The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	37931	109401	4710838	tRNA,transposase	Bacillus_phage(14.29%)	55	NA	NA
WP_161506701.1|37931_38678_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_161506702.1|38836_40954_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	36.4	3.0e-12
WP_005307060.1|41089_41365_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_139745085.1|41444_42071_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.3	3.2e-23
WP_161506703.1|42371_43427_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_161507810.1|43567_44281_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_161506704.1|44613_45477_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_161506705.1|45548_46418_-	DMT family transporter	NA	NA	NA	NA	NA
WP_161507811.1|46460_46937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139437058.1|47188_48088_-	EamA family transporter	NA	NA	NA	NA	NA
WP_161506706.1|48178_49138_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161506707.1|49116_50130_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025325220.1|50322_50757_-	universal stress protein	NA	NA	NA	NA	NA
WP_161506708.1|51135_52323_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_161507812.1|52466_54023_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.2	6.0e-18
WP_005326403.1|54232_54757_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_161507813.1|54918_56103_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_161506709.1|56289_57510_-	MFS transporter	NA	NA	NA	NA	NA
WP_005326407.1|57732_58371_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_161506710.1|58413_59100_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_099369027.1|59479_60496_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	4.9e-186
WP_084865641.1|62905_64108_-|transposase	ISL3-like element ISAeme19 family transposase	transposase	A9YX10	Burkholderia_phage	53.2	1.4e-102
WP_161506711.1|64099_64534_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_161506712.1|64572_65013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161506713.1|65186_66860_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_161506714.1|66989_67721_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_042650638.1|67830_69027_+	MFS transporter	NA	NA	NA	NA	NA
WP_161506715.1|69098_70223_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_161506716.1|70219_70729_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.0	3.3e-18
WP_161506717.1|71169_73005_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.2	4.6e-09
WP_161506718.1|73120_73909_+	glutamate racemase	NA	NA	NA	NA	NA
WP_005326417.1|73913_74405_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_161506719.1|80568_81405_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	35.0	1.0e-16
WP_161506720.1|81426_81861_-	SufE family protein	NA	NA	NA	NA	NA
WP_161506721.1|81874_83095_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.1	8.7e-97
WP_161506722.1|83247_85260_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	39.4	9.8e-122
WP_161506723.1|85246_87547_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	34.6	5.4e-23
WP_161506724.1|87631_88084_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_161506725.1|88358_89384_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	4.7e-19
WP_081805940.1|89473_90664_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	27.2	2.4e-35
WP_041206718.1|90848_91493_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005327364.1|91639_92599_+	ADP-glyceromanno-heptose 6-epimerase	NA	A0A2K9L0I7	Tupanvirus	26.6	7.0e-17
WP_148304719.1|92603_93710_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_161506726.1|93732_94989_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_161507814.1|95161_96433_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041205384.1|97819_98917_+|transposase	ISAs1-like element ISAeme2 family transposase	transposase	NA	NA	NA	NA
WP_161506727.1|99835_100258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004576012.1|100335_101754_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_081805941.1|102004_104002_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_161506728.1|104033_105014_+	oxidoreductase	NA	NA	NA	NA	NA
WP_005331099.1|105394_105733_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_005331102.1|106025_106460_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_041206721.1|106605_107157_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005331104.1|107153_108017_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_041205828.1|108063_109401_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	363685	415873	4710838	protease,transposase	Staphylococcus_prophage(16.67%)	53	NA	NA
WP_019706001.1|363685_364633_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_041206499.1|364758_365964_+	nucleoside permease	NA	NA	NA	NA	NA
WP_161506851.1|366357_366918_-	cytochrome B	NA	NA	NA	NA	NA
WP_005332935.1|366966_367236_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_005332933.1|367353_367806_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_161507817.1|367946_368912_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_042649397.1|368921_369440_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_042649398.1|369479_369728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161506852.1|369817_371605_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_005332927.1|371737_372259_-	MltR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042649400.1|372375_373521_-	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_041206491.1|373558_375487_-	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_161506853.1|376341_378357_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	29.0	1.4e-30
WP_161506854.1|378457_379357_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_161506855.1|379596_380223_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_161506856.1|380287_381070_+	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	48.2	1.1e-55
WP_161506857.1|381332_381953_+	amino acid transporter	NA	NA	NA	NA	NA
WP_043132565.1|382080_384060_+	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_161506858.1|384194_385118_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.5	3.3e-56
WP_139751753.1|385371_386799_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A0K0KVL9	Prochlorococcus_phage	38.4	2.7e-17
WP_042649405.1|386898_388224_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_025325572.1|388529_389171_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	35.6	1.1e-23
WP_041206485.1|389222_389669_+	DUF1249 domain-containing protein	NA	NA	NA	NA	NA
WP_161506859.1|389697_390516_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_161506860.1|390529_391117_+	esterase YqiA	NA	NA	NA	NA	NA
WP_161506861.1|391119_391743_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_161506862.1|391781_392177_+	GFA family protein	NA	NA	NA	NA	NA
WP_161506863.1|392316_394212_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.3	4.5e-92
WP_161506864.1|394290_396582_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.5	9.6e-89
WP_161506865.1|396635_396809_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_019706001.1|396866_397814_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_161506866.1|398033_399041_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	2.2e-183
WP_102948393.1|399069_400274_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	4.5e-114
WP_106885079.1|402067_402280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161506867.1|402394_403192_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_161506868.1|403571_403982_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_161506869.1|404051_404426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507818.1|404497_404749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025325588.1|404945_405161_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_161506870.1|405500_406403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161506871.1|406413_407175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161506872.1|407188_407719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025325592.1|407726_408011_-	DnaJ domain-containing protein	NA	A0A1V0SDD4	Indivirus	40.0	7.3e-07
WP_042649992.1|408372_408792_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_161506873.1|408877_409405_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_161506874.1|409408_410140_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_161506875.1|410136_412179_-	protein-disulfide reductase	NA	NA	NA	NA	NA
WP_139751114.1|412229_412607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139438739.1|412783_413512_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_161506876.1|413719_414382_+	phage shock protein PspA	NA	NA	NA	NA	NA
WP_161506877.1|414384_414591_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_005331057.1|414640_414859_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_161506878.1|414907_415873_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	748027	870414	4710838	tRNA,integrase,protease,transposase	Vibrio_phage(13.64%)	98	806920:806979	855686:856684
WP_024945937.1|748027_749590_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.2	6.2e-124
WP_024945936.1|749615_750371_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.4	6.9e-52
WP_005323871.1|750562_752710_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	F9VHP7	Thermus_phage	41.8	1.7e-143
WP_005323870.1|752719_753403_+	hypothetical protein	NA	A0A191VYJ2	Roseobacter_phage	40.6	3.1e-35
WP_041206373.1|753844_755215_+	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	45.5	1.6e-107
WP_005323866.1|755284_755989_-	thiamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	3.9e-25
WP_041206372.1|756067_757675_-	thiamine/thiamine pyrophosphate ABC transporter, permease protein	NA	NA	NA	NA	NA
WP_005323861.1|757671_758652_-	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_005323856.1|758933_759224_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_005323854.1|759328_760255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005323852.1|760367_760967_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005323850.1|760979_762377_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005323847.1|762409_763495_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005323845.1|763693_765256_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_005323843.1|765662_766286_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005323841.1|766426_766930_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005323839.1|766926_768036_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_005323836.1|768613_770332_+	acetolactate synthase 3 large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	28.1	3.0e-18
WP_025328160.1|770331_770826_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_041206371.1|771225_773379_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_005323830.1|773448_774651_-	acetate kinase	NA	NA	NA	NA	NA
WP_025328157.1|774953_775394_+	DUF412 domain-containing protein	NA	NA	NA	NA	NA
WP_005323826.1|775439_775940_-	YfbU family protein	NA	NA	NA	NA	NA
WP_005323824.1|776159_776624_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_025328154.1|776647_777181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206370.1|777380_778268_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_041206367.1|778290_779385_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_041206365.1|779554_780658_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_005323815.1|780785_781388_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_005323813.1|781486_782386_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005323812.1|782463_783078_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_041206363.1|783148_783595_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_005323808.1|783713_784409_+	DUF3334 family protein	NA	NA	NA	NA	NA
WP_005323806.1|784477_785476_-	DUF2860 domain-containing protein	NA	NA	NA	NA	NA
WP_005323804.1|785678_787991_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.3	8.3e-40
WP_041206361.1|788024_789395_+	dGTPase	NA	NA	NA	NA	NA
WP_005328210.1|789687_789891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021141311.1|790720_791857_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_012564931.1|792278_793226_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_148304712.1|793348_794014_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041205088.1|798717_799080_-	DUF2061 domain-containing protein	NA	NA	NA	NA	NA
WP_005325909.1|799261_799468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161506893.1|799549_800404_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_005325916.1|800397_800859_-	DUF2390 domain-containing protein	NA	NA	NA	NA	NA
WP_005325918.1|800851_802762_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	32.8	2.1e-73
WP_005325920.1|802914_803325_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_001809438.1|803673_804705_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_011191341.1|804951_806226_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_161506894.1|806901_807882_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	9.8e-176
806920:806979	attL	CAGCGTGAATAACATCGCCAGTTGGTTATCGTTTTTCAGCAACCCCTTGTATCTGGCTTT	NA	NA	NA	NA
WP_041205091.1|807993_809061_+	porin	NA	Q1MVN1	Enterobacteria_phage	33.7	6.3e-43
WP_041204923.1|809556_810699_+|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_041205093.1|811726_812335_-	arylesterase	NA	NA	NA	NA	NA
WP_005325231.1|812392_813103_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.9e-32
WP_005325230.1|813099_815541_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_005325229.1|815605_816511_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_041205096.1|816772_818323_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005325227.1|818450_819632_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005325226.1|819833_820901_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_041205099.1|821178_821892_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005325222.1|821935_822268_+	YggL family protein	NA	NA	NA	NA	NA
WP_005325214.1|822367_823288_+	glutaminase B	NA	NA	NA	NA	NA
WP_041205101.1|823317_824610_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_041205103.1|825032_825242_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_005325210.1|825285_828849_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.8	2.0e-16
WP_005325209.1|828948_830226_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080675078.1|830698_830920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005342491.1|831679_832630_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_161506895.1|832903_834085_+|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	26.4	1.1e-08
WP_161506896.1|834094_836299_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_161506897.1|837020_838262_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	31.1	2.3e-28
WP_081934480.1|838757_839177_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_161506898.1|839188_839392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161506899.1|839402_839807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161506900.1|839829_840132_-	DUF1232 domain-containing protein	NA	A0A2I7S9Z5	Vibrio_phage	39.2	2.7e-07
WP_161506901.1|840128_840689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161506902.1|841005_841380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161506903.1|841481_842744_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	34.3	1.1e-59
WP_161506904.1|842826_843243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041204928.1|843218_844346_-|transposase	ISAs1-like element ISKpn9 family transposase	transposase	NA	NA	NA	NA
WP_161507814.1|844927_846199_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011191341.1|847240_848515_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_064162514.1|849839_850322_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161506905.1|850269_850893_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	63.5	6.8e-13
WP_042012893.1|850873_851182_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_042012890.1|851181_851547_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_052814785.1|851596_853207_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.8	2.5e-43
WP_099993964.1|855631_856648_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_139750635.1|856814_857747_-	hypothetical protein	NA	NA	NA	NA	NA
855686:856684	attR	CAGCGTGAATAACATCGCCAGTTGGTTATCGTTTTTCAGCAACCCCTTGTATCTGGCTTTCACGAAGCCGAACTGTCGCTTGATGATGCGAAATGGGTGCTCCACCTTGGCCCGGATGCTGGCTTTCATGTATTCGATGTTGATGGCCGTTTTGTTCTTGCGTGGATGCTGTTTCAAGGTTCTTACCTTGCCGGGGCGCTCGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGCCCCTTGGTAGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGCAGCAGATTACCCAGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACTAGGCTGTGGGTCAGGCCACTCTTGGCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGATGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGTCGAGCTGGGTGCCTCAATGATGGTGGCATCGACCAAGGTGCCTTGAGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTGATGGTCTTGAACAATTGGCGGGCCAGTTGATGCTGCTCCAGCAGGTGGCGGAAATTCATGATGGTGGTGCGGTCCGGCAAGGCGCTATCCAGGGATAACCGGGCAAACAGACGCATGGAGGCGATTTCGTACAGAGCATCTTCGATCGCGCCATCGCTCAGGTTGTACCAATGCTGCATGCAGTGAATGCGTAGCATGGTTTCCAGCGGATAAGGTCGCCGGCCATTACCAGCCTTGGGGTAAAACGGCTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATGCGGGACAAGAAAATCTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAGGTAAGTTGATGACTCATGATGAACCCTGTTCCATGGCTCCAGATGACAAACATGATCTCATATCAGGGACTTGTTCGCACCTTCCCTAG	NA	NA	NA	NA
WP_041205105.1|857810_858905_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_005326773.1|859209_860250_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_081805630.1|860399_860735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205107.1|860831_861803_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_161506906.1|861799_862951_-	galactokinase	NA	NA	NA	NA	NA
WP_139750636.1|862947_863994_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_041205112.1|864045_865059_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.8	1.0e-82
WP_041205116.1|865940_868217_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_041206820.1|868649_868985_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_041205253.1|869076_870414_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	883170	937809	4710838	tRNA,transposase	Streptococcus_phage(25.0%)	41	NA	NA
WP_005327088.1|883170_884586_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005327087.1|884588_884729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005323562.1|887729_888647_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	2.6e-101
WP_005327079.1|890517_891753_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_161506907.1|891764_892400_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_005327075.1|892416_892824_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005327072.1|892890_893418_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005327070.1|893428_894802_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005327067.1|894798_895563_-	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_041205127.1|895666_898273_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	2.2e-36
WP_021141311.1|898814_899951_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_019706001.1|900109_901057_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_041205130.1|901549_902575_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005325957.1|902577_903621_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005325959.1|903703_905521_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041206825.1|905534_906593_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.3	5.7e-12
WP_041205133.1|906687_907689_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	1.4e-20
WP_041205135.1|908298_909750_-	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_005325980.1|910688_911156_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005325987.1|911328_912597_+	esterase FrsA	NA	NA	NA	NA	NA
WP_041205137.1|912659_913052_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_005325991.1|913185_914289_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.5	2.6e-60
WP_041205139.1|914413_915667_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.5	9.2e-94
WP_041205140.1|915817_916450_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_005325997.1|916523_916955_-	universal stress protein	NA	NA	NA	NA	NA
WP_041205143.1|917157_917910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005325999.1|917990_918494_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_161506908.1|918812_921437_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081805634.1|921466_922225_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_041205148.1|922350_922932_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_005326004.1|923247_924579_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_049832146.1|924593_925553_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005326006.1|925584_926406_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	7.3e-31
WP_005326007.1|926432_929006_+	nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_005326008.1|929053_929413_+	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_005326010.1|929558_930650_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005326011.1|930643_931552_+	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_041205152.1|931624_932326_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011191341.1|933233_934508_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_021141311.1|934971_936108_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_011191341.1|936534_937809_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	1323741	1331433	4710838		Enterobacteria_phage(33.33%)	7	NA	NA
WP_010675337.1|1323741_1324416_-	response regulator	NA	W8CYM9	Bacillus_phage	33.3	1.8e-27
WP_161506951.1|1325378_1326464_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.6	2.2e-96
WP_161506952.1|1326463_1327351_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	1.8e-27
WP_161506953.1|1327463_1328339_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	6.6e-107
WP_161506954.1|1328446_1328998_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.0	5.9e-53
WP_161506955.1|1328999_1330244_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_161506956.1|1330308_1331433_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.7	6.0e-28
>prophage 8
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	1377373	1449326	4710838	tRNA,transposase	Salmonella_phage(16.67%)	54	NA	NA
WP_005328710.1|1377373_1378480_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005328711.1|1378637_1379105_-	NUDIX hydrolase	NA	A0A023W5N2	Serratia_phage	62.2	8.6e-05
WP_041205353.1|1379101_1380034_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_005328714.1|1380169_1380937_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_005328715.1|1380937_1381243_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_005328717.1|1381455_1382862_-	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_005328732.1|1383325_1385230_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_011191341.1|1385841_1387116_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_161506965.1|1387180_1387498_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041206859.1|1388210_1388465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043132489.1|1388669_1389113_-	copper resistance protein CopD	NA	NA	NA	NA	NA
WP_041205355.1|1390132_1392457_+	hypothetical protein	NA	J9Q6D6	Salmonella_phage	27.6	5.1e-05
WP_005328918.1|1392654_1394541_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_005328921.1|1395504_1396053_-	YgjV family protein	NA	NA	NA	NA	NA
WP_005328923.1|1396241_1397441_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_041205357.1|1397570_1398446_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005328927.1|1398641_1399895_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.6e-13
WP_005332623.1|1400496_1401828_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_005332620.1|1401845_1403183_-	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_005332617.1|1403413_1404358_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_005332615.1|1404766_1405174_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011191341.1|1405340_1406615_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_041205359.1|1407048_1408155_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A218MA87	Escherichia_phage	47.3	1.2e-81
WP_005332611.1|1408412_1409219_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_081805651.1|1409350_1410766_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005332602.1|1410768_1412808_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.9	9.2e-35
WP_005332598.1|1412804_1413968_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005332596.1|1414211_1414652_-	universal stress protein	NA	NA	NA	NA	NA
WP_005332594.1|1415049_1415931_-	pyrophosphatase	NA	NA	NA	NA	NA
WP_005332592.1|1416466_1418131_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_005332588.1|1418465_1419626_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.7	4.2e-16
WP_005332581.1|1419665_1420550_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_025327678.1|1420813_1421389_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_041205360.1|1421723_1423649_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.0	1.1e-151
WP_005330311.1|1423917_1425054_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.1	3.1e-24
WP_005330309.1|1425322_1426807_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_081805653.1|1426919_1427897_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_005330304.1|1427968_1429333_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_005330303.1|1429332_1430748_+	sucrose-6-phosphate hydrolase	NA	NA	NA	NA	NA
WP_005330302.1|1430775_1431786_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042649827.1|1431872_1432601_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	39.3	1.5e-11
WP_004576012.1|1432757_1434176_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_041205364.1|1434361_1434766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005330299.1|1435131_1435317_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_005330298.1|1435402_1435717_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005330289.1|1435713_1436127_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_039039223.1|1436140_1436587_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_041205365.1|1436626_1437646_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_161506966.1|1437638_1440797_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_041205366.1|1440830_1443275_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	36.2	4.8e-22
WP_041205367.1|1443685_1444699_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_081805654.1|1445563_1445980_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.1	4.9e-44
WP_041205370.1|1446001_1447207_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	61.1	1.2e-135
WP_161506967.1|1448360_1449326_-|transposase	IS1595-like element ISAeme10 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	1463824	1664884	4710838	tRNA,transposase	Helicobacter_phage(21.95%)	163	NA	NA
WP_103261424.1|1463824_1464229_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.0	3.3e-29
WP_103261423.1|1464286_1465513_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_080989979.1|1465547_1466534_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_039039207.1|1466629_1466959_+	DUF3634 family protein	NA	NA	NA	NA	NA
WP_052815582.1|1467049_1467958_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160839189.1|1468888_1469971_+	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_041211612.1|1469974_1471951_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_080989981.1|1471871_1472567_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010673684.1|1472567_1472897_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_010673685.1|1472905_1473799_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_113978023.1|1473963_1475325_+	MFS transporter	NA	NA	NA	NA	NA
WP_010673687.1|1475408_1475777_+	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_041205253.1|1475881_1477219_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_041205389.1|1477342_1478446_-	YdcF family protein	NA	NA	NA	NA	NA
WP_005332127.1|1478595_1479489_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081805658.1|1479589_1480078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161506973.1|1480088_1480517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005332143.1|1480795_1481038_-	DUF3297 family protein	NA	NA	NA	NA	NA
WP_161506974.1|1481136_1482453_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_049832154.1|1482436_1482733_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019706001.1|1483236_1484184_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_148304709.1|1484252_1484612_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.4	3.2e-15
WP_041206863.1|1484645_1485785_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	68.7	7.2e-146
WP_019706001.1|1486286_1487234_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_005323482.1|1488391_1489198_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_005323481.1|1489194_1490388_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_005323480.1|1490442_1491930_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	42.3	3.8e-38
WP_005323479.1|1491926_1492940_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	4.4e-54
WP_005323478.1|1492949_1493549_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	36.8	1.2e-27
WP_005323477.1|1493541_1495179_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_005323476.1|1495600_1496482_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_161506975.1|1496611_1497232_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_081805733.1|1497158_1498106_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_005323473.1|1498141_1498714_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.3	8.1e-21
WP_005323472.1|1498824_1499748_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_005323471.1|1500003_1500867_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_005323470.1|1500941_1502120_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_005323469.1|1502237_1502897_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005323466.1|1502996_1503638_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041206082.1|1503790_1504984_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_041206081.1|1505001_1508151_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_041206080.1|1508143_1509559_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_041205574.1|1510122_1510548_-|transposase	IS200/IS605-like element ISAeme8 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.9	4.9e-23
WP_041206863.1|1510605_1511745_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	68.7	7.2e-146
WP_041206683.1|1512395_1513937_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
WP_161506736.1|1513951_1514707_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.9	6.8e-60
WP_041206074.1|1516197_1516512_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_005328266.1|1516517_1516853_-	addiction module protein	NA	A0A141GEX6	Brucella_phage	46.4	2.0e-11
WP_041205574.1|1517091_1517517_-|transposase	IS200/IS605-like element ISAeme8 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.9	4.9e-23
WP_041206863.1|1517574_1518714_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	68.7	7.2e-146
WP_161507828.1|1518813_1519350_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	36.8	4.4e-21
WP_001809438.1|1519451_1520483_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_005342491.1|1520863_1521814_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_161506976.1|1522725_1523466_-	phosphatase	NA	NA	NA	NA	NA
WP_005324182.1|1523934_1524588_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161506977.1|1524635_1526960_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_161506978.1|1527121_1530184_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.3	5.4e-71
WP_161506979.1|1530199_1531243_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005324189.1|1531309_1532749_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_005324191.1|1532921_1533779_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041205155.1|1533976_1535245_+|transposase	IS4-like element ISAeme3 family transposase	transposase	NA	NA	NA	NA
WP_039041241.1|1535518_1536487_+	glucokinase	NA	NA	NA	NA	NA
WP_041206069.1|1536862_1538245_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_041207018.1|1538244_1538919_-	response regulator	NA	W8CYM9	Bacillus_phage	34.6	2.8e-28
WP_099993964.1|1541576_1542593_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_010674210.1|1543877_1545491_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
WP_004576012.1|1545848_1547267_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_041205384.1|1547967_1549065_-|transposase	ISAs1-like element ISAeme2 family transposase	transposase	NA	NA	NA	NA
WP_010674210.1|1549467_1551081_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
WP_004576012.1|1551438_1552857_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_041205384.1|1553557_1554655_-|transposase	ISAs1-like element ISAeme2 family transposase	transposase	NA	NA	NA	NA
WP_161507829.1|1554730_1555186_+	hypothetical protein	NA	A0A1V0SAG5	Catovirus	40.6	5.6e-09
WP_161506980.1|1555202_1556474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161506981.1|1556448_1557609_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_161506982.1|1557991_1558762_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_161506983.1|1558778_1559669_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_161506984.1|1559713_1560553_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_161506985.1|1561043_1562210_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	54.5	2.4e-112
WP_161506986.1|1562527_1563649_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_161506987.1|1563712_1564141_+	protein tyrosine phosphatase	NA	NA	NA	NA	NA
WP_161506988.1|1564196_1566371_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_161506989.1|1567920_1569482_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
WP_161506990.1|1570886_1571303_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.1	3.8e-44
WP_161506991.1|1571818_1572490_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_161506992.1|1572486_1573242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161506993.1|1573238_1575323_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_161506994.1|1575410_1577129_+	ligase	NA	NA	NA	NA	NA
WP_161506995.1|1577305_1577758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113720009.1|1577938_1578592_+	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_161506996.1|1578797_1582634_+	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	28.8	1.3e-45
WP_042649461.1|1582753_1583647_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_005331430.1|1584170_1584380_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_161506997.1|1584652_1585669_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_005331435.1|1585930_1587028_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_005331436.1|1587096_1588083_+	alpha-ketoacid dehydrogenase subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	28.8	1.8e-07
WP_005331438.1|1589484_1589694_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	60.0	1.1e-15
WP_041206056.1|1589789_1590086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025327553.1|1590072_1590321_-	TIGR02647 family protein	NA	NA	NA	NA	NA
WP_041206055.1|1590569_1591127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005331447.1|1591221_1591614_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_161506998.1|1591700_1593551_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005331452.1|1593643_1594537_-	EamA family transporter	NA	NA	NA	NA	NA
WP_005331455.1|1594751_1594940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021141233.1|1595231_1595636_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	8.8e-30
WP_021141234.1|1595693_1596920_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_081805727.1|1596863_1597913_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_041206053.1|1598087_1598780_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_161506999.1|1598890_1599880_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005329750.1|1600170_1601073_-	DMT family transporter	NA	NA	NA	NA	NA
WP_041207011.1|1601372_1603010_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161507000.1|1603020_1603575_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_161507001.1|1603608_1604025_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_005329758.1|1604021_1604342_-	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_161507002.1|1604436_1605120_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_161507003.1|1605278_1606190_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.5e-37
WP_005329773.1|1606207_1607032_+	protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
WP_161507004.1|1607092_1607491_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_005329775.1|1607490_1607910_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_042648969.1|1608015_1608759_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_161507005.1|1608769_1610635_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_161507006.1|1610781_1611528_+	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_005329779.1|1611542_1612331_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_161507007.1|1612357_1613029_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_161507008.1|1613090_1614188_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_069652528.1|1614234_1615335_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RU71	Clostridium_phage	36.5	3.4e-15
WP_161507009.1|1615338_1617336_+	flagellar biosynthesis protein FlgK	NA	NA	NA	NA	NA
WP_005329788.1|1617339_1618548_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_041205574.1|1618788_1619214_-|transposase	IS200/IS605-like element ISAeme8 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.9	4.9e-23
WP_012564931.1|1620346_1621294_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_021141233.1|1623083_1623488_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	8.8e-30
WP_021141234.1|1623545_1624772_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_041206049.1|1625047_1626538_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005331929.1|1626527_1628597_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005331931.1|1628673_1629186_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_041206048.1|1629444_1630284_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_041206047.1|1630523_1631942_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_161507010.1|1632047_1633082_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_161507011.1|1633137_1634472_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_161507012.1|1634614_1635376_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_161507013.1|1635494_1636133_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.8	3.5e-25
WP_139751091.1|1636141_1637179_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.5	7.2e-76
WP_005302745.1|1637354_1637981_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_161507014.1|1638124_1639153_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_005331956.1|1639255_1639957_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_004575061.1|1640101_1641439_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_161507015.1|1641491_1642805_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_161507016.1|1642878_1644486_-	malate synthase A	NA	NA	NA	NA	NA
WP_161507017.1|1645925_1646465_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_161507018.1|1646668_1648906_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_042649945.1|1648923_1650573_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005328825.1|1650793_1651612_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	3.6e-22
WP_139751100.1|1651702_1652413_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_041206040.1|1652606_1653926_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_161507019.1|1653946_1654489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507020.1|1654763_1655663_+	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_005328837.1|1655672_1657073_+	amino acid permease	NA	NA	NA	NA	NA
WP_041205358.1|1657125_1658454_-|transposase	IS4-like element ISAeme12 family transposase	transposase	NA	NA	NA	NA
WP_041207009.1|1658573_1659413_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_041206038.1|1659613_1660357_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	3.0e-36
WP_005330345.1|1660446_1661406_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005330342.1|1661503_1662292_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021141233.1|1663195_1663600_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	8.8e-30
WP_021141234.1|1663657_1664884_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
>prophage 10
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	1685114	1728810	4710838	tRNA,integrase,transposase	Klebsiella_phage(16.67%)	31	1672735:1672750	1717916:1717931
1672735:1672750	attL	GCGGGCGCTGCGTGGC	NA	NA	NA	NA
WP_161507032.1|1685114_1686452_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_161507033.1|1686500_1688006_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	46.4	6.5e-86
WP_161507034.1|1688132_1688627_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_161507035.1|1688620_1689139_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_161507830.1|1689167_1691429_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_005331991.1|1691617_1693387_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	4.2e-60
WP_005331989.1|1693386_1694382_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005331987.1|1694532_1694733_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_005331986.1|1694729_1695479_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_041206003.1|1695689_1696334_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_041206002.1|1696445_1698299_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_041206001.1|1698592_1699147_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_161507036.1|1699989_1701195_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	34.6	6.5e-12
WP_161507037.1|1701342_1701699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507038.1|1701691_1702006_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_011191341.1|1702051_1703326_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_041205574.1|1703809_1704235_-|transposase	IS200/IS605-like element ISAeme8 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.9	4.9e-23
WP_041204928.1|1705674_1706802_-|transposase	ISAs1-like element ISKpn9 family transposase	transposase	NA	NA	NA	NA
WP_158319064.1|1710420_1711050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205997.1|1711390_1712014_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005330893.1|1712220_1712469_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005330895.1|1712589_1713318_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_005330897.1|1713314_1714028_-	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
WP_005330899.1|1714017_1714515_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005330901.1|1714718_1716095_+|tRNA	cysteine--tRNA ligase	tRNA	H2EDD6	Moumouvirus	30.0	1.0e-45
WP_004576012.1|1716716_1718135_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
1717916:1717931	attR	GCGGGCGCTGCGTGGC	NA	NA	NA	NA
WP_041204928.1|1719275_1720403_+|transposase	ISAs1-like element ISKpn9 family transposase	transposase	NA	NA	NA	NA
WP_148304699.1|1721146_1721839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011191341.1|1722214_1723489_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_107961366.1|1724653_1725799_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_052814785.1|1727199_1728810_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.8	2.5e-43
>prophage 11
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	2002631	2024691	4710838	integrase,transposase	uncultured_Caudovirales_phage(20.0%)	19	1996207:1996266	2020425:2020515
1996207:1996266	attL	AATAATGGGGTGGCTGATGGGGCTCGAACCCACGACAACCGGAATCACAATCCGGGACTC	NA	NA	NA	NA
WP_041205618.1|2002631_2005010_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_161507133.1|2004994_2008303_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010674971.1|2008793_2008994_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	36.9	1.5e-06
WP_010674970.1|2009119_2009335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507134.1|2009350_2010595_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	29.1	3.8e-39
WP_104453295.1|2010716_2011469_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_010674967.1|2011593_2011875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160839242.1|2012272_2012518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024943279.1|2012576_2012927_+	toxin RelE	NA	NA	NA	NA	NA
WP_042648333.1|2012926_2013229_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099368881.1|2013452_2014469_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_161507135.1|2014510_2015653_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005330546.1|2015788_2016373_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_161507841.1|2016381_2018940_+	DEAD/DEAH box helicase family protein	NA	G9FI19	Nocardia_phage	32.8	1.0e-30
WP_161507136.1|2019048_2020266_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_005329232.1|2020943_2022254_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
2020425:2020515	attR	AATAATGGGGTGGCTGATGGGGCTCGAACCCACGACAACCGGAATCACAATCCGGGACTCTACCAACTGAGCTACAGCCACCACTGAAATC	NA	NA	NA	NA
WP_005329233.1|2022253_2022508_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161507132.1|2023009_2023258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005328758.1|2023773_2024691_+|transposase	IS5-like element ISAeme7 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	56.5	2.6e-93
>prophage 13
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	2107041	2201516	4710838	transposase	Bacillus_phage(38.46%)	59	NA	NA
WP_041205253.1|2107041_2108379_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_161507149.1|2108490_2109426_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005327914.1|2109587_2111852_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_161507150.1|2112216_2113353_+	HPP family protein	NA	NA	NA	NA	NA
WP_041205644.1|2115490_2116165_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005327907.1|2116236_2117490_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_161507151.1|2117643_2119164_-	cryptochrome/photolyase family protein	NA	E3T4R9	Cafeteria_roenbergensis_virus	31.8	2.7e-47
WP_005327905.1|2119163_2119307_-	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
WP_005327904.1|2119478_2120399_-	peptidase S11	NA	NA	NA	NA	NA
WP_005327903.1|2120749_2121940_-	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
WP_005327902.1|2121936_2122512_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_005327901.1|2122508_2124470_-	heme lyase NrfEFG subunit NrfE	NA	NA	NA	NA	NA
WP_005327900.1|2124619_2125573_-	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
WP_005327898.1|2125660_2126341_-	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
WP_041205646.1|2126337_2126991_-	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_041205647.1|2127042_2128485_-	ammonia-forming nitrite reductase cytochrome c552 subunit	NA	NA	NA	NA	NA
WP_005327893.1|2140028_2141231_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_041205648.1|2141334_2142612_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_139751787.1|2142601_2144284_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_139751788.1|2144617_2145073_-	SecC motif-containing protein	NA	NA	NA	NA	NA
WP_041205651.1|2145201_2146869_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.5	9.8e-43
WP_005327887.1|2146973_2148185_+	ROK family protein	NA	NA	NA	NA	NA
WP_005327886.1|2148181_2149765_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005327885.1|2149765_2150431_+	response regulator	NA	W8CYM9	Bacillus_phage	36.9	1.6e-07
WP_041205828.1|2151163_2152501_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_025327141.1|2153474_2153936_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_005327879.1|2153978_2154944_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_041205653.1|2155149_2156667_-	lytic transglycosylase F	NA	A0A1P8CWQ1	Bacillus_phage	43.3	9.0e-11
WP_005327876.1|2156871_2158557_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_005327874.1|2158984_2159191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205655.1|2159537_2161550_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_041205657.1|2161546_2161804_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_005327863.1|2161884_2162535_+	DedA family protein	NA	NA	NA	NA	NA
WP_041205661.1|2163043_2163565_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_041205664.1|2163651_2165229_-	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_041205666.1|2165562_2166276_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_139751786.1|2166336_2167857_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_005327855.1|2167867_2169139_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.7	7.6e-11
WP_005327853.1|2169163_2171086_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_041205668.1|2171647_2173570_-	RecQ family ATP-dependent DNA helicase	NA	A0A2K9L3P7	Tupanvirus	35.5	2.9e-54
WP_041205671.1|2173906_2175157_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_005327845.1|2175918_2177217_-	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_010676219.1|2177392_2178490_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_041206924.1|2178630_2179221_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_049832177.1|2179276_2180653_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	43.6	2.4e-47
WP_005323523.1|2180862_2182386_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_005323524.1|2182546_2183026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005323525.1|2183259_2183457_+	DUF4250 domain-containing protein	NA	NA	NA	NA	NA
WP_021141311.1|2183792_2184929_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_005323527.1|2185304_2187779_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	45.6	2.0e-15
WP_041205253.1|2187893_2189231_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005323528.1|2189282_2189837_-	cytochrome b561	NA	NA	NA	NA	NA
WP_005323530.1|2190138_2191524_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_041205674.1|2191678_2192119_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.4	2.6e-11
WP_005323534.1|2192273_2195072_+	response regulator	NA	A0A1V0SGX0	Hokovirus	34.0	1.3e-66
WP_041205675.1|2195215_2196952_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.4	2.9e-53
WP_005323542.1|2197061_2198813_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	3.7e-48
WP_161507152.1|2198874_2200056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205447.1|2200349_2201516_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	67.9	7.4e-146
>prophage 14
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	2253172	2389669	4710838	tRNA,integrase,protease,transposase	Hokovirus(12.0%)	111	2366041:2366056	2393279:2393294
WP_041205828.1|2253172_2254510_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_161507155.1|2254552_2255818_-	long-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_005325140.1|2256226_2256970_-	DUF3379 domain-containing protein	NA	NA	NA	NA	NA
WP_005325142.1|2256962_2257478_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_041206927.1|2257593_2259114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507156.1|2259143_2260619_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_005325155.1|2260640_2261600_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_041205724.1|2261596_2262160_-	DUF4381 family protein	NA	NA	NA	NA	NA
WP_041205726.1|2262144_2263035_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_005325158.1|2263158_2264109_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005325159.1|2264303_2265614_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_041206928.1|2265613_2267761_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_005325161.1|2268035_2268176_+	TIGR02808 family protein	NA	NA	NA	NA	NA
WP_042648052.1|2268365_2268923_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_161507157.1|2268935_2269820_+	AEC family transporter	NA	NA	NA	NA	NA
WP_012564931.1|2269943_2270891_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_161507158.1|2271073_2271559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507159.1|2271626_2272211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507160.1|2272336_2273566_-	MFS transporter	NA	NA	NA	NA	NA
WP_161507161.1|2273630_2274398_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.6	3.2e-12
WP_161507162.1|2274390_2275443_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_161507163.1|2275562_2276669_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161507164.1|2277220_2280439_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_005326114.1|2280606_2281146_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_161507165.1|2281493_2283116_+	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	24.5	1.8e-25
WP_161507166.1|2283292_2284024_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_161507167.1|2284090_2284411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205732.1|2284512_2285148_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	34.2	7.9e-17
WP_161507168.1|2285140_2285914_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_161507169.1|2286116_2290058_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	35.1	2.7e-51
WP_139750895.1|2290054_2292205_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_042650180.1|2292197_2293307_-	two-component system response regulator	NA	W8CYM9	Bacillus_phage	36.4	3.6e-09
WP_005325000.1|2293458_2294193_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	A0A2H4UVM0	Bodo_saltans_virus	22.8	7.7e-08
WP_042650179.1|2294198_2294831_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_042650178.1|2294830_2295964_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_042650177.1|2295976_2297077_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_042650176.1|2297073_2298384_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_005324991.1|2298396_2299293_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_041205737.1|2299631_2299877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005324987.1|2299943_2301854_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.6	2.5e-90
WP_005324985.1|2302006_2302708_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_042650175.1|2302775_2303294_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_042650174.1|2303293_2304136_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_081805875.1|2304332_2306009_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.1	9.6e-38
WP_161507170.1|2306109_2307222_+	ribonuclease D	NA	NA	NA	NA	NA
WP_161507171.1|2307724_2308477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507172.1|2308466_2309594_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_161507173.1|2309970_2310408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507842.1|2310681_2311050_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_161507174.1|2311248_2312411_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	50.3	2.0e-82
WP_004576012.1|2313148_2314567_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_161506800.1|2316364_2317452_-|transposase	IS3-like element ISAeme6 family transposase	transposase	NA	NA	NA	NA
WP_161507175.1|2317490_2318327_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_042650170.1|2318383_2319328_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_161507176.1|2319505_2319883_+	DUF454 domain-containing protein	NA	NA	NA	NA	NA
WP_042650168.1|2320015_2320561_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.9	3.4e-29
WP_041205745.1|2320734_2323254_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	39.4	7.9e-44
WP_011706069.1|2323384_2323714_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_043131365.1|2324240_2324867_-	hydrolase	NA	NA	NA	NA	NA
WP_161507177.1|2325031_2325898_-	pirin family protein	NA	NA	NA	NA	NA
WP_161507843.1|2325995_2326886_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005330645.1|2326969_2328292_-	YjiH family protein	NA	NA	NA	NA	NA
WP_011191341.1|2328703_2329978_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_019706001.1|2330527_2331475_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_005325086.1|2332377_2332800_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_161507178.1|2332976_2336903_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	27.4	1.1e-55
WP_041205747.1|2337001_2337844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205748.1|2338007_2338295_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_161507179.1|2338498_2341669_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.3	3.6e-62
WP_042650066.1|2341665_2342682_+	response regulator	NA	W8CYM9	Bacillus_phage	33.9	3.2e-12
WP_042650067.1|2342657_2343302_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_161507180.1|2343295_2344426_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_041205752.1|2344478_2345516_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_005328336.1|2345844_2346489_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_005328337.1|2346902_2348096_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_161507181.1|2348309_2349740_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	1.1e-18
WP_005328342.1|2349823_2350096_+	acylphosphatase	NA	NA	NA	NA	NA
WP_161507182.1|2350115_2350859_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_042650070.1|2350926_2352960_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	26.5	2.9e-44
WP_005328348.1|2353145_2354228_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_041205758.1|2354336_2354981_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.0	3.0e-32
WP_005328350.1|2355044_2355626_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	39.5	9.1e-28
WP_041205760.1|2355974_2357447_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_041206683.1|2357754_2359296_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
WP_161507183.1|2360704_2363878_-	ribonuclease E	NA	NA	NA	NA	NA
WP_111910603.1|2364252_2365236_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_161507184.1|2365235_2365883_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_041205765.1|2365955_2366537_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
2366041:2366056	attL	TCCAGCCCCTGGAACA	NA	NA	NA	NA
WP_041205768.1|2366681_2367335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025326977.1|2367605_2368127_+	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_005300935.1|2368147_2368315_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_041205769.1|2368324_2369344_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_005329561.1|2369350_2370310_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_041205773.1|2370376_2371312_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_025326981.1|2371325_2372060_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.7	9.7e-19
WP_005300909.1|2372217_2372454_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.7e-09
WP_042648386.1|2372536_2373778_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_161507185.1|2373845_2374652_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_005329567.1|2374641_2375643_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_041205780.1|2375642_2376284_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	42.4	8.2e-30
WP_005329570.1|2376268_2377216_+	DNA polymerase III subunit delta'	NA	B2ZY37	Ralstonia_phage	27.5	3.5e-05
WP_005329573.1|2377234_2378014_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_161507844.1|2378340_2379330_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_139751745.1|2379542_2379800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139751744.1|2379995_2381426_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_139750695.1|2381555_2384108_-	MCE family protein	NA	NA	NA	NA	NA
WP_139750696.1|2384163_2384772_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_139750697.1|2384749_2385394_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_139750698.1|2385618_2385924_+	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_139750699.1|2386213_2387491_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_161507186.1|2387692_2389669_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
2393279:2393294	attR	TCCAGCCCCTGGAACA	NA	NA	NA	NA
>prophage 15
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	2436300	2447424	4710838	tRNA	Hokovirus(16.67%)	8	NA	NA
WP_161507845.1|2436300_2440227_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	35.6	4.1e-31
WP_005300715.1|2440281_2440578_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	35.6	3.0e-11
WP_161507199.1|2440581_2442969_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.5	1.1e-05
WP_005329694.1|2442981_2443965_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.2	5.3e-36
WP_010674800.1|2444289_2444646_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005315535.1|2444660_2444858_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_041204270.1|2444943_2445492_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.2	1.8e-14
WP_043131783.1|2445495_2447424_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.0	9.7e-127
>prophage 16
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	2621922	2683335	4710838	tRNA,protease,bacteriocin,transposase	Bacillus_virus(20.0%)	49	NA	NA
WP_041204923.1|2621922_2623065_-|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_004576012.1|2624689_2626108_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_042650400.1|2627306_2628896_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_042650401.1|2628980_2630444_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.6	9.1e-93
WP_161507245.1|2630719_2631355_-	YitT family protein	NA	NA	NA	NA	NA
WP_161507847.1|2631985_2635081_-	alpha-amylase	NA	NA	NA	NA	NA
WP_161507246.1|2635575_2636490_+	EamA family transporter	NA	NA	NA	NA	NA
WP_161507247.1|2636651_2638016_+	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	32.1	7.8e-22
WP_161507248.1|2638071_2639445_-	heme anaerobic degradation radical SAM methyltransferase ChuW/HutW	NA	NA	NA	NA	NA
WP_161507249.1|2639694_2640183_-	OmpA family protein	NA	NA	NA	NA	NA
WP_161507250.1|2640211_2641453_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	35.3	2.1e-18
WP_041206956.1|2641449_2641995_-	YfiR family protein	NA	NA	NA	NA	NA
WP_042650408.1|2642193_2643741_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_161507251.1|2643887_2644226_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_161507252.1|2644274_2645069_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_161507253.1|2645289_2646321_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_161507254.1|2646351_2647758_-	YcjX family protein	NA	NA	NA	NA	NA
WP_161507255.1|2647834_2648239_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_161507256.1|2648235_2648472_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_041205885.1|2648475_2649156_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_161507257.1|2649351_2650395_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_161507848.1|2650555_2652151_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_161507258.1|2652227_2653187_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_161507259.1|2653231_2654125_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005325353.1|2654335_2655334_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.1	2.8e-08
WP_005325357.1|2655569_2656355_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	2.9e-13
WP_043131987.1|2656500_2657259_-|tRNA	tRNA hydroxylase	tRNA	NA	NA	NA	NA
WP_161507849.1|2657387_2658398_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_161507260.1|2660128_2661559_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	27.0	7.7e-36
WP_005325371.1|2661665_2663186_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.6	1.8e-88
WP_005325372.1|2663204_2663696_-|bacteriocin	bacteriocin production protein	bacteriocin	NA	NA	NA	NA
WP_043132095.1|2663884_2665180_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.7	8.1e-93
WP_161507850.1|2665467_2666811_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.0	5.4e-76
WP_042650317.1|2666957_2667566_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_042650316.1|2667635_2670140_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.6	1.6e-89
WP_005300047.1|2670332_2670824_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_161507261.1|2670974_2672090_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_043132103.1|2672274_2673225_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.8	1.0e-60
WP_043132104.1|2673281_2674523_+	response regulator	NA	A0A127AWB9	Bacillus_phage	32.8	7.6e-16
WP_043132106.1|2674625_2675096_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_043132108.1|2675113_2675821_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_042650310.1|2675817_2676534_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005300033.1|2676602_2676821_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_043132110.1|2676890_2679143_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	7.0e-169
WP_005325410.1|2679203_2679521_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	2.0e-13
WP_005300025.1|2679749_2679968_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_043132112.1|2680093_2681206_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_043132113.1|2681535_2681850_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_041205253.1|2681997_2683335_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	2797309	2934144	4710838	integrase,transposase	Escherichia_phage(15.38%)	110	2792664:2792681	2907643:2907660
2792664:2792681	attL	CAAGTGCTCGCCCTGGCC	NA	NA	NA	NA
WP_099369027.1|2797309_2798326_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	4.9e-186
WP_148304730.1|2798386_2799328_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041205490.1|2800004_2801741_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.3	1.0e-29
WP_021141311.1|2801927_2803064_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_161507312.1|2804203_2805640_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_005327429.1|2805633_2806560_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_005327427.1|2806556_2807357_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005327426.1|2807373_2808075_+	peptidase	NA	NA	NA	NA	NA
WP_041205479.1|2808157_2808643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327423.1|2808766_2809216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205476.1|2809220_2812190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327419.1|2812189_2813014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327418.1|2813099_2814524_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005327417.1|2814664_2815225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327416.1|2815331_2816591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327415.1|2816678_2818325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327414.1|2818441_2819644_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.4	1.2e-21
WP_041205474.1|2819724_2820291_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_041205472.1|2820320_2821748_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_005327410.1|2821874_2822348_-	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_005327408.1|2822500_2823181_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.5e-29
WP_005327406.1|2823202_2825623_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_005327404.1|2825619_2826693_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_099369027.1|2826867_2827884_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	4.9e-186
WP_161507313.1|2828091_2830884_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_041205467.1|2830883_2831528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005327547.1|2831529_2832966_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_081805666.1|2832958_2833735_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_041205465.1|2833747_2835445_-	L-lactate permease	NA	NA	NA	NA	NA
WP_005327551.1|2835580_2836486_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041205463.1|2836524_2837334_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005327555.1|2837442_2837814_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_005327557.1|2837819_2838356_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041206878.1|2838367_2838703_+	DUF3802 family protein	NA	NA	NA	NA	NA
WP_005327561.1|2838969_2839602_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_041206877.1|2839854_2841183_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_148304685.1|2841356_2841536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005327565.1|2841600_2842953_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_041205459.1|2843089_2844184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507314.1|2844434_2846696_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_012564931.1|2847662_2848610_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_005331601.1|2849159_2849477_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005331597.1|2850733_2852026_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005331594.1|2852100_2852640_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005331593.1|2852849_2854658_-	M3 family oligoendopeptidase	NA	A0A1X9I5X5	Streptococcus_phage	22.9	1.6e-09
WP_041205454.1|2856960_2857878_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_005331588.1|2858088_2858691_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	35.3	7.2e-20
WP_005331587.1|2858770_2859676_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.7	1.3e-33
WP_041205451.1|2859785_2861555_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_021141234.1|2861616_2862843_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_012564931.1|2862945_2863893_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_161507315.1|2863960_2864398_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	1.6e-29
WP_041205447.1|2864604_2865771_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	67.9	7.4e-146
WP_041205445.1|2865958_2866456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205443.1|2866524_2867385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139751046.1|2867438_2868362_-	phosphotransferase	NA	NA	NA	NA	NA
WP_041205438.1|2868291_2868888_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_041205436.1|2868887_2869286_-	YcfL family protein	NA	NA	NA	NA	NA
WP_005330108.1|2869352_2870774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005330109.1|2870773_2871124_-	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_041205433.1|2873469_2874345_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.1	1.4e-11
WP_005330115.1|2874424_2875768_+	dihydroorotase	NA	NA	NA	NA	NA
WP_049832155.1|2876202_2876673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005330120.1|2876875_2878135_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_041205431.1|2878191_2878638_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_005326819.1|2878814_2880041_+	alanine racemase	NA	NA	NA	NA	NA
WP_005326821.1|2880094_2881054_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	34.7	6.1e-37
WP_005326823.1|2881348_2882344_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	2.2e-21
WP_041205429.1|2882343_2883324_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.9e-14
WP_005326827.1|2883434_2884346_-	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_041205427.1|2884360_2885281_-	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_161507316.1|2885595_2887215_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_041205423.1|2887495_2888131_-	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_005326838.1|2889038_2891714_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_161507317.1|2891824_2893060_+	DUF3391 domain-containing protein	NA	NA	NA	NA	NA
WP_042649229.1|2893412_2895104_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	56.4	4.8e-162
WP_139751416.1|2895100_2895805_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_161507318.1|2895947_2897369_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_161507319.1|2897440_2899075_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_012564931.1|2899196_2900144_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_021141234.1|2900432_2901659_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_021141233.1|2901716_2902121_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	8.8e-30
WP_161507320.1|2902192_2902525_+	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_161507321.1|2902534_2903572_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_161507322.1|2903688_2905449_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.1	1.7e-90
WP_161507323.1|2905541_2906975_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_161507324.1|2907176_2907434_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	57.7	2.8e-21
WP_005326862.1|2907501_2907711_-	DUF1653 domain-containing protein	NA	M5ABZ3	Bacillus_phage	49.2	2.6e-09
2907643:2907660	attR	GGCCAGGGCGAGCACTTG	NA	NA	NA	NA
WP_005326864.1|2908070_2909285_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_139751411.1|2910988_2912182_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_005326867.1|2912464_2912908_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_161507325.1|2913428_2914727_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	1.2e-14
WP_161507326.1|2914807_2915005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507327.1|2915066_2915963_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005326871.1|2916074_2916656_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_161507328.1|2916660_2917227_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_161507329.1|2917241_2919752_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_161507330.1|2919755_2920808_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_139751791.1|2920932_2921565_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_161507331.1|2921603_2922362_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_161507332.1|2922392_2923034_+	endonuclease III	NA	NA	NA	NA	NA
WP_025326535.1|2923114_2923522_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_161507333.1|2925571_2926501_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_161507334.1|2926642_2927335_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_161507335.1|2927361_2928294_+	cobalamin biosynthesis protein CobD	NA	NA	NA	NA	NA
WP_064339913.1|2928286_2929150_+	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_005342491.1|2929330_2930281_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_161507336.1|2930378_2930798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019706001.1|2931404_2932352_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_021141311.1|2933007_2934144_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	2940197	3005391	4710838	tRNA,transposase	Enterobacteria_phage(30.77%)	49	NA	NA
WP_161507342.1|2940197_2941646_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_161507343.1|2941821_2942781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507344.1|2942853_2945253_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_161507853.1|2945263_2950186_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_161507345.1|2950225_2951242_+	DUF2955 domain-containing protein	NA	NA	NA	NA	NA
WP_161507346.1|2951243_2951672_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_161507347.1|2951765_2953454_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_161507348.1|2953588_2956528_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.1	2.5e-09
WP_161507349.1|2956603_2957446_+	pyruvate formate lyase 1-activating protein	NA	M4MAG2	Vibrio_phage	37.5	9.2e-05
WP_161507350.1|2957540_2958182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005342491.1|2959124_2960075_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_011191341.1|2960184_2961459_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_107961366.1|2962024_2963170_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_161470123.1|2963377_2963752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205394.1|2965776_2966577_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_161507351.1|2966599_2967250_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.8	6.8e-08
WP_161507352.1|2967265_2968468_+	sugar transporter	NA	NA	NA	NA	NA
WP_005342491.1|2968549_2969500_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_161507814.1|2969638_2970910_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161507353.1|2971084_2973910_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_161507354.1|2973909_2975574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507854.1|2975612_2976779_+	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.9	9.1e-112
WP_161507355.1|2976863_2977766_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_161507356.1|2977855_2979871_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_161507357.1|2979858_2980887_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_161507358.1|2980928_2981843_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.6	7.5e-61
WP_161507359.1|2981844_2982930_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.2	1.3e-96
WP_161507360.1|2982929_2983817_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.7	6.2e-28
WP_010676219.1|2984636_2985734_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_041206088.1|2986084_2986636_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.9	3.0e-49
WP_161507361.1|2986686_2988771_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_161507362.1|2988778_2990092_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_043130022.1|2990268_2990961_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005332892.1|2991054_2991795_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_161507363.1|2991999_2992773_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161507364.1|2992838_2993609_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.0	1.7e-13
WP_041206091.1|2994141_2995044_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_041207026.1|2995250_2996579_+|transposase	IS4-like element ISAeme13 family transposase	transposase	NA	NA	NA	NA
WP_021141234.1|2996803_2998030_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_021141233.1|2998087_2998492_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	8.8e-30
WP_005327633.1|2998584_2998965_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_041206093.1|2998961_2999312_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_041206094.1|2999370_2999850_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_041206095.1|2999920_3001354_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005327624.1|3001505_3001748_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_041206096.1|3001828_3002899_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_081805736.1|3003084_3003759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021141234.1|3003702_3004929_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_021141233.1|3004986_3005391_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	8.8e-30
>prophage 19
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	3025480	3072886	4710838	protease,transposase	Edwardsiella_phage(25.0%)	44	NA	NA
WP_005328180.1|3025480_3025963_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_005328181.1|3026253_3026613_+	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_161507370.1|3026612_3027488_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_161507371.1|3027554_3028694_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_139751563.1|3028812_3029886_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	47.9	7.9e-78
WP_161507372.1|3030216_3031296_-	glycerophosphodiester phosphodiesterase	NA	A0A220BY94	Staphylococcus_phage	26.7	7.1e-10
WP_161507373.1|3031399_3032887_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_005328190.1|3033329_3034088_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.2	2.8e-21
WP_021141311.1|3035125_3036262_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_005327692.1|3037484_3038333_+	aquaporin family protein	NA	NA	NA	NA	NA
WP_041206102.1|3038362_3039865_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_043130055.1|3040044_3040947_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041206103.1|3041193_3041541_+	GFA family protein	NA	NA	NA	NA	NA
WP_139750857.1|3041769_3042156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206104.1|3042202_3042568_+	VOC family protein	NA	NA	NA	NA	NA
WP_161507374.1|3042742_3043033_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_041206106.1|3043120_3043924_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	33.3	9.6e-36
WP_005327701.1|3044297_3045470_+	MFS transporter	NA	NA	NA	NA	NA
WP_005310033.1|3045533_3045647_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_005327704.1|3045671_3046799_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_041206107.1|3046798_3048370_-	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_011191341.1|3048470_3049745_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_005327708.1|3049890_3051306_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005327710.1|3051426_3052233_+	solute-binding protein	NA	NA	NA	NA	NA
WP_005327713.1|3052286_3052706_+	lipoprotein	NA	NA	NA	NA	NA
WP_005327716.1|3052713_3053241_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_041206108.1|3053225_3053930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205828.1|3054007_3055345_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005332697.1|3055463_3055922_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005332699.1|3056103_3056757_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_041207030.1|3057981_3058452_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_081805738.1|3058537_3058693_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_005332701.1|3058762_3059230_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005332702.1|3059301_3060153_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041206109.1|3060274_3060778_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_161507375.1|3060770_3062009_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_005332706.1|3062052_3063066_-	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_005332707.1|3063599_3064958_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_005332708.1|3065143_3065347_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_005332709.1|3065372_3065741_-	VOC family protein	NA	NA	NA	NA	NA
WP_005332710.1|3065855_3066323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010676219.1|3067315_3068413_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_161507376.1|3068460_3069663_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011191341.1|3071611_3072886_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	3084594	3135482	4710838	integrase,protease,transposase	Enterobacteria_phage(10.0%)	46	3128778:3128795	3142273:3142290
WP_021141234.1|3084594_3085821_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_041205449.1|3085878_3086283_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	1.1e-29
WP_005325486.1|3087596_3088334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005325488.1|3088333_3088894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005325490.1|3089004_3089907_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005325492.1|3089908_3090322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206120.1|3090388_3092119_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_004575061.1|3092172_3093510_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005325496.1|3093632_3095282_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.4	4.9e-26
WP_005325498.1|3095551_3096208_-	GTP cyclohydrolase I FolE	NA	Q6WI31	Vibrio_phage	54.8	8.0e-57
WP_041207032.1|3096566_3097793_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_005325501.1|3097789_3098545_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A291ATS8	Pandoravirus	32.3	1.0e-07
WP_041206121.1|3098610_3099390_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005325503.1|3099460_3100516_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	5.1e-21
WP_005325504.1|3100512_3101193_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005325505.1|3101302_3102031_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005325506.1|3102115_3102601_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_005325507.1|3102800_3103046_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_005325509.1|3103042_3103537_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_041207033.1|3103618_3104146_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_005325513.1|3104367_3104958_-	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_041206124.1|3104969_3105425_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_041206126.1|3105424_3106300_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_005325518.1|3106296_3107031_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_041206127.1|3107044_3109534_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_041204444.1|3109660_3109927_-	chaperone NapD	NA	NA	NA	NA	NA
WP_041206129.1|3109959_3110469_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_005325528.1|3110719_3111715_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_005325535.1|3111921_3113634_+	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_005325544.1|3113633_3114272_+	two-component system response regulator NarL	NA	NA	NA	NA	NA
WP_041206130.1|3114441_3114867_+	globin	NA	NA	NA	NA	NA
WP_041206132.1|3115180_3115756_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_005325547.1|3116023_3118105_-	response regulator	NA	A0A1V0SGX0	Hokovirus	34.4	2.2e-44
WP_005325548.1|3118123_3119308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005325549.1|3119419_3120343_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	32.3	9.0e-30
WP_005325550.1|3120357_3120693_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_005325551.1|3120989_3121787_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_005325554.1|3121904_3122483_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	31.5	8.2e-13
WP_041206134.1|3122742_3125199_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005325558.1|3125372_3126890_+	DUF3369 domain-containing protein	NA	NA	NA	NA	NA
WP_005325560.1|3126970_3128227_-	TIGR03503 family protein	NA	NA	NA	NA	NA
WP_161507377.1|3128223_3128946_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.3	1.3e-39
3128778:3128795	attL	CCACCAGCCGATCCGGCT	NA	NA	NA	NA
WP_161507378.1|3129082_3130348_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_161507814.1|3130306_3131578_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161507379.1|3131751_3133413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507380.1|3133409_3135482_+|integrase	integrase	integrase	NA	NA	NA	NA
3142273:3142290	attR	CCACCAGCCGATCCGGCT	NA	NA	NA	NA
>prophage 21
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	3314139	3376191	4710838	transposase	Bacillus_phage(25.0%)	51	NA	NA
WP_021141311.1|3314139_3315276_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_161507394.1|3316316_3319754_+	response regulator	NA	W8CYM9	Bacillus_phage	43.7	1.9e-19
WP_161507395.1|3320042_3320837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139751376.1|3321396_3322281_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_139751375.1|3322486_3323623_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_042650524.1|3323820_3324171_+	cyclophilin	NA	NA	NA	NA	NA
WP_139751374.1|3324201_3325395_+	MFS transporter	NA	NA	NA	NA	NA
WP_041206196.1|3326834_3327152_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_041206197.1|3327288_3327438_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_161507396.1|3327487_3328033_-	NosL protein	NA	NA	NA	NA	NA
WP_005324386.1|3328057_3328888_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_139751372.1|3328884_3329811_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.8	2.2e-28
WP_161507397.1|3329807_3331127_-	nitrous oxide reductase family maturation protein NosD	NA	NA	NA	NA	NA
WP_021141192.1|3331186_3333094_-	nitrous-oxide reductase	NA	NA	NA	NA	NA
WP_161507859.1|3333158_3335327_-	regulatory protein NosR	NA	NA	NA	NA	NA
WP_041204923.1|3335545_3336688_+|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_161507398.1|3336886_3337396_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005326992.1|3337998_3338916_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_161507399.1|3338937_3339936_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_042650508.1|3339996_3340719_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_161507400.1|3340966_3341908_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_041206201.1|3342060_3342549_-	peptidase P60	NA	A0A217EQL1	Bacillus_phage	42.1	5.1e-16
WP_161507401.1|3342825_3343548_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_043131180.1|3343544_3344393_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_025327798.1|3344526_3344769_-	lipoprotein	NA	NA	NA	NA	NA
WP_041206202.1|3344992_3345646_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2I2L4Y7	Orpheovirus	43.0	4.6e-36
WP_042650512.1|3346107_3346944_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	38.2	1.4e-13
WP_161507402.1|3347008_3348277_-	YdgA family protein	NA	NA	NA	NA	NA
WP_005326968.1|3348384_3349866_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_161507403.1|3349962_3350514_+	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_161507404.1|3350504_3350963_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_161507860.1|3351272_3352007_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	57.7	8.8e-28
WP_161507405.1|3352128_3352815_-	aquaporin Z	NA	NA	NA	NA	NA
WP_005326958.1|3353127_3353649_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_161507406.1|3353913_3354828_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_161507407.1|3354999_3355503_+	damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_161507408.1|3355533_3355761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019706001.1|3356258_3357206_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_161507409.1|3357351_3359745_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	68.5	2.5e-100
WP_161507410.1|3359891_3363038_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.6	1.3e-75
WP_161507411.1|3363037_3364102_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_161507412.1|3364300_3365857_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.9	1.5e-21
WP_005333067.1|3365890_3366754_+	patatin	NA	NA	NA	NA	NA
WP_042648643.1|3366823_3368185_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_005298604.1|3368380_3368647_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042648642.1|3368905_3369499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206213.1|3369807_3370827_+	porin OmpA	NA	NA	NA	NA	NA
WP_011191341.1|3371306_3372581_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_161507413.1|3372679_3373645_+	OmpA family protein	NA	NA	NA	NA	NA
WP_084865641.1|3373695_3374898_-|transposase	ISL3-like element ISAeme19 family transposase	transposase	A9YX10	Burkholderia_phage	53.2	1.4e-102
WP_161507819.1|3374976_3376191_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.5	8.7e-49
>prophage 22
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	3499880	3549170	4710838	tRNA,transposase	Bacillus_phage(28.57%)	48	NA	NA
WP_021141311.1|3499880_3501017_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_005330785.1|3501162_3501603_-	flavodoxin	NA	NA	NA	NA	NA
WP_041206262.1|3501788_3502535_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_025327927.1|3502605_3502941_-	YqcC family protein	NA	NA	NA	NA	NA
WP_005330776.1|3503152_3504181_+	DUF3549 family protein	NA	NA	NA	NA	NA
WP_041206263.1|3504252_3504549_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_005330771.1|3504615_3504852_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_041207059.1|3505044_3505341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005330766.1|3505350_3506136_+	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_041206264.1|3506228_3506777_-	SecY-interacting protein	NA	NA	NA	NA	NA
WP_041206265.1|3506882_3507731_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HGP3	Vibrio_phage	36.7	1.6e-41
WP_005330744.1|3507845_3510116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005330743.1|3510201_3511797_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.6	4.3e-19
WP_041206266.1|3511955_3513311_+	LOG family protein	NA	NA	NA	NA	NA
WP_005330737.1|3513443_3514253_+	flap endonuclease Xni	NA	U5PWU8	Bacillus_phage	29.1	1.2e-14
WP_005330735.1|3514395_3515403_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_005330733.1|3515522_3515966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206267.1|3516048_3517143_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_041206268.1|3517135_3517522_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_005330730.1|3517556_3518195_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_025327944.1|3518199_3519120_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_041204928.1|3520082_3521210_+|transposase	ISAs1-like element ISKpn9 family transposase	transposase	NA	NA	NA	NA
WP_005330722.1|3522898_3523951_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_005330720.1|3524152_3524365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005330718.1|3524438_3524663_-	(Na+)-NQR maturation NqrM	NA	NA	NA	NA	NA
WP_111909910.1|3524765_3525809_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_103244418.1|3525812_3527036_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit F	NA	NA	NA	NA	NA
WP_005330713.1|3527053_3527650_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit E	NA	NA	NA	NA	NA
WP_005330711.1|3527653_3528286_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit D	NA	NA	NA	NA	NA
WP_025327949.1|3528278_3529067_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_005330707.1|3529056_3530286_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit B	NA	NA	NA	NA	NA
WP_161507458.1|3530289_3531633_-	Na(+)-translocating NADH-quinone reductase subunit A	NA	NA	NA	NA	NA
WP_041204526.1|3532072_3532381_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_041206273.1|3532600_3533734_+	methyltransferase	NA	NA	NA	NA	NA
WP_042649552.1|3533746_3534319_+	lipoprotein	NA	NA	NA	NA	NA
WP_161507459.1|3534334_3534886_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	30.9	2.0e-08
WP_161507460.1|3535001_3535331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507461.1|3535416_3536820_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_139751339.1|3536976_3537819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206278.1|3537922_3538405_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_161507462.1|3538619_3539567_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_161507463.1|3539603_3540164_+	DJ-1 family protein	NA	NA	NA	NA	NA
WP_161506736.1|3540732_3541488_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.9	6.8e-60
WP_041206683.1|3541502_3543044_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
WP_161507464.1|3543902_3545106_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.5	2.0e-114
WP_041204923.1|3545169_3546312_-|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_161507465.1|3546509_3547208_-	DUF2931 family protein	NA	NA	NA	NA	NA
WP_004576012.1|3547751_3549170_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	3592766	3663432	4710838	transposase	Escherichia_phage(28.57%)	58	NA	NA
WP_005323562.1|3592766_3593684_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	2.6e-101
WP_012564931.1|3593776_3594724_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_019706001.1|3594810_3595758_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_161507864.1|3595901_3596459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507490.1|3596863_3597826_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_005328684.1|3597942_3599043_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.2	4.7e-25
WP_041206300.1|3599115_3599943_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_050504416.1|3599944_3600835_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_005328673.1|3600901_3602185_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_161507491.1|3602251_3603328_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_161507492.1|3603630_3603798_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_161507865.1|3603842_3604166_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_161507493.1|3604162_3605032_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_081934583.1|3605305_3606946_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_042649267.1|3607195_3608257_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_005328663.1|3608273_3608429_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005328660.1|3608448_3609237_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	52.0	2.1e-64
WP_042649266.1|3609492_3610401_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	70.9	2.6e-106
WP_161507494.1|3610397_3611651_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.4	6.3e-127
WP_005328654.1|3611643_3612276_+	aldolase	NA	A0A077SK32	Escherichia_phage	68.4	1.5e-76
WP_161507495.1|3612337_3613111_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_042650707.1|3613151_3614102_+	SDR family oxidoreductase	NA	Q76TT0	Molluscum_contagiosum_virus	27.8	5.9e-08
WP_005328642.1|3614098_3615604_+	gluconate permease	NA	NA	NA	NA	NA
WP_161507496.1|3615689_3616580_+	DMT family transporter	NA	NA	NA	NA	NA
WP_042649124.1|3616639_3618571_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	3.6e-12
WP_161507497.1|3619184_3620585_+	OprD family porin	NA	NA	NA	NA	NA
WP_042649126.1|3620700_3621531_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_042649127.1|3621647_3621980_-	DUF1904 family protein	NA	NA	NA	NA	NA
WP_161507498.1|3622050_3622932_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_081805766.1|3623099_3623249_+	DUF3149 domain-containing protein	NA	NA	NA	NA	NA
WP_042649129.1|3623359_3623941_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_042649130.1|3624047_3625526_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_042649131.1|3625676_3627197_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_042649132.1|3627193_3627670_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	57.1	9.7e-20
WP_041206310.1|3628016_3628391_+	cupin	NA	NA	NA	NA	NA
WP_042649133.1|3628580_3628838_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_042649134.1|3628884_3629214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042649135.1|3629337_3631185_-	U32 family peptidase	NA	Q6DW11	Phage_TP	41.4	2.5e-15
WP_042649136.1|3631429_3632041_-	LysE family translocator	NA	NA	NA	NA	NA
WP_042649137.1|3632169_3633123_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042649138.1|3633327_3634416_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_042649139.1|3635113_3635389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507499.1|3635576_3636314_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_042649141.1|3636780_3638142_+	succinyl-CoA synthetase subunit alpha	NA	NA	NA	NA	NA
WP_042649142.1|3638198_3641306_-	tetrathionate reductase subunit TtrA	NA	NA	NA	NA	NA
WP_042649143.1|3641305_3642412_-	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_042649144.1|3642401_3643190_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_161507866.1|3643450_3645400_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_139750961.1|3645396_3646008_+	response regulator	NA	NA	NA	NA	NA
WP_042648531.1|3646147_3646888_+	dipeptidase PepE	NA	NA	NA	NA	NA
WP_042648532.1|3646990_3648382_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_161507500.1|3648784_3649222_-	VOC family protein	NA	NA	NA	NA	NA
WP_107961366.1|3653105_3654251_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_041205253.1|3654995_3656333_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_161507501.1|3656638_3657712_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	26.9	4.3e-23
WP_005330482.1|3658008_3659403_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	71.5	8.5e-181
WP_005330485.1|3659829_3660684_+	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_004576012.1|3662013_3663432_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	3694795	3757903	4710838	tRNA,protease,transposase	Vibrio_phage(14.29%)	57	NA	NA
WP_005323562.1|3694795_3695713_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	2.6e-101
WP_041206321.1|3697105_3698080_+	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_005329152.1|3698105_3698660_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_025328092.1|3698699_3699104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005329149.1|3699174_3699732_-	heme utilization protein HutZ	NA	NA	NA	NA	NA
WP_005329147.1|3699728_3700241_-	heme utilization cystosolic carrier protein HutX	NA	NA	NA	NA	NA
WP_005329145.1|3700409_3701249_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005329142.1|3701245_3702277_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_041206322.1|3702292_3703093_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	2.3e-13
WP_005329125.1|3703342_3703951_-	YitT family protein	NA	NA	NA	NA	NA
WP_041206324.1|3704254_3705616_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.0	3.3e-81
WP_005329119.1|3705612_3706611_+	NAD-dependent epimerase	NA	A0A1V0SKV4	Klosneuvirus	30.8	5.7e-30
WP_041206327.1|3706694_3708383_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_041206328.1|3708372_3708738_-	membrane protein	NA	NA	NA	NA	NA
WP_005329116.1|3708826_3709567_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	26.5	1.5e-06
WP_139751352.1|3709915_3710764_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	44.1	9.2e-21
WP_005329110.1|3711095_3712763_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.9e-39
WP_005329107.1|3713031_3713367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206332.1|3713628_3714984_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	38.0	7.9e-67
WP_005327208.1|3715051_3715870_-	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_041206335.1|3715889_3716558_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_041206336.1|3716554_3717583_-	phosphotransferase	NA	NA	NA	NA	NA
WP_005327225.1|3717757_3720190_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_005327228.1|3720220_3721513_+	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_041207076.1|3721527_3722523_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_041206338.1|3722512_3723340_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_041206340.1|3723344_3723707_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_005327236.1|3723713_3724535_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R4ALP3	Aeromonas_phage	42.5	6.2e-06
WP_004575061.1|3724798_3726136_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_161507503.1|3726201_3726528_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041206342.1|3726698_3727688_-	luciferase-like monooxygenase	NA	NA	NA	NA	NA
WP_041206344.1|3727919_3730805_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_041206346.1|3730874_3732245_-	YjiH family protein	NA	NA	NA	NA	NA
WP_005327243.1|3732613_3733819_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_005911261.1|3734008_3734266_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_005304210.1|3734283_3734595_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_161507504.1|3734837_3735809_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	23.3	3.3e-06
WP_005327246.1|3735901_3736090_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_041206348.1|3736175_3737060_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_041206349.1|3737063_3738212_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_005327255.1|3738294_3739581_-	GTPase HflX	NA	NA	NA	NA	NA
WP_011704864.1|3739644_3739908_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_081805770.1|3739980_3740913_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_005327259.1|3740994_3742866_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.6	4.6e-57
WP_041206350.1|3743046_3744582_-	AMIN domain-containing protein	NA	A0A059WLJ5	Vibrio_phage	30.4	6.1e-15
WP_041206351.1|3744572_3745046_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_041206352.1|3745063_3746566_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_005327306.1|3746698_3747853_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_005327307.1|3747936_3748680_+	ROK family protein	NA	NA	NA	NA	NA
WP_005327308.1|3748734_3749190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206353.1|3749672_3750716_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	36.9	4.0e-34
WP_005327310.1|3750774_3751428_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005327312.1|3751454_3752255_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_041205253.1|3752372_3753710_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005331636.1|3753795_3754296_+	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
WP_161507505.1|3754453_3756406_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.4	1.5e-13
WP_103244595.1|3756474_3757903_+|transposase	IS66-like element ISAeme23 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	3762812	3842393	4710838	tRNA,transposase	Bacillus_phage(25.0%)	57	NA	NA
WP_004576012.1|3762812_3764231_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_021141311.1|3764581_3765718_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_012564931.1|3765923_3766871_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_099993964.1|3767091_3768108_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_041204891.1|3768313_3769450_+|transposase	ISAs1-like element ISAeme1 family transposase	transposase	NA	NA	NA	NA
WP_041205079.1|3770451_3771960_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_005328224.1|3772234_3773161_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_005328233.1|3773339_3774581_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_041205080.1|3774714_3775914_-	acetate kinase	NA	NA	NA	NA	NA
WP_041205081.1|3776240_3776711_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_041205083.1|3777011_3778118_-	acyltransferase	NA	NA	NA	NA	NA
WP_041205084.1|3778933_3779494_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005327028.1|3779843_3781610_+	hemagglutinin	NA	NA	NA	NA	NA
WP_041204928.1|3782122_3783250_-|transposase	ISAs1-like element ISKpn9 family transposase	transposase	NA	NA	NA	NA
WP_041205087.1|3784057_3785251_+	multidrug efflux MFS transporter MdtH	NA	NA	NA	NA	NA
WP_148304728.1|3785453_3791939_-	type I secretion C-terminal target domain-containing protein	NA	NA	NA	NA	NA
WP_004576012.1|3791830_3793249_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_005327944.1|3794998_3796660_-	putative transporter	NA	NA	NA	NA	NA
WP_041205078.1|3796778_3797414_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_005327951.1|3797645_3799178_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_005327953.1|3799312_3799864_+	septation protein A	NA	NA	NA	NA	NA
WP_005327955.1|3799887_3800184_+	YciI family protein	NA	NA	NA	NA	NA
WP_005327957.1|3800275_3801031_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_005327958.1|3801196_3801517_+	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_041205077.1|3801611_3802523_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.9	2.0e-61
WP_041205076.1|3802736_3804134_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	38.8	1.4e-79
WP_005327964.1|3804206_3805178_-	response regulator	NA	NA	NA	NA	NA
WP_041206814.1|3805491_3806166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205075.1|3806232_3807087_+	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	28.4	6.2e-09
WP_005327970.1|3807213_3807849_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005327972.1|3807927_3809133_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005327974.1|3809129_3810266_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005327977.1|3810265_3811270_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_041205074.1|3811343_3812750_-	TolC family protein	NA	NA	NA	NA	NA
WP_041205073.1|3813042_3814008_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005309538.1|3814033_3814330_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005327991.1|3814418_3815051_-	LysE family translocator	NA	NA	NA	NA	NA
WP_161507506.1|3815183_3816815_+|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
WP_161469620.1|3816753_3817780_-|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	67.4	2.1e-11
WP_025328177.1|3823951_3824302_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.5	6.7e-26
WP_041205072.1|3824391_3825084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205071.1|3825171_3826566_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_161507507.1|3826788_3828075_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_005327593.1|3828285_3829110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327590.1|3829341_3830247_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005327588.1|3830493_3831210_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_041205070.1|3831419_3831935_+	DUF2937 family protein	NA	NA	NA	NA	NA
WP_041205069.1|3831989_3832871_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041205067.1|3833029_3833422_+	multidrug transporter	NA	NA	NA	NA	NA
WP_005327579.1|3833409_3833730_+	multidrug transporter	NA	NA	NA	NA	NA
WP_005327577.1|3833800_3834211_-	VOC family protein	NA	NA	NA	NA	NA
WP_005327576.1|3834253_3836575_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_139751514.1|3836839_3839287_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	27.8	2.2e-27
WP_005327573.1|3839523_3840069_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_005327571.1|3840065_3840803_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_005329052.1|3840928_3841378_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_041206812.1|3841490_3842393_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
>prophage 26
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	3890019	3902226	4710838	tRNA,transposase	uncultured_Mediterranean_phage(22.22%)	12	NA	NA
WP_081805626.1|3890019_3891885_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
WP_005331907.1|3892098_3893886_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.4	4.0e-74
WP_005331908.1|3893974_3894418_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	2.0e-27
WP_005309452.1|3894433_3894649_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005331910.1|3894828_3895842_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	3.1e-108
WP_005331913.1|3895929_3896913_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.7	4.9e-34
WP_161506916.1|3896946_3897894_-|transposase	IS481-like element ISAeme21 family transposase	transposase	NA	NA	NA	NA
WP_099993964.1|3898014_3899031_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_041205045.1|3899190_3900255_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	36.2	4.9e-11
WP_041205044.1|3900264_3900846_-	DedA family protein	NA	NA	NA	NA	NA
WP_005332743.1|3900842_3901460_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	2.4e-34
WP_005332745.1|3901464_3902226_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.4	3.3e-70
>prophage 27
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	4175938	4233664	4710838	protease,transposase	Bacillus_phage(28.57%)	50	NA	NA
WP_161507590.1|4175938_4177282_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_025328542.1|4177393_4177918_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_161506878.1|4178057_4179023_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_161507591.1|4179040_4182124_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_161469620.1|4182399_4183425_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	67.4	2.1e-11
WP_025328544.1|4183444_4183762_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_005327754.1|4189846_4191043_+	NnrS family protein	NA	NA	NA	NA	NA
WP_005327753.1|4191046_4191616_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161507592.1|4191731_4192883_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_161507593.1|4193030_4194095_+	DUF3103 family protein	NA	NA	NA	NA	NA
WP_025325515.1|4194215_4194686_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_161507594.1|4194846_4195365_+	protein tyrosine phosphatase	NA	NA	NA	NA	NA
WP_005327747.1|4195447_4196395_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_041204871.1|4196539_4197778_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_005327739.1|4197805_4198969_+	competence protein CinA	NA	NA	NA	NA	NA
WP_005327731.1|4198976_4199492_-	membrane protein	NA	A0A127AVX7	Bacillus_phage	40.9	4.3e-05
WP_161507872.1|4199932_4201561_+	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_043130614.1|4201675_4202485_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_161507595.1|4202850_4203621_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A2P9FI75	Pseudomonas_phage	29.3	5.8e-06
WP_005327724.1|4203617_4204022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507596.1|4204114_4204825_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_041206763.1|4204871_4205828_-	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	30.4	6.5e-15
WP_161507597.1|4205820_4206501_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_025325502.1|4206656_4207487_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_161507598.1|4207583_4208834_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_025325500.1|4208854_4209061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005330957.1|4209134_4209449_+	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_042649021.1|4209463_4210117_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005330961.1|4210194_4212714_-	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_041207133.1|4213036_4213966_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_161507873.1|4214012_4214747_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_161507599.1|4214743_4215820_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005330966.1|4215830_4216994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043130633.1|4217168_4217420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206766.1|4217589_4218600_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_161507600.1|4218818_4219877_+	porin	NA	NA	NA	NA	NA
WP_161507601.1|4219963_4220443_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_161507602.1|4220721_4222764_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_161507874.1|4222829_4223450_+	peptidase	NA	NA	NA	NA	NA
WP_161507603.1|4223623_4224661_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_161507604.1|4224632_4225010_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161507605.1|4225131_4225437_+	monooxygenase	NA	NA	NA	NA	NA
WP_161507606.1|4225444_4225942_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_161507607.1|4225987_4226602_-	porin family protein	NA	NA	NA	NA	NA
WP_025325483.1|4226827_4227466_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_025325482.1|4227575_4228466_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.6	4.9e-17
WP_012564931.1|4228929_4229877_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_161507608.1|4230241_4230829_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_099369027.1|4231164_4232181_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	4.9e-186
WP_011191341.1|4232389_4233664_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP047962	Aeromonas media strain MC64 chromosome, complete genome	4710838	4538920	4656152	4710838	holin,protease,tRNA,transposase	Vibrio_phage(10.53%)	100	NA	NA
WP_161469620.1|4538920_4539947_-|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	67.4	2.1e-11
WP_161507744.1|4540057_4541323_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_161507745.1|4541324_4542422_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_161507746.1|4542635_4543424_+	glycosyltransferase family 2 protein	NA	A0A1C3NFH8	Phage_NCTB	36.8	1.7e-05
WP_161507747.1|4543482_4544526_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_005323744.1|4544748_4545231_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.9	4.0e-29
WP_161507882.1|4545307_4546186_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_161507748.1|4546363_4547176_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	28.5	2.3e-21
WP_042648922.1|4547203_4547659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005323752.1|4547753_4547921_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_005307492.1|4547932_4548169_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_042648929.1|4548305_4548980_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_041206610.1|4549127_4550330_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	1.2e-42
WP_005323758.1|4550455_4550914_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	65.1	5.4e-52
WP_005323760.1|4550985_4551582_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_005323762.1|4551755_4552592_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_005323764.1|4552722_4552911_-|holin	holin	holin	NA	NA	NA	NA
WP_161507749.1|4553329_4554979_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_041205828.1|4555031_4556369_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_161507750.1|4556572_4558054_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005323770.1|4558278_4559172_+	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_005323772.1|4559274_4559466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507751.1|4559557_4562131_+	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_161507752.1|4567842_4568367_-	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_043128965.1|4568374_4569832_-	potassium transporter	NA	NA	NA	NA	NA
WP_161507753.1|4569868_4570486_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.9	3.2e-23
WP_161507754.1|4570485_4571808_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_161507755.1|4572004_4573942_+	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_161507756.1|4574146_4576294_+	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_161507757.1|4576315_4577479_+	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_005323928.1|4577762_4578485_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_043128973.1|4578555_4580001_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_041206710.1|4580006_4581263_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005323922.1|4581308_4581500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206709.1|4581781_4582027_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	72.2	2.8e-07
WP_161507758.1|4582048_4582393_+	RidA family protein	NA	NA	NA	NA	NA
WP_161507759.1|4582539_4583196_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_005323913.1|4583361_4583604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005323912.1|4583724_4583979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507760.1|4584061_4584334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043129211.1|4584378_4584633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507761.1|4584623_4584863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507762.1|4584953_4585523_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_161507763.1|4585732_4586659_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_161507764.1|4586668_4588738_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_161507765.1|4588950_4589901_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161507766.1|4590230_4590797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507767.1|4591460_4592684_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161507883.1|4593228_4594365_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099368881.1|4594486_4595503_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_161507768.1|4595822_4597034_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_005330036.1|4597151_4597493_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_161507769.1|4597544_4598711_-	NADH:flavorubredoxin reductase NorW	NA	NA	NA	NA	NA
WP_161507770.1|4598707_4600189_-	anaerobic nitric oxide reductase flavorubredoxin	NA	NA	NA	NA	NA
WP_161507771.1|4600360_4601884_+	nitric oxide reductase transcriptional regulator NorR	NA	NA	NA	NA	NA
WP_041205828.1|4601955_4603293_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005330032.1|4603414_4604419_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	32.2	2.3e-31
WP_041206698.1|4604854_4605976_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005330030.1|4606040_4606967_+	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_161507772.1|4606963_4608232_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_043132444.1|4608228_4609014_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.8	4.2e-12
WP_005330014.1|4609024_4609726_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.2	1.5e-16
WP_161507773.1|4609728_4610574_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_161507884.1|4610552_4611122_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005330007.1|4611313_4611637_+	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_161507885.1|4611666_4612500_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_161507886.1|4612608_4615011_-	lipase	NA	NA	NA	NA	NA
WP_041206692.1|4615326_4615584_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_004575061.1|4615642_4616980_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005328900.1|4617204_4617903_-	NAD(P)H-flavin reductase	NA	NA	NA	NA	NA
WP_025328827.1|4618058_4619528_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_161507774.1|4619561_4620566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206691.1|4620673_4621939_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_025328829.1|4622145_4622472_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	42.3	4.8e-18
WP_161507775.1|4622585_4623875_+	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	26.2	3.1e-36
WP_005328890.1|4623888_4625379_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_161507776.1|4625581_4626568_+	DUF4382 domain-containing protein	NA	NA	NA	NA	NA
WP_005328887.1|4626598_4626853_+	modulator protein	NA	NA	NA	NA	NA
WP_041207127.1|4626926_4627679_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_161507777.1|4627739_4630307_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	31.5	1.8e-19
WP_161507778.1|4630547_4632590_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	20.6	3.5e-34
WP_161507779.1|4632811_4633831_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_161507780.1|4633834_4634620_-	hydrolase TatD	NA	NA	NA	NA	NA
WP_005328872.1|4634731_4635487_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_161507781.1|4635483_4635927_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_025328841.1|4635930_4636179_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
WP_161507782.1|4636219_4637860_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	G9E4X0	Ostreococcus_lucimarinus_virus	30.0	2.0e-35
WP_161507783.1|4637859_4638468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206685.1|4638476_4639229_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_005328863.1|4639294_4639672_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	37.2	4.4e-07
WP_161507784.1|4639761_4641027_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_161507785.1|4641020_4642265_-	cytosine permease	NA	NA	NA	NA	NA
WP_161469620.1|4642363_4643389_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	67.4	2.1e-11
WP_161507786.1|4649400_4650579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507787.1|4650581_4651244_-	TonB family protein	NA	NA	NA	NA	NA
WP_005326222.1|4651240_4651642_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_025328851.1|4651638_4652169_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_161507788.1|4652165_4653461_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_161507789.1|4653457_4654219_-	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_021141311.1|4655015_4656152_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP047963	Aeromonas media strain MC64 plasmid pMC64A, complete sequence	283486	5535	61810	283486	transposase	Enterobacteria_phage(12.0%)	44	NA	NA
WP_013213985.1|5535_6516_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_001217881.1|6638_7196_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_161507889.1|7358_7559_+	DUF4158 domain-containing protein	NA	Q1MVP5	Enterobacteria_phage	100.0	2.8e-21
WP_041204923.1|7529_8672_-|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_021141311.1|9727_10864_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_161507890.1|13560_14745_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	25.2	1.5e-05
WP_099368947.1|14979_16067_-|transposase	IS3-like element ISKpn10 family transposase	transposase	S5WIU1	Leptospira_phage	36.0	3.8e-43
WP_161507891.1|16388_17426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507892.1|17524_18697_+	nuclease	NA	A0A2R2ZH57	Clostridioides_phage	27.5	5.2e-22
WP_021141233.1|19485_19890_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.4	8.5e-33
WP_021141234.1|19947_21174_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_161507893.1|21493_22393_-	DNA/RNA non-specific endonuclease	NA	A0A1V0SA52	Catovirus	30.8	2.7e-07
WP_114523319.1|22472_24263_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	22.9	3.7e-19
WP_114523111.1|25413_26502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507894.1|26613_27669_+	AAA domain-containing protein	NA	A0A1Y0SVK5	Sinorhizobium_phage	28.5	2.1e-06
WP_161507895.1|27931_28894_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_161507896.1|28955_30878_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_114523107.1|31084_32155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507897.1|32168_32684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507898.1|32785_32932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507899.1|33269_33626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507900.1|33742_34849_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_161507901.1|34989_35133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041204891.1|35124_36261_-|transposase	ISAs1-like element ISAeme1 family transposase	transposase	NA	NA	NA	NA
WP_041206863.1|36713_37853_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	68.7	7.2e-146
WP_041205574.1|37910_38336_+|transposase	IS200/IS605-like element ISAeme8 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.9	4.9e-23
WP_114523103.1|38692_38962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012564931.1|39230_40178_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_001809438.1|40404_41436_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_161508001.1|41526_42540_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	42.5	4.0e-71
WP_161507902.1|42714_43266_-	hypothetical protein	NA	A0A1S6UB21	Serratia_phage	50.9	2.1e-05
WP_161507903.1|43292_44150_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	45.6	1.3e-54
WP_161507904.1|44429_45380_+|transposase	IS1595-like element ISAeca5 family transposase	transposase	NA	NA	NA	NA
WP_161508002.1|45386_46580_+|transposase	ISL3-like element ISAeme19 family transposase	transposase	A9YX10	Burkholderia_phage	53.2	1.3e-102
WP_161508003.1|47381_47825_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	5.5e-33
WP_161507905.1|47805_49065_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	53.7	3.1e-121
WP_161508004.1|49334_49823_+	single-stranded DNA-binding protein	NA	A0A2I7RML0	Vibrio_phage	66.1	1.4e-45
WP_161507906.1|49890_50706_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_161507907.1|51069_53301_-	hypothetical protein	NA	A0A127AW80	Bacillus_phage	22.3	9.2e-28
WP_161507908.1|53516_54467_+|transposase	IS1595-like element ISAeca5 family transposase	transposase	NA	NA	NA	NA
WP_161507909.1|54862_56416_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.8	9.9e-122
WP_161507910.1|56438_57194_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.0	1.8e-52
WP_161507819.1|57325_58540_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.5	8.7e-49
WP_041205384.1|60712_61810_+|transposase	ISAs1-like element ISAeme2 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP047963	Aeromonas media strain MC64 plasmid pMC64A, complete sequence	283486	76514	134253	283486	transposase	Escherichia_phage(25.0%)	49	NA	NA
WP_052814785.1|76514_78125_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	32.7	2.8e-58
WP_042012890.1|78174_78540_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_042012893.1|78539_78848_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_161507926.1|80921_81176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507927.1|81375_82602_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.9	7.7e-154
WP_011191341.1|83759_85034_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_114523099.1|85683_86043_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	38.4	8.1e-19
WP_161507928.1|86039_87311_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	45.8	7.1e-102
WP_161507929.1|87422_87887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507930.1|87971_88376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052814785.1|88522_90133_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	32.7	2.8e-58
WP_042012890.1|90182_90548_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_042012893.1|90547_90856_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_143237393.1|90993_92082_+|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_161507931.1|92033_94334_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_011191341.1|94433_95708_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_161507932.1|95772_96270_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_114523095.1|96281_97616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507933.1|97615_98647_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_161507934.1|98932_99388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119197661.1|99466_100693_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.9	7.7e-154
WP_161507935.1|100750_101155_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	52.0	1.8e-30
WP_161507936.1|101180_101468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114523092.1|101767_102811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114523091.1|102803_103175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507814.1|104274_105546_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161507937.1|107605_108253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041204923.1|108315_109458_-|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_161507938.1|109544_109832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507939.1|109992_110904_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_161507940.1|110900_113756_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	40.2	1.2e-184
WP_161507941.1|113752_114880_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	24.2	1.0e-14
WP_161507942.1|114876_115521_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_161507943.1|115538_116042_+	site-specific DNA-methyltransferase	NA	A0A0M7Q8J6	Escherichia_phage	60.8	7.5e-47
WP_161507944.1|116152_117088_+	hypothetical protein	NA	A0A0K1LNZ9	Escherichia_phage	61.3	2.7e-34
WP_004576012.1|117350_118769_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_052815201.1|119069_120323_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.6	8.3e-95
WP_161507945.1|121765_124618_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_161507946.1|124996_125473_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_161507947.1|125599_125923_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_161507948.1|125959_126493_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_161507949.1|126508_127369_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_161507950.1|127358_127796_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_161507951.1|127845_128187_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_161507952.1|128216_129926_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_161507953.1|129961_130945_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_161507954.1|131327_131861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507955.1|131835_132156_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_041206016.1|132984_134253_+|transposase	IS4-like element ISAeme4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP047963	Aeromonas media strain MC64 plasmid pMC64A, complete sequence	283486	140688	189583	283486	transposase	Enterobacteria_phage(30.43%)	50	NA	NA
WP_041205447.1|140688_141855_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	67.9	7.4e-146
WP_114523085.1|142411_142696_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_114523084.1|142697_143030_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_114523075.1|144896_145211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507960.1|145680_145824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507961.1|147023_147368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141233.1|147447_147852_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.4	8.5e-33
WP_041206018.1|147909_149136_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	1.3e-153
WP_084865641.1|149298_150501_-|transposase	ISL3-like element ISAeme19 family transposase	transposase	A9YX10	Burkholderia_phage	53.2	1.4e-102
WP_114522800.1|150646_150937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147273898.1|151043_151469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507962.1|151868_152870_-	ParB N-terminal domain-containing protein	NA	O64340	Escherichia_phage	28.4	6.6e-10
WP_114522803.1|152869_154102_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	30.7	6.2e-34
WP_114522804.1|154403_154742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507963.1|155124_155367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206863.1|155453_156593_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	68.7	7.2e-146
WP_041205574.1|156650_157076_+|transposase	IS200/IS605-like element ISAeme8 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.9	4.9e-23
WP_161507964.1|157072_157609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147273899.1|157868_159821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507927.1|160622_161849_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.9	7.7e-154
WP_147273900.1|162411_162930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205447.1|163107_164274_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	67.9	7.4e-146
WP_114522808.1|164819_165161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205447.1|165259_166426_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	67.9	7.4e-146
WP_114522809.1|166666_167305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114522810.1|167316_167934_+	single-stranded DNA-binding protein	NA	A0A2I7RHA9	Vibrio_phage	67.2	1.2e-43
WP_161507927.1|168167_169394_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.9	7.7e-154
WP_114522813.1|170861_171218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507927.1|171317_172544_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.9	7.7e-154
WP_021141233.1|172601_173006_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.4	8.5e-33
WP_114522814.1|173093_173654_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_161507965.1|174157_175477_-	hypothetical protein	NA	V5YTC9	Pseudomonas_phage	26.5	2.4e-20
WP_147273901.1|175553_176267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507966.1|176675_177401_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_114522818.1|177397_177919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114522819.1|178078_178321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114522820.1|178484_178805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114522821.1|178789_179515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130627553.1|179727_180378_-	Qnr family pentapeptide repeat protein	NA	NA	NA	NA	NA
WP_130627552.1|180514_180946_-	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	43.3	1.0e-23
WP_084865641.1|181136_182339_+|transposase	ISL3-like element ISAeme19 family transposase	transposase	A9YX10	Burkholderia_phage	53.2	1.4e-102
WP_114522822.1|182468_182684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114522781.1|182956_183361_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	53.6	3.2e-32
WP_119197661.1|183418_184645_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.9	7.7e-154
WP_161507967.1|184689_184956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507968.1|185123_185543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507969.1|185539_186619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507970.1|186801_187869_+	DUF4942 domain-containing protein	NA	A0A2I7RNS1	Vibrio_phage	35.3	6.4e-11
WP_021141233.1|187894_188299_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.4	8.5e-33
WP_021141234.1|188356_189583_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
>prophage 4
NZ_CP047963	Aeromonas media strain MC64 plasmid pMC64A, complete sequence	283486	208246	267977	283486	transposase,integrase	Escherichia_phage(11.76%)	47	222400:222421	256360:256381
WP_021141311.1|208246_209383_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_107979024.1|209660_210140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507980.1|210102_211740_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_101618122.1|211928_213203_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_101618123.1|213261_215262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102948393.1|215886_217091_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	4.5e-114
WP_021141311.1|217952_219089_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_058671242.1|219531_220338_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_005342491.1|220426_221377_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
222400:222421	attL	GGGGTCGTCTCAGAAAACGGAA	NA	NA	NA	NA
WP_161508006.1|222676_223579_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_019706001.1|223678_224626_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_000184001.1|224996_226202_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|226212_226518_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|226744_227509_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|228001_228586_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|228585_229824_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|229820_230726_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|230847_231552_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_113736295.1|231816_233368_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000557454.1|233453_234314_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|234326_234869_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|235350_235542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|235565_235793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|235843_236980_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|236946_237096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|237094_238465_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342213.1|238606_238732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|239285_240146_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_161507981.1|240308_241355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206683.1|242354_243896_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
WP_161506736.1|243910_244666_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.9	6.8e-60
WP_021141311.1|246364_247501_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_041206016.1|247748_249017_+|transposase	IS4-like element ISAeme4 family transposase	transposase	NA	NA	NA	NA
WP_114523317.1|249687_250095_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_161507982.1|250427_250589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114523314.1|250829_251132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161507983.1|251185_252247_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7QY74	Vibrio_phage	32.9	1.2e-38
WP_161507927.1|252790_254017_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.9	7.7e-154
WP_042650430.1|254412_255666_-|transposase	IS256-like element ISAeme25 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	47.2	7.0e-94
WP_161507984.1|255973_256396_+	sel1 repeat family protein	NA	NA	NA	NA	NA
256360:256381	attR	GGGGTCGTCTCAGAAAACGGAA	NA	NA	NA	NA
WP_161507985.1|257817_258024_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.0	1.3e-13
WP_161507986.1|258046_259684_+	ATP-dependent DNA helicase	NA	A0A1B3AYT3	Gordonia_phage	26.7	7.7e-16
WP_161507987.1|259899_261459_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.1	1.0e-102
WP_161507988.1|261455_262496_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	58.4	1.6e-112
WP_161507989.1|262492_263683_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	50.9	8.0e-39
WP_161507990.1|263850_264882_+	cell filamentation protein Fic	NA	Q9JMN3	Wolbachia_phage	50.2	7.6e-86
WP_161507991.1|264878_267977_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.5	2.2e-24
>prophage 1
NZ_CP047964	Aeromonas media strain MC64 plasmid pMC64B, complete sequence	24044	0	5426	24044		Salmonella_phage(50.0%)	4	NA	NA
WP_001162010.1|2051_2609_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
WP_042201119.1|2739_4227_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003056106.1|4213_4687_-	cytochrome c	NA	NA	NA	NA	NA
WP_004393997.1|4715_5426_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
>prophage 2
NZ_CP047964	Aeromonas media strain MC64 plasmid pMC64B, complete sequence	24044	9998	13531	24044		uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_042044880.1|9998_10628_-	AAA family ATPase	NA	K7R2R7	Vibrio_phage	51.2	4.5e-49
WP_161508013.1|10915_10999_-	ParA family protein	NA	NA	NA	NA	NA
WP_101617265.1|11203_11491_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_101617266.1|11478_11772_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_161508008.1|12620_12962_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_113722067.1|13011_13299_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	75.8	3.0e-32
WP_026080514.1|13288_13531_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	58.8	1.9e-19
