092232_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2092366_2092693_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2092865_2092991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|2093681_2093918_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048458.1|2094005_2096477_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2096569_2096761_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2096757_2096946_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2097346_2097511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2097514_2097733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2097804_2098104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2098456_2098735_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2098736_2098928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2098948_2099320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2099417_2099720_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2099716_2100142_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2100164_2101127_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2101133_2101874_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2102684_2103080_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2103136_2103721_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2103836_2103941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2104129_2104342_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2104509_2104788_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2104789_2105839_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_161512808.1|2105851_2106127_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	9.2e-23
WP_085948178.1|2106129_2107343_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001059381.1|2107520_2108210_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2108849_2109278_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2109756_2111607_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000411805.1|2112055_2112262_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2112266_2112611_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_001056806.1|2113464_2114034_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2114033_2114180_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2114407_2114593_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2115017_2115245_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2115286_2115652_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2115940_2116504_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038425863.1|2116500_2118162_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|2118225_2120163_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|2120207_2120429_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000125988.1|2122955_2123282_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2123291_2123642_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2123638_2124085_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2124081_2124426_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_060722693.1|2124491_2125208_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	5.2e-126
WP_001030063.1|2125213_2125588_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2125683_2125893_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212897.1|2125945_2129026_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
WP_000807954.1|2129018_2129360_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|2129359_2129797_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_038425866.1|2129984_2133245_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001304111.1|2133247_2133463_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2133530_2134130_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2134194_2135418_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2135419_2135689_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001121225.1|2137088_2137739_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2138321_2139860_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2139909_2140257_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2140253_2140634_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2141596_2141911_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2142549_2143794_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2143886_2144075_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2144071_2144260_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2144824_2145034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2145034_2145673_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2145684_2145837_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2146129_2146468_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2146859_2147102_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2147085_2147511_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2147579_2148623_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2148615_2149077_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2149110_2149827_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2149859_2150141_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2150137_2150365_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2150357_2150669_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2150796_2151015_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2151016_2151574_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2151807_2152020_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2152139_2152484_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2152605_2152878_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2152879_2153929_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2153941_2154247_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2154309_2154864_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2155088_2155286_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2155421_2156135_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2156585_2157017_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2157494_2159345_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411805.1|2159792_2159999_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2160003_2160348_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_001056806.1|2161202_2161772_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2161771_2161918_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2162140_2162326_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2162851_2163166_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2163247_2163472_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867493.1|2163858_2164404_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|2164378_2166304_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2166300_2166507_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2166503_2168105_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2168085_2169405_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2169414_2169747_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2169802_2170828_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2170869_2171268_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2171279_2171633_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2171647_2172181_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2172177_2172573_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2172580_2173333_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2173346_2173769_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2173795_2174209_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_097340392.1|2174189_2176802_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000847298.1|2176798_2177128_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2177127_2177826_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2177836_2178580_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2178525_2179155_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_161512810.1|2179395_2182875_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.3	0.0e+00
WP_001230508.1|2182942_2183542_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2183606_2184830_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2184831_2185101_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|2185214_2185790_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2185862_2186492_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|2186573_2187215_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_016241229.1|2187376_2187691_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2187750_2189034_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2189122_2190583_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2190618_2190822_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 9
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	2365326	2429868	5554243	head,tRNA,integrase,tail,capsid,terminase,holin,transposase	Escherichia_phage(44.44%)	71	2361784:2361799	2422204:2422219
2361784:2361799	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_001295593.1|2365326_2365761_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2366341_2366983_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2367064_2367694_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2367766_2368342_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2368454_2368724_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|2368725_2370039_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|2370103_2370703_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2370773_2374271_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|2374404_2374932_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2375122_2375755_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2375700_2376444_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2376454_2377153_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2377152_2377494_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212768.1|2377486_2380567_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001453698.1|2380619_2380829_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2380924_2381299_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275480.1|2381304_2382021_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
WP_000133393.1|2382089_2382434_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2382430_2382877_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2382873_2383224_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_001063025.1|2386084_2386306_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2386350_2388288_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001411753.1|2388351_2390013_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|2390009_2390573_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2390861_2391227_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2391268_2391469_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2391600_2391927_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|2392327_2392513_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|2392735_2392867_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|2392961_2393657_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992146.1|2393930_2394464_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.9	6.7e-102
WP_000731259.1|2394514_2394859_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2394863_2395079_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_021497500.1|2395228_2397082_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000466957.1|2397656_2398088_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2398649_2399204_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2399200_2399491_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2399490_2400090_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|2400589_2401981_+	ATPase	NA	NA	NA	NA	NA
WP_000016656.1|2401980_2402970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|2402937_2404089_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000208018.1|2404844_2405006_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2405016_2405280_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|2405531_2405744_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2405849_2406272_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2406287_2407049_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2407071_2407818_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2407824_2408613_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2408690_2409113_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2409109_2409364_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2409443_2409863_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001169151.1|2410295_2410451_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2410447_2410936_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2411377_2411599_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2411598_2411769_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2411843_2412119_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|2412220_2414821_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|2414813_2415623_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2415678_2415828_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2415865_2416054_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2416153_2416369_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2416370_2417606_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|2417657_2418593_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123746.1|2418721_2420095_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2420572_2421556_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2421810_2423043_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2422204:2422219	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
WP_001046821.1|2423063_2423627_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000885454.1|2423956_2424865_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000444937.1|2425040_2426351_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_001156434.1|2426350_2427796_+	amidohydrolase	NA	NA	NA	NA	NA
WP_085948178.1|2428655_2429868_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 10
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	2507989	2583425	5554243	protease,head,integrase,tail,capsid,terminase,holin,transposase	Stx2-converting_phage(36.54%)	81	2523490:2523517	2583562:2583589
WP_000422055.1|2507989_2509039_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2509258_2510017_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2510013_2510604_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2510643_2511516_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2511728_2513312_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2513339_2513960_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2513956_2514838_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2514975_2515020_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2515111_2516674_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001302292.1|2518271_2519630_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000209521.1|2519641_2520835_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2520834_2521641_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2522021_2522201_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2522286_2522787_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2522832_2523339_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2523490:2523517	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000147167.1|2523840_2524059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|2526809_2527400_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2527583_2528231_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2528367_2528514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2528941_2529220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2529559_2529940_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2529936_2530284_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2530333_2531872_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2532837_2533407_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2533472_2534384_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2534490_2534613_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2536210_2537536_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2538562_2538832_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2538833_2540147_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2540298_2540898_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_115801855.1|2540965_2543311_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001304109.1|2543262_2544438_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2544779_2545412_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2545357_2546101_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179481.1|2546111_2546810_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807954.1|2546809_2547151_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_161512814.1|2549551_2550382_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	1.7e-112
WP_001453746.1|2550428_2550638_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_161512817.1|2550733_2551117_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	2.3e-64
WP_000133388.1|2551897_2552242_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2552238_2552685_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2552681_2553032_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_001063094.1|2555888_2556110_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|2556154_2558092_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001507810.1|2558155_2559817_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.5	0.0e+00
WP_000958416.1|2559813_2560377_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2560666_2561032_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2561073_2561301_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2561725_2561911_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2562138_2562285_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2562284_2562854_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2563124_2563658_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2563708_2564053_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2564057_2564273_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2564422_2566276_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2567072_2568131_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2568281_2568479_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2568720_2569251_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2569259_2569619_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2569631_2570678_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2570679_2570958_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2571027_2571285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2571505_2571718_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2571996_2572755_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2573453_2573618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2573614_2574196_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2574382_2574925_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2574836_2575877_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2575848_2576400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2576383_2576611_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2576687_2577095_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2577358_2577658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2577730_2577949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2577971_2578379_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2578356_2578590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994727.1|2578583_2578727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2579063_2579252_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2579248_2579440_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2579532_2582004_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2582068_2582317_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2582294_2583425_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2583562:2583589	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 11
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	2629827	2799916	5554243	protease,head,portal,tRNA,integrase,tail,capsid,lysis,terminase,holin,transposase	Enterobacteria_phage(32.48%)	197	2662537:2662552	2787458:2787472
WP_001299679.1|2629827_2631084_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|2631297_2631921_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|2631920_2632772_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|2632922_2633870_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|2633994_2635674_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|2635728_2636007_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|2636284_2636869_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|2636985_2638077_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|2640898_2641969_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|2641979_2642612_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|2642622_2644041_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001417816.1|2644344_2644623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304187.1|2644587_2646045_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_001459046.1|2646072_2646273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|2646380_2647403_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|2647402_2648383_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|2648379_2649138_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000903990.1|2649147_2649792_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000576838.1|2649956_2650811_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|2650836_2652807_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|2652856_2653111_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020148.1|2653311_2653908_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_085952403.1|2653959_2655172_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001295616.1|2655360_2655972_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|2656071_2656986_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|2657081_2658818_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|2659209_2660280_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|2660289_2661588_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|2661950_2663483_+	SpoVR family protein	NA	NA	NA	NA	NA
2662537:2662552	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|2663534_2664254_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
2662537:2662552	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000406391.1|2664475_2666017_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|2666162_2666693_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|2666738_2668007_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|2668006_2668426_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|2668798_2669710_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|2669916_2670378_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|2670454_2671114_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|2671185_2671479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000874954.1|2671490_2671649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|2671719_2672121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|2672223_2672592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|2673111_2673807_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|2673830_2674643_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|2674646_2674913_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_085948178.1|2676078_2677292_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000361110.1|2677465_2678050_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|2678548_2679502_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|2679688_2681173_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|2681475_2683014_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2683063_2683411_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2683407_2683788_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|2683863_2684112_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|2684168_2684837_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|2685334_2685517_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|2685595_2686096_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|2686132_2686639_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|2686657_2687548_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885629.1|2687667_2688249_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000268883.1|2688248_2691164_-	membrane protein	NA	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|2691228_2691828_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|2691894_2695293_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|2695353_2695986_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|2695922_2696666_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|2696671_2697370_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|2697369_2697699_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000459457.1|2700236_2700671_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|2700652_2701075_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|2701090_2701831_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|2701838_2702234_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|2702230_2702809_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|2702820_2703174_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|2703185_2703584_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2703625_2704651_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2704706_2705039_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2705048_2706368_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2706348_2707950_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2707946_2708153_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027374.1|2708149_2710075_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|2710049_2710595_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|2710983_2711178_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|2711342_2711549_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|2711834_2712245_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|2712536_2712830_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|2712920_2713103_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|2713319_2713796_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|2713782_2714088_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|2714409_2715099_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|2715095_2715236_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|2715232_2715595_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|2715591_2715882_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|2715874_2716045_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|2716044_2716500_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|2717001_2718528_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|2718585_2718708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|2718772_2719105_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|2719172_2719475_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|2719471_2720173_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|2720169_2720994_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088655.1|2721097_2721334_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|2721323_2722466_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|2722579_2723830_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|2724001_2724655_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2724664_2725126_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|2725179_2726286_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|2726321_2726963_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2726966_2728337_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
2728255:2728270	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|2728505_2729177_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
2728255:2728270	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000735407.1|2729176_2730637_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133425.1|2731493_2731775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127893.1|2731788_2733450_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000113645.1|2733433_2733790_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|2733913_2734096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|2734079_2734520_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|2734519_2734816_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|2734812_2735151_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000267612.1|2735147_2736359_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_000504050.1|2736360_2736933_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|2736972_2738130_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|2738422_2738647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233299.1|2738771_2739044_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|2739054_2739465_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|2739461_2739713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761781.1|2740083_2742216_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000770148.1|2742212_2742512_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|2742517_2742760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|2742749_2742941_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|2742940_2743126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|2743118_2743316_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|2743341_2744085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|2744142_2744331_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085257.1|2744695_2745925_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_001301987.1|2746173_2747295_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|2747343_2748570_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2748819_2749956_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|2749939_2750803_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|2751166_2752528_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|2752588_2752864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|2752943_2753069_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001301673.1|2759163_2761512_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2761531_2761621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|2761633_2761870_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|2761815_2762553_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|2762606_2763485_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|2763787_2763898_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|2764007_2764262_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|2764278_2764977_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807950.1|2764976_2765318_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|2765310_2768553_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|2768605_2768815_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2768910_2769285_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|2769290_2770007_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|2770065_2770410_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2770406_2770853_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2770849_2771200_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2771209_2771536_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2771615_2774117_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063095.1|2774062_2774284_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	2.9e-35
WP_000173030.1|2774328_2776266_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|2776329_2777991_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2777987_2778551_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2778840_2779206_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|2779247_2779433_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|2779562_2779703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|2780059_2780284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|2780348_2780555_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|2780782_2780929_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2780928_2781498_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2781768_2782302_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|2782352_2782697_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|2782701_2782917_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|2782992_2783262_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|2783299_2783482_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|2783629_2785567_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|2785881_2786049_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|2786645_2787467_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|2787463_2787838_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265168.1|2787850_2788900_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|2788901_2789180_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2789347_2789560_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2789748_2789853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|2789968_2790556_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|2790558_2790750_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|2790751_2791189_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|2791175_2791493_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|2791446_2791764_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|2791753_2792056_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|2792052_2792370_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|2792366_2793083_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|2793116_2793659_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262409.1|2793570_2794608_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2794676_2795102_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2795098_2795326_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2795423_2796068_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2796342_2796495_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2796975_2797164_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2797160_2797349_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2797444_2799916_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
>prophage 12
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	2932943	3039446	5554243	protease,portal,tRNA,integrase,tail,terminase,holin,transposase	Enterobacteria_phage(60.24%)	119	2987764:2987784	3036952:3036972
WP_000476014.1|2932943_2934305_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|2934634_2934952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2935357_2936257_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|2936338_2937118_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|2937217_2938258_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|2938305_2939661_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|2939664_2939949_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2939979_2940432_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|2940441_2941704_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|2941732_2942587_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2942885_2943938_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|2944194_2945472_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|2945468_2946473_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|2946469_2947435_+	kinase	NA	NA	NA	NA	NA
WP_000434031.1|2947408_2948155_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|2948206_2949025_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|2949089_2949890_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|2949886_2950675_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|2951008_2951248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|2952298_2952646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|2952655_2952970_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|2953079_2953352_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134627.1|2953472_2954330_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|2954547_2954886_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|2954967_2956002_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|2958508_2959183_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|2959270_2959813_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|2960104_2960386_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|2960647_2961757_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_160124443.1|2961888_2963922_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
WP_001411921.1|2967884_2969165_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|2969328_2970870_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|2970879_2974509_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2974570_2974888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2976128_2977217_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2977227_2978757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|2978775_2979507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|2979499_2980636_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_085953806.1|2982676_2983890_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	8.4e-169
WP_001295429.1|2984073_2984535_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2984576_2985047_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2985093_2985813_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2985809_2987495_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
2987764:2987784	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261937.1|2988009_2988258_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023431.1|2988625_2988895_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_000268835.1|2988896_2990210_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001228289.1|2990274_2990874_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_161512816.1|2990941_2994415_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.2	0.0e+00
WP_072147834.1|2994655_2995285_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|2995230_2995974_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_115448574.1|2995984_2996683_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	98.7	2.8e-132
WP_000847298.1|2996682_2997012_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918269.1|2997008_2999654_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000532073.1|2999697_3000006_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|3000032_3000455_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|3000468_3001221_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|3001228_3001627_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3001639_3002263_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3002265_3002547_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3002539_3002866_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_085948178.1|3004115_3005328_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000974564.1|3006235_3007738_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|3007737_3007950_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|3007946_3010070_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|3010066_3010543_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|3010575_3010848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|3011059_3011245_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3011472_3011619_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3011618_3012188_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3012458_3012992_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3012996_3013212_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|3013289_3013535_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3013575_3013755_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874257.1|3013892_3015839_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000752026.1|3016349_3016619_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3016628_3017576_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204849.1|3018082_3018517_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|3018509_3018704_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107983.1|3018700_3019306_-	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_001543885.1|3019298_3019508_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_000924601.1|3019467_3019869_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|3019871_3020048_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000153268.1|3020044_3020572_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001304104.1|3020568_3021015_-	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_001281772.1|3020971_3021208_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103678.1|3021218_3021434_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|3021566_3021845_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145935.1|3021915_3022206_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788906.1|3022202_3022904_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000035953.1|3023864_3024161_-	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_001033078.1|3024275_3024494_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_001299796.1|3024602_3025250_+	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001280993.1|3025372_3025654_+	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_000990548.1|3025660_3026212_+	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_000256574.1|3026724_3026997_+	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_001066169.1|3027013_3027595_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000065377.1|3027855_3028224_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198861.1|3028296_3028461_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372942.1|3028429_3028573_+	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_000995395.1|3028648_3028945_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|3028950_3029736_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3029732_3030410_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|3030409_3030592_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|3030564_3030756_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3030766_3031048_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3031146_3031368_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|3031364_3032312_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|3032313_3032490_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|3032823_3033180_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|3033176_3033539_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|3033626_3033869_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|3033872_3034007_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_085948178.1|3034215_3035429_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_149008366.1|3035351_3035594_+	hypothetical protein	NA	Q859D3	Escherichia_coli_phage	86.0	9.6e-16
WP_000063648.1|3035627_3036914_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|3036934_3037636_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
3036952:3036972	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|3037695_3037803_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3037783_3038515_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3038519_3039446_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 13
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	3286378	3291765	5554243	integrase	Enterobacteria_phage(50.0%)	6	3276829:3276845	3288793:3288809
3276829:3276845	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3286378_3287311_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3287622_3288780_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3288954_3290091_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3288793:3288809	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3290100_3290781_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3290767_3291235_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|3291234_3291765_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 14
NZ_CP034384	Escherichia coli O157:H7 strain FRIK804 chromosome, complete genome	5554243	3532167	3585771	5554243	holin,tRNA,tail,transposase	Enterobacteria_phage(28.57%)	55	NA	NA
WP_000997403.1|3532167_3533205_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3533411_3533831_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|3533899_3534598_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|3534629_3537290_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3537403_3538759_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464871.1|3538783_3539128_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|3539124_3540423_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|3546196_3548770_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|3548899_3549631_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|3549627_3550608_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3550742_3551480_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3551750_3552092_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3552195_3552243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|3552341_3553502_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3553544_3554666_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|3554676_3555747_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|3555956_3556322_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3556471_3556990_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969012.1|3556979_3558206_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589827.1|3558221_3558704_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3558780_3559128_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3559169_3559937_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3559967_3560516_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3560534_3560783_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3560919_3562281_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|3562372_3563239_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626964.1|3563260_3564547_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3564601_3565195_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|3565317_3566196_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|3566281_3567943_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3568091_3568433_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|3568494_3568785_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3568774_3569251_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3569382_3569865_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3570710_3570959_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3571460_3572051_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3572233_3572884_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3572962_3574021_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3574150_3574573_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3574733_3575003_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000165061.1|3575220_3575547_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001299612.1|3575543_3576434_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000998000.1|3576240_3576885_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_000612591.1|3576934_3577282_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3577278_3577659_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3578015_3578360_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3578364_3578580_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|3578729_3580583_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|3580990_3581158_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|3581243_3581987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3582239_3582863_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3582859_3583525_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3583521_3584133_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3584107_3584674_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|3585015_3585771_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP034385	Escherichia coli O157:H7 strain FRIK804 plasmid pO157, complete sequence	92697	25339	37998	92697	integrase,transposase	Macacine_betaherpesvirus(50.0%)	13	16524:16538	39771:39785
16524:16538	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000361615.1|25339_26317_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|26724_26925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|26921_27542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|27538_28222_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|28680_28899_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|28900_29206_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|29206_30013_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|30689_30770_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|30735_31949_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_071525396.1|31910_32249_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_000772446.1|32836_34003_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|34002_34974_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000138832.1|36273_37998_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
39771:39785	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
