The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034236	Pectobacterium carotovorum subsp. carotovorum strain BP201601.1 chromosome, complete genome	4853176	430027	438744	4853176		Dickeya_phage(42.86%)	7	NA	NA
WP_161503029.1|430027_430852_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.1	2.8e-06
WP_161502058.1|430863_431673_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	2.3e-29
WP_010297073.1|431879_432464_+	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	35.9	9.1e-12
WP_010297071.1|432544_433822_-	pectate lyase	NA	A0A1B1IPS8	uncultured_Mediterranean_phage	33.1	1.3e-34
WP_010297068.1|433991_435116_-	polysaccharide lyase	NA	A0A140XB77	Dickeya_phage	76.8	6.6e-59
WP_010297054.1|435826_436951_-	polysaccharide lyase	NA	A0A140XB77	Dickeya_phage	70.3	4.4e-55
WP_010297052.1|437619_438744_-	polysaccharide lyase	NA	A0A140XB77	Dickeya_phage	72.5	1.3e-54
>prophage 2
NZ_CP034236	Pectobacterium carotovorum subsp. carotovorum strain BP201601.1 chromosome, complete genome	4853176	1082767	1176229	4853176	portal,plate,bacteriocin,capsid,integrase,head,tRNA,tail	Salmonella_phage(20.0%)	78	1145866:1145913	1175617:1175664
WP_010303156.1|1082767_1083199_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_161502193.1|1083201_1084968_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_010303151.1|1084931_1085930_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_010303148.1|1085932_1087153_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_010303144.1|1087152_1087674_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_161502194.1|1087676_1089014_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_010303138.1|1089029_1089806_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_161502195.1|1089819_1092417_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.0	5.0e-94
WP_010303132.1|1092419_1093958_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_161502196.1|1093957_1094518_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_161502197.1|1094529_1095948_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_161502198.1|1095972_1099470_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_103862905.1|1099518_1100955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010310081.1|1100983_1102339_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_039475383.1|1102962_1103481_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_010308499.1|1107171_1107870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010308494.1|1108028_1108985_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_010308491.1|1108981_1109899_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_161502199.1|1109919_1115097_+	DUF3990 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	36.5	4.0e-26
WP_039542643.1|1115108_1115483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080762751.1|1115544_1115649_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_039542640.1|1116415_1116781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161502200.1|1117675_1118038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161503038.1|1118149_1118260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103165407.1|1120653_1121100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161502201.1|1121212_1121488_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_029369213.1|1121852_1122818_+	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_161502202.1|1123152_1123575_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_161502203.1|1123869_1124505_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_010307211.1|1124720_1125602_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080762749.1|1125717_1126914_+	MFS transporter	NA	NA	NA	NA	NA
WP_119881640.1|1127180_1128779_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.6	7.3e-19
WP_010307203.1|1128959_1129634_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_161502204.1|1129716_1130205_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_010307196.1|1130685_1131021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010285348.1|1131858_1132932_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	9.9e-113
WP_010307191.1|1132977_1133472_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_010307188.1|1133610_1136238_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	3.5e-79
WP_005972168.1|1136562_1136748_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_010308368.1|1138010_1138577_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_010308364.1|1138573_1139002_+	DedA family protein	NA	NA	NA	NA	NA
WP_010308361.1|1139084_1140638_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_010286009.1|1140790_1141306_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_010286006.1|1141375_1142170_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010308359.1|1142339_1143701_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_010285998.1|1143858_1144107_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_010308358.1|1144125_1144674_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_010308356.1|1144712_1145468_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_010285987.1|1145531_1145879_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
1145866:1145913	attL	AGCGTCTTAACTAAGATAGCGCTTTCGCAACATCCGAAAGTTGTTATT	NA	NA	NA	NA
WP_103161059.1|1146040_1146259_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	68.1	9.2e-26
WP_161502205.1|1146346_1147507_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	67.2	5.6e-146
WP_161502206.1|1147503_1147989_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	60.2	5.4e-50
WP_161502207.1|1147993_1150870_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	57.5	5.6e-163
WP_010310409.1|1150862_1150985_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	81.6	4.2e-12
WP_161502208.1|1150999_1151296_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	63.0	2.8e-25
WP_161502209.1|1151364_1151886_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	78.5	3.0e-75
WP_161502210.1|1151902_1153072_-|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	82.9	2.3e-187
WP_161502211.1|1156037_1156946_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	77.5	3.3e-125
WP_161502212.1|1156950_1157295_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	64.9	1.6e-35
WP_161502213.1|1158026_1158824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161502214.1|1158810_1158993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005967821.1|1159664_1159868_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	74.6	1.2e-22
WP_161502215.1|1159867_1160371_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	59.5	3.3e-50
WP_161502216.1|1161124_1162252_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	71.6	3.8e-147
WP_161503039.1|1165251_1166268_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	76.2	9.3e-153
WP_161502217.1|1166587_1166809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161502218.1|1167292_1169590_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	61.5	9.7e-267
WP_161502219.1|1169586_1170600_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	45.3	5.9e-67
WP_161502220.1|1170596_1170821_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	58.1	1.8e-16
WP_094369901.1|1170820_1171129_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_161502221.1|1171128_1171377_-	DUF2732 family protein	NA	A0A0F7LBR4	Escherichia_phage	61.1	1.3e-07
WP_161502222.1|1171439_1171940_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	55.8	4.2e-50
WP_161502223.1|1172123_1172633_-	phage regulatory CII family protein	NA	A0A218M4I4	Erwinia_phage	57.1	7.9e-52
WP_161503040.1|1172671_1172959_-	Cro/Cl family transcriptional regulator	NA	A0A0M4R4X7	Salmonella_phage	55.2	1.6e-22
WP_161502224.1|1173127_1173991_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	56.5	3.5e-92
WP_161502225.1|1174001_1174475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161502226.1|1174484_1175555_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	75.6	6.3e-160
WP_010306201.1|1175863_1176229_+	hypothetical protein	NA	R9TR46	Vibrio_phage	69.5	1.2e-22
1175617:1175664	attR	AGCGTCTTAACTAAGATAGCGCTTTCGCAACATCCGAAAGTTGTTATT	NA	NA	NA	NA
>prophage 3
NZ_CP034236	Pectobacterium carotovorum subsp. carotovorum strain BP201601.1 chromosome, complete genome	4853176	1198647	1204067	4853176		Mycobacterium_phage(33.33%)	6	NA	NA
WP_010309443.1|1198647_1199112_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.4	1.2e-46
WP_039508085.1|1199168_1199906_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.4	5.0e-39
WP_010309782.1|1200264_1201227_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.9	2.7e-138
WP_161503041.1|1201251_1203414_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	50.4	9.3e-203
WP_010280810.1|1203410_1203818_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A220BYR7	Staphylococcus_phage	26.5	1.1e-06
WP_010309776.1|1203827_1204067_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	58.9	3.5e-18
>prophage 4
NZ_CP034236	Pectobacterium carotovorum subsp. carotovorum strain BP201601.1 chromosome, complete genome	4853176	1728874	1785922	4853176	portal,lysis,plate,capsid,integrase,head,terminase,tail,transposase	Erwinia_phage(26.47%)	59	1736160:1736176	1783309:1783325
WP_062792250.1|1728874_1730149_-|integrase	tyrosine-type recombinase/integrase	integrase	Q8W6M6	Sinorhizobium_phage	30.5	2.7e-48
WP_157757053.1|1730495_1730648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010308275.1|1731426_1731693_+	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_039533723.1|1731863_1733276_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_161502323.1|1734154_1734442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010279363.1|1734535_1734760_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_010279369.1|1735404_1736061_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_161502324.1|1736053_1737886_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
1736160:1736176	attL	CAAAAGACTTAAAAAAA	NA	NA	NA	NA
WP_010279374.1|1737944_1738493_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_082218609.1|1739139_1739358_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	65.3	1.1e-23
WP_161502325.1|1739444_1740602_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	67.6	3.6e-145
WP_130622813.1|1740598_1741084_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	58.4	5.9e-49
WP_161502326.1|1741088_1743830_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	54.4	5.6e-168
WP_039512472.1|1743822_1743945_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.2	1.9e-12
WP_039512474.1|1743959_1744256_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	66.3	8.7e-27
WP_161502327.1|1744323_1744845_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	77.9	8.0e-76
WP_161502328.1|1744857_1746027_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	83.2	7.1e-189
WP_161502329.1|1746299_1748393_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	65.6	2.6e-117
WP_161502330.1|1748389_1749001_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.5	6.5e-77
WP_161502331.1|1748993_1749902_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	76.8	1.2e-124
WP_161502212.1|1749906_1750251_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	64.9	1.6e-35
WP_161502332.1|1750247_1750883_-|plate	phage baseplate assembly protein V	plate	M1SV78	Escherichia_phage	75.8	1.9e-87
WP_161502333.1|1751384_1751840_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	67.1	5.4e-52
WP_116156593.1|1751833_1752046_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	56.7	7.3e-12
WP_161502334.1|1752188_1752632_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	36.9	6.1e-16
WP_161502335.1|1752628_1753138_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	70.1	4.6e-60
WP_039318041.1|1753121_1753340_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	56.9	8.9e-13
WP_005967821.1|1753330_1753534_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	74.6	1.2e-22
WP_161502215.1|1753533_1754037_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	59.5	3.3e-50
WP_161502336.1|1754128_1754788_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	64.7	3.7e-70
WP_161502216.1|1754791_1755919_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	71.6	3.8e-147
WP_161502337.1|1756959_1758729_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.1	5.7e-283
WP_161502338.1|1758725_1759736_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	74.6	4.7e-149
WP_161502339.1|1759784_1760369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161502340.1|1760365_1760989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161502341.1|1761549_1763850_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	60.5	6.1e-261
WP_161502219.1|1763846_1764860_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	45.3	5.9e-67
WP_161502342.1|1764856_1765081_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	57.7	6.8e-16
WP_094369901.1|1765080_1765389_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_161502343.1|1765388_1765637_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_161502344.1|1765699_1766200_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	59.0	2.2e-54
WP_161502345.1|1766196_1766430_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_161502346.1|1766776_1767040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039512512.1|1767089_1767599_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	56.5	8.1e-49
WP_039512514.1|1767644_1767857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161502347.1|1767972_1768560_+	CI repressor	NA	A0A0M4RE65	Salmonella_phage	43.2	9.7e-46
WP_161502348.1|1768605_1770744_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_161502349.1|1770748_1771627_+	RelA/SpoT protein	NA	NA	NA	NA	NA
WP_161502350.1|1771710_1772721_+|integrase	tyrosine-type recombinase/integrase	integrase	Q1I119	Pasteurella_virus	60.3	8.7e-111
WP_161502351.1|1772722_1773412_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_161502352.1|1773789_1775067_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.6	1.4e-81
WP_161502353.1|1775388_1775928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161502354.1|1776161_1777079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161502355.1|1777081_1778038_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_161503049.1|1778379_1778721_-	DNA sulfur modification protein DndE	NA	NA	NA	NA	NA
WP_161502356.1|1778720_1780679_-	DNA sulfur modification protein DndD	NA	NA	NA	NA	NA
WP_161502357.1|1782331_1783411_-	DNA sulfur modification protein DndB	NA	NA	NA	NA	NA
1783309:1783325	attR	TTTTTTTAAGTCTTTTG	NA	NA	NA	NA
WP_161502358.1|1783541_1784666_+	cysteine desulfurase DndA	NA	H7BUW1	unidentified_phage	38.4	6.7e-27
WP_161502359.1|1784899_1785922_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP034236	Pectobacterium carotovorum subsp. carotovorum strain BP201601.1 chromosome, complete genome	4853176	2305655	2310847	4853176		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_161503058.1|2305655_2306447_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	2.8e-11
WP_010295596.1|2306448_2307147_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	1.7e-12
WP_161502485.1|2307271_2307721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130633596.1|2307844_2308165_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.5	5.0e-20
WP_161502486.1|2308211_2309504_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.2	5.6e-171
WP_039531832.1|2309513_2309939_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	2.8e-50
WP_039531830.1|2310022_2310847_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-20
>prophage 6
NZ_CP034236	Pectobacterium carotovorum subsp. carotovorum strain BP201601.1 chromosome, complete genome	4853176	2869357	2935300	4853176	plate,protease,integrase,tRNA,tail	Burkholderia_phage(26.92%)	68	2864820:2864835	2871805:2871820
2864820:2864835	attL	TCTTCCTGTTCCAGCG	NA	NA	NA	NA
WP_161502584.1|2869357_2870608_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	48.0	2.0e-109
WP_014915001.1|2870907_2871123_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_103162094.1|2871598_2871796_+	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	50.0	5.6e-06
WP_161502585.1|2871952_2874559_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	47.0	4.4e-223
2871805:2871820	attR	CGCTGGAACAGGAAGA	NA	NA	NA	NA
WP_161502586.1|2875400_2877083_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_010286544.1|2877353_2877599_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_161502587.1|2877588_2877873_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_161503064.1|2877919_2878159_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_161502588.1|2878216_2878576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049776225.1|2879854_2880151_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_010294834.1|2880562_2881441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029367307.1|2881608_2882073_-	DNA gyrase inhibitor	NA	NA	NA	NA	NA
WP_010294838.1|2882221_2882944_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010294841.1|2883188_2883518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010294845.1|2883584_2884121_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_010294847.1|2884526_2885927_+	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_161502589.1|2885970_2887140_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_010294853.1|2887426_2887942_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.0	7.0e-16
WP_010294855.1|2888318_2889206_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_010294858.1|2889193_2889745_-	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	26.4	2.2e-15
WP_010294859.1|2890103_2890607_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.9	1.8e-08
WP_010294862.1|2890997_2891744_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_010294864.1|2891770_2892430_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_010294867.1|2892426_2893149_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	3.3e-35
WP_010294869.1|2893200_2895069_-	peptidase M3	NA	NA	NA	NA	NA
WP_010294872.1|2895154_2896123_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_161502590.1|2896232_2896382_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010294877.1|2896693_2897314_-|tail	tail assembly protein	tail	E5G6P1	Salmonella_phage	34.8	8.5e-24
WP_161502591.1|2897313_2899257_-|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	62.7	1.8e-48
WP_039536957.1|2899259_2899841_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	60.6	5.3e-60
WP_039536954.1|2899833_2900937_-|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	54.0	1.1e-103
WP_010294895.1|2900927_2901275_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.0	3.3e-33
WP_010294897.1|2901333_2901915_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	44.2	3.0e-23
WP_161502592.1|2901911_2903072_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	49.0	1.1e-85
WP_010294901.1|2903059_2903272_-	membrane protein	NA	A4JWL2	Burkholderia_virus	57.1	2.0e-17
WP_161502593.1|2903261_2904191_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	44.2	2.2e-47
WP_161502594.1|2904190_2906683_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_108723452.1|2906899_2907019_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_039287185.1|2906987_2907308_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_161502595.1|2907439_2907754_-	ferredoxin	NA	C7BUZ5	Synechococcus_phage	61.0	3.5e-18
WP_161502596.1|2907810_2908335_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	67.2	2.8e-68
WP_161502597.1|2908334_2909762_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	72.7	1.1e-202
WP_039273081.1|2909751_2909949_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	58.5	1.9e-09
WP_039476254.1|2909945_2910413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010294921.1|2910675_2910987_-	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	47.5	7.5e-21
WP_010294923.1|2910979_2911309_-	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	45.8	1.5e-19
WP_039536933.1|2911298_2911973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039536931.1|2911962_2912574_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	56.3	6.8e-58
WP_010281025.1|2912575_2912905_-	membrane protein	NA	A4JWP3	Burkholderia_virus	58.3	1.2e-24
WP_029367320.1|2913124_2914492_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_039476265.1|2914494_2915823_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_161502598.1|2915850_2917578_-	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	31.1	1.5e-17
WP_010297561.1|2917595_2917907_-|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_010297563.1|2918010_2919441_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_039536922.1|2919962_2922062_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.7	1.5e-43
WP_161502599.1|2922241_2923084_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_161502600.1|2923136_2923784_+	LysE family translocator	NA	NA	NA	NA	NA
WP_161502601.1|2924132_2924672_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_161502602.1|2924772_2927079_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_161502603.1|2927472_2928159_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_039476287.1|2928233_2929181_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_138255454.1|2929313_2929841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161502604.1|2929919_2930276_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_010297594.1|2930336_2930879_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_039536903.1|2931261_2931810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161502605.1|2931826_2932774_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_010297603.1|2932766_2934179_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_039476299.1|2934367_2935300_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP034236	Pectobacterium carotovorum subsp. carotovorum strain BP201601.1 chromosome, complete genome	4853176	3216346	3225245	4853176		Synechococcus_phage(42.86%)	8	NA	NA
WP_161502679.1|3216346_3217753_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	29.3	2.1e-30
WP_014914740.1|3217983_3218880_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	41.0	1.1e-48
WP_161502680.1|3219169_3220543_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.7	1.4e-34
WP_161502681.1|3220549_3221296_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.4	2.3e-07
WP_010296800.1|3221297_3222701_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.0	2.7e-57
WP_039540659.1|3222710_3223169_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_010296796.1|3223170_3224133_-	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	50.5	2.3e-84
WP_014914734.1|3224135_3225245_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	1.7e-128
>prophage 8
NZ_CP034236	Pectobacterium carotovorum subsp. carotovorum strain BP201601.1 chromosome, complete genome	4853176	3262610	3304460	4853176	plate,integrase,head,terminase,tRNA,tail	uncultured_Caudovirales_phage(31.91%)	55	3262150:3262209	3304523:3304626
3262150:3262209	attL	TAAAAACGAAAACGGGCTAGCCTAAGCTAACCCGTTGAATTTTGTGGCGGAGGAGTAGAG	NA	NA	NA	NA
WP_161502685.1|3262610_3263222_-|tail	tail fiber assembly protein	tail	G4KKN5	Yersinia_phage	34.3	1.3e-24
WP_161502686.1|3264472_3265144_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	68.6	6.9e-88
WP_161502687.1|3265140_3266340_-	hypothetical protein	NA	A0A2H4J5T1	uncultured_Caudovirales_phage	71.2	2.8e-156
WP_161502688.1|3266339_3266693_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	75.2	1.3e-45
WP_161502689.1|3266692_3267448_-|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	67.3	8.3e-82
WP_161502690.1|3267508_3267757_-	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	43.0	2.1e-05
WP_161503071.1|3267794_3268094_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	53.3	1.5e-23
WP_161502691.1|3268134_3269205_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	58.4	1.5e-121
WP_161502692.1|3269207_3269510_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	58.0	1.8e-27
WP_161502693.1|3269496_3270114_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	64.6	2.0e-57
WP_161502694.1|3270113_3272075_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	49.5	1.6e-172
WP_014915210.1|3272064_3272217_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	80.0	2.1e-16
WP_161502695.1|3272252_3272663_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	55.8	1.4e-35
WP_039538207.1|3272663_3273104_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	76.7	9.8e-59
WP_161502696.1|3273113_3274262_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.8	6.3e-166
WP_161502697.1|3274264_3274807_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	53.6	1.6e-47
WP_161502698.1|3274796_3275204_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	68.5	2.0e-42
WP_161502699.1|3275206_3275707_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	42.3	3.3e-26
WP_161502700.1|3275703_3276114_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	54.3	1.4e-30
WP_161502701.1|3276128_3276500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161502702.1|3276550_3277498_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	57.9	1.8e-102
WP_161502703.1|3277507_3278011_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	49.4	3.4e-31
WP_161502704.1|3278021_3279275_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	42.3	2.1e-77
WP_161503072.1|3279325_3279874_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	57.0	2.8e-47
WP_161502705.1|3279935_3281405_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	55.9	4.6e-153
WP_161502706.1|3281607_3281826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161502707.1|3282055_3283456_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.7	1.4e-191
WP_161502708.1|3283379_3284192_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	33.0	9.1e-10
WP_161502709.1|3284333_3284654_-	negative regulator GrlR	NA	NA	NA	NA	NA
WP_161502710.1|3284773_3284998_-	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	61.1	7.8e-20
WP_161502711.1|3285354_3285774_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	31.5	5.4e-06
WP_161502712.1|3285805_3286348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161502713.1|3286413_3286959_-	lysozyme	NA	Q71TF3	Escherichia_phage	68.7	2.1e-71
WP_161502714.1|3286955_3287261_-	hypothetical protein	NA	O64361	Escherichia_phage	57.1	6.4e-25
WP_161502715.1|3287361_3287958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161502716.1|3288001_3288877_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_161502717.1|3289262_3289973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161502718.1|3290079_3290655_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	43.0	5.8e-35
WP_161502719.1|3290931_3291525_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	84.3	4.8e-93
WP_161502720.1|3292200_3292575_-	hypothetical protein	NA	A0A1I9KFB7	Aeromonas_phage	43.5	1.3e-16
WP_161502721.1|3292571_3293315_-	hypothetical protein	NA	H9C168	Pectobacterium_phage	57.5	9.2e-17
WP_161502722.1|3293311_3293566_-	hypothetical protein	NA	H9C167	Pectobacterium_phage	96.4	6.9e-41
WP_161502723.1|3293568_3294048_-	hypothetical protein	NA	H9C166	Pectobacterium_phage	79.2	7.1e-63
WP_161502724.1|3294095_3295505_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	60.2	7.5e-161
WP_116226911.1|3295497_3296100_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	39.9	5.7e-41
WP_161502725.1|3296099_3296924_-	hypothetical protein	NA	A0A1C9LVZ5	Vibrio_phage	43.5	1.7e-16
WP_161502726.1|3296926_3297151_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	87.8	3.7e-30
WP_161502727.1|3297164_3297617_-|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	95.3	5.0e-74
WP_161502728.1|3297673_3297868_-	cell division protein	NA	NA	NA	NA	NA
WP_161503073.1|3297968_3298592_+	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	45.8	6.3e-43
WP_161502729.1|3299786_3300089_+	hypothetical protein	NA	H9C158	Pectobacterium_phage	49.0	8.0e-20
WP_161502730.1|3300111_3302313_+	exodeoxyribonuclease VIII-like protein	NA	H9C157	Pectobacterium_phage	59.0	3.4e-224
WP_161502731.1|3302309_3302810_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	88.6	3.1e-77
WP_161502732.1|3303228_3303450_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	70.6	9.7e-15
WP_161502733.1|3303449_3304460_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	54.2	3.0e-95
3304523:3304626	attR	TAAAAACGAAAACGGGCTAGCCTAAGCTAACCCGTTGAATTTTGTGGCGGAGGAGTAGAGATTCGAACTCTAGAACACTTTCGCGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
>prophage 9
NZ_CP034236	Pectobacterium carotovorum subsp. carotovorum strain BP201601.1 chromosome, complete genome	4853176	3919166	3928719	4853176	capsid,integrase	Enterobacteria_phage(42.86%)	11	3911872:3911885	3933058:3933071
3911872:3911885	attL	CGATAAACGACGGC	NA	NA	NA	NA
WP_039513204.1|3919166_3920360_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.6	7.9e-103
WP_161502848.1|3920387_3922475_-	zinc chelation protein SecC	NA	NA	NA	NA	NA
WP_103160151.1|3922813_3923062_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	60.3	1.2e-13
WP_161502849.1|3923058_3923820_-|capsid	capsid size determination protein	capsid	Q7M2A2	Enterobacteria_phage	33.2	5.0e-26
WP_039488126.1|3924359_3924620_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	50.0	8.7e-15
WP_161502850.1|3924616_3924841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161502851.1|3925196_3925394_+	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	63.0	9.9e-11
WP_161503083.1|3925386_3925599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161502852.1|3925609_3927934_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.1	2.0e-267
WP_005973616.1|3928193_3928445_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_161502853.1|3928434_3928719_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	60.6	2.0e-25
3933058:3933071	attR	GCCGTCGTTTATCG	NA	NA	NA	NA
