The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017146	Marisediminicola antarctica strain ZS314 chromosome, complete genome	3352609	797018	804399	3352609	tRNA	Listeria_phage(16.67%)	7	NA	NA
WP_161885247.1|797018_798317_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	46.5	3.4e-14
WP_161885248.1|798570_799065_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	51.4	7.2e-34
WP_161885249.1|799157_800216_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_161885250.1|800235_800790_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	32.4	2.6e-08
WP_161885251.1|800911_802909_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	G8DDJ2	Micromonas_pusilla_virus	44.6	1.7e-105
WP_161885252.1|802913_803489_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	45.1	1.5e-35
WP_161887330.1|803619_804399_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	34.0	3.3e-25
>prophage 2
NZ_CP017146	Marisediminicola antarctica strain ZS314 chromosome, complete genome	3352609	1857011	1932211	3352609	integrase,transposase,protease,tRNA	Bacillus_virus(16.67%)	58	1921613:1921648	1933130:1933165
WP_161885076.1|1857011_1858061_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_161886103.1|1858479_1860384_-	DUF222 domain-containing protein	NA	NA	NA	NA	NA
WP_161886104.1|1864917_1865091_-	DUF2510 domain-containing protein	NA	NA	NA	NA	NA
WP_161886105.1|1865303_1867424_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_161886106.1|1867484_1868036_-	CGNR zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_161886107.1|1868108_1869065_+	EamA family transporter	NA	NA	NA	NA	NA
WP_161886108.1|1869091_1869412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161886109.1|1869778_1871146_+	trigger factor	NA	NA	NA	NA	NA
WP_161886110.1|1871130_1872015_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_161886111.1|1872094_1873303_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_161886112.1|1874066_1874735_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	44.4	1.2e-39
WP_161886113.1|1874827_1875544_-	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_161886114.1|1875721_1876996_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.2	3.4e-136
WP_161887448.1|1877020_1878196_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_161886115.1|1878301_1879315_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_161886116.1|1879363_1879768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161886117.1|1879764_1881810_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_161886118.1|1881836_1883093_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_161886119.1|1883220_1883469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161886120.1|1883523_1884174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161886121.1|1884173_1886777_-|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	37.8	3.9e-163
WP_161886122.1|1887007_1888975_-	DUF222 domain-containing protein	NA	NA	NA	NA	NA
WP_161886123.1|1889355_1890171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161886124.1|1891205_1891829_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161886125.1|1891905_1893549_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161887449.1|1893695_1894514_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_161886126.1|1894510_1895356_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_161886127.1|1895352_1896915_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.5e-13
WP_161886128.1|1896914_1898183_+	amino acid permease	NA	NA	NA	NA	NA
WP_161886129.1|1898269_1899178_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161887450.1|1899220_1900153_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_161886130.1|1900152_1901460_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.5	2.6e-30
WP_161886131.1|1902095_1905401_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9V7W4	Bandra_megavirus	34.0	4.8e-158
WP_161886132.1|1905348_1906785_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_161886133.1|1906781_1907195_+	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_161886134.1|1907191_1907611_+	nucleoside-diphosphate kinase	NA	A0A2K9L0Y6	Tupanvirus	46.3	1.8e-25
WP_161887451.1|1907607_1908318_-	vitamin K epoxide reductase family protein	NA	NA	NA	NA	NA
WP_161886135.1|1908586_1911349_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_161886136.1|1911389_1912496_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_161886137.1|1912610_1912886_-	DUF4031 domain-containing protein	NA	NA	NA	NA	NA
WP_161886138.1|1913128_1913437_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_161886139.1|1913467_1913737_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_161886140.1|1913878_1915432_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_161886141.1|1915440_1916259_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	46.3	2.7e-33
WP_161886142.1|1916307_1917591_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.8	4.8e-90
WP_161886143.1|1917651_1917846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161886144.1|1917897_1918461_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_161886145.1|1918457_1920062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161886146.1|1920097_1920484_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_161886147.1|1920489_1921473_+	hypothetical protein	NA	NA	NA	NA	NA
1921613:1921648	attL	CAGGGGGTCAGGGGTTCGAATCCCCTTGGATCCACC	NA	NA	NA	NA
WP_161886148.1|1921896_1923798_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	8.9e-40
WP_161886149.1|1924314_1925151_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_161886150.1|1925622_1926054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161886151.1|1926371_1926884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161886152.1|1926993_1928064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161887452.1|1929096_1930296_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	24.5	2.2e-07
WP_161886153.1|1930292_1931225_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_161886154.1|1931221_1932211_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	23.7	1.6e-16
1933130:1933165	attR	CAGGGGGTCAGGGGTTCGAATCCCCTTGGATCCACC	NA	NA	NA	NA
