The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043925	Proteus columbae strain T60 chromosome, complete genome	4114477	1049484	1060327	4114477		Mycobacterium_phage(25.0%)	12	NA	NA
WP_109374070.1|1049484_1050684_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	36.6	2.4e-27
WP_109374071.1|1051306_1052275_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.1	7.5e-136
WP_160230060.1|1052299_1054426_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.0	2.9e-204
WP_109374073.1|1054431_1054851_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	36.1	2.8e-10
WP_023581131.1|1054862_1055087_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	45.7	3.5e-12
WP_109374074.1|1055370_1055844_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_023581133.1|1056041_1056251_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	4.5e-22
WP_109374075.1|1056386_1056761_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.0	2.5e-23
WP_075671558.1|1056774_1057740_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_109374076.1|1057841_1058486_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036912266.1|1058651_1058915_-	YbeD family protein	NA	NA	NA	NA	NA
WP_109374077.1|1059115_1060327_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.1	3.1e-102
>prophage 2
NZ_CP043925	Proteus columbae strain T60 chromosome, complete genome	4114477	1368381	1423539	4114477	tail,lysis,terminase,head,integrase	Morganella_phage(48.0%)	80	1369699:1369714	1395419:1395434
WP_160230127.1|1368381_1370433_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	24.9	1.8e-17
1369699:1369714	attL	GATATTTCTCCATTAA	NA	NA	NA	NA
WP_075673145.1|1370435_1370894_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_109373556.1|1371031_1371445_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_036912304.1|1371524_1371842_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_109373557.1|1372042_1372324_+	acylphosphatase	NA	NA	NA	NA	NA
WP_023581360.1|1372358_1372688_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_109849951.1|1373123_1374308_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	51.6	4.4e-114
WP_063693452.1|1374311_1374518_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.8	8.7e-10
WP_098943689.1|1374547_1374742_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	95.3	8.4e-31
WP_160230128.1|1374826_1375429_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	56.2	7.4e-57
WP_109849925.1|1375415_1375727_-	DUF2591 family protein	NA	A0A1P8DTH6	Proteus_phage	37.4	2.4e-11
WP_109849926.1|1375719_1375905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109849927.1|1375997_1377272_-	DNA (cytosine-5-)-methyltransferase	NA	A0A2D0YW64	Vibrio_phage	53.8	2.0e-112
WP_109849928.1|1377344_1377620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109849929.1|1377612_1377873_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	61.2	3.7e-21
WP_109849930.1|1377872_1378154_-	hypothetical protein	NA	A0A1P8DTG9	Proteus_phage	76.3	2.6e-36
WP_160230129.1|1378226_1378754_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	53.1	1.0e-49
WP_109849932.1|1378753_1379365_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	69.3	1.8e-74
WP_109373564.1|1379366_1379687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530398.1|1379683_1379836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098943682.1|1379832_1380108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230130.1|1380098_1380275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098943681.1|1380363_1380591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138158020.1|1380679_1380904_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	40.5	1.8e-08
WP_098943679.1|1380984_1381359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098943678.1|1381558_1381861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098943677.1|1382306_1382501_+	DUF2767 family protein	NA	NA	NA	NA	NA
WP_088495876.1|1382656_1382998_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	62.8	9.6e-38
WP_098943676.1|1383006_1383717_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	61.3	2.8e-79
WP_088495874.1|1383812_1383998_+	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	56.7	3.9e-09
WP_004247478.1|1384116_1384464_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	8.3e-37
WP_004251793.1|1384559_1384733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109374413.1|1384729_1385497_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.4e-23
WP_160230131.1|1385496_1386882_+	AAA family ATPase	NA	Q716D2	Shigella_phage	47.9	6.1e-115
WP_026090523.1|1386909_1387239_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.0	1.1e-22
WP_160230132.1|1387306_1387756_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.2e-13
WP_004245984.1|1387834_1388125_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|1388121_1388478_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_098943672.1|1388477_1389110_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	2.5e-23
WP_160230133.1|1389348_1389807_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_041701226.1|1390387_1390600_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.6	1.5e-25
WP_098943670.1|1391248_1391656_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_109372766.1|1391756_1392752_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_098943667.1|1392776_1393286_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	73.2	2.9e-70
WP_098943665.1|1393777_1394047_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	52.3	4.6e-19
WP_109850508.1|1394046_1394517_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	2.3e-50
WP_004244729.1|1394498_1394657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109850507.1|1394659_1395121_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	5.3e-23
WP_036976683.1|1395626_1396055_-	hypothetical protein	NA	NA	NA	NA	NA
1395419:1395434	attR	TTAATGGAGAAATATC	NA	NA	NA	NA
WP_160230134.1|1396070_1396238_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	59.0	4.7e-06
WP_164530411.1|1396339_1396504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230135.1|1396583_1397192_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	77.3	3.0e-74
WP_160230136.1|1397194_1398679_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	88.3	6.7e-269
WP_160230137.1|1398680_1400063_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	80.2	1.5e-217
WP_109850503.1|1400065_1401127_+|head	phage head morphogenesis protein	head	A0A1W6JNT7	Morganella_phage	76.2	4.6e-155
WP_089503223.1|1401193_1401880_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	77.1	4.3e-69
WP_109850502.1|1401885_1402836_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	86.5	2.5e-152
WP_098943655.1|1402879_1403257_+	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	72.8	4.0e-45
WP_052038475.1|1403258_1403600_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	82.3	1.1e-52
WP_160230138.1|1403602_1403971_+	HK97 gp10 family phage protein	NA	A0A1W6JNX7	Morganella_phage	82.8	2.8e-51
WP_098943652.1|1403967_1404339_+	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	69.9	1.9e-47
WP_160230139.1|1404403_1405159_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	77.7	8.5e-103
WP_160230140.1|1405208_1405901_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	68.9	2.4e-88
WP_098943649.1|1405922_1406201_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_098943648.1|1406216_1406516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098943644.1|1407600_1408065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230141.1|1408198_1408654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098943640.1|1408846_1409554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098943638.1|1409578_1410391_-	LexA family transcriptional regulator	NA	B0ZSI5	Halomonas_phage	25.9	2.4e-10
WP_160230142.1|1410494_1410665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098943636.1|1411435_1412161_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	56.8	8.0e-66
WP_160230143.1|1412298_1412883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098943632.1|1413019_1413325_+	hypothetical protein	NA	A0A1P8DTJ8	Proteus_phage	36.7	2.5e-05
WP_098943630.1|1413358_1413667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230144.1|1413735_1417071_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	48.3	6.4e-219
WP_089503235.1|1417110_1417440_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	69.7	1.1e-41
WP_098943626.1|1417436_1418135_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	82.3	1.9e-112
WP_098943624.1|1418138_1418858_+	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.9	1.4e-110
WP_098943622.1|1418794_1419361_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	77.4	3.4e-48
WP_160230145.1|1419360_1423539_+	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	75.9	0.0e+00
>prophage 3
NZ_CP043925	Proteus columbae strain T60 chromosome, complete genome	4114477	1451406	1492000	4114477	lysis,tRNA,terminase,head,integrase	Burkholderia_phage(24.24%)	52	1450652:1450667	1467321:1467336
1450652:1450667	attL	AATGTAGAACATAAAT	NA	NA	NA	NA
WP_160230156.1|1451406_1452519_-|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.8	3.6e-25
WP_109372812.1|1453063_1453633_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_160230157.1|1453682_1453937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230158.1|1454616_1455498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230159.1|1456812_1457988_-|integrase	site-specific integrase	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	29.5	4.2e-32
WP_060555085.1|1457989_1458202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945461.1|1458616_1458787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230160.1|1458814_1458994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230161.1|1459041_1459542_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	57.0	1.6e-41
WP_160230162.1|1459541_1461506_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	40.5	1.9e-114
WP_160230163.1|1461518_1461851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230164.1|1462252_1462945_-	helix-turn-helix domain-containing protein	NA	G8C7L8	Escherichia_phage	48.5	6.3e-52
WP_098943545.1|1463050_1463296_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_049257326.1|1463343_1463799_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	54.7	3.8e-29
WP_103004846.1|1463816_1464041_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	6.1e-17
WP_160230165.1|1464042_1464873_+	replication protein	NA	H9C164	Pectobacterium_phage	58.4	1.7e-35
WP_160230166.1|1464862_1466281_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	61.4	3.6e-171
WP_160230167.1|1466335_1466512_+	palmdelphin	NA	NA	NA	NA	NA
WP_160230168.1|1466852_1467596_+	hypothetical protein	NA	NA	NA	NA	NA
1467321:1467336	attR	AATGTAGAACATAAAT	NA	NA	NA	NA
WP_160230169.1|1467708_1468302_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	53.2	4.7e-56
WP_160230170.1|1468313_1468625_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	4.5e-34
WP_160230171.1|1468612_1469146_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	50.6	1.2e-37
WP_160230172.1|1469253_1469724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250558.1|1469930_1470200_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
WP_104836572.1|1470199_1470670_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.5	2.9e-48
WP_167514938.1|1470651_1470810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230173.1|1470812_1471280_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	37.9	2.8e-11
WP_160230174.1|1471370_1471712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230175.1|1471811_1472822_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	36.5	2.1e-35
WP_160230176.1|1472961_1473834_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_160230177.1|1474056_1475457_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.7	3.9e-85
WP_160230178.1|1475458_1476958_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	45.5	3.4e-103
WP_160230865.1|1476995_1477709_+|head	phage head morphogenesis protein	head	A0A2H5BG15	Pseudoalteromonas_phage	35.3	1.0e-33
WP_160230179.1|1477705_1478968_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	54.3	3.2e-46
WP_160230180.1|1478967_1479465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230181.1|1479464_1480532_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	38.3	5.7e-52
WP_160230182.1|1480601_1480943_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	33.6	1.8e-07
WP_160230183.1|1480945_1481377_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	31.0	2.6e-11
WP_160230184.1|1481376_1481835_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	34.7	3.9e-10
WP_072069958.1|1481834_1482206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230185.1|1482192_1482708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230186.1|1482716_1484204_+	DUF3383 family protein	NA	A0A088C3U1	Shewanella_sp._phage	37.3	1.3e-81
WP_100157941.1|1484214_1484667_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.8	2.6e-22
WP_160230187.1|1484706_1485165_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	3.9e-26
WP_160230188.1|1485250_1487509_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	32.4	3.8e-21
WP_109372844.1|1487505_1488033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230189.1|1488032_1488350_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	34.4	2.3e-09
WP_160230190.1|1488315_1489131_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.0	5.4e-10
WP_109372847.1|1489133_1489826_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	1.6e-34
WP_109372848.1|1489822_1490167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230191.1|1490159_1491347_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.9	1.7e-68
WP_160230192.1|1491343_1492000_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.9	1.7e-38
>prophage 4
NZ_CP043925	Proteus columbae strain T60 chromosome, complete genome	4114477	1528632	1574803	4114477	holin,lysis,terminase,integrase,capsid	Proteus_phage(21.15%)	68	1515387:1515401	1530592:1530606
1515387:1515401	attL	AGAAACAGTTGATGA	NA	NA	NA	NA
WP_160230201.1|1528632_1529808_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	59.4	5.3e-136
WP_099659572.1|1529788_1529977_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	56.9	5.9e-13
WP_069367891.1|1530181_1530388_-	DUF4060 family protein	NA	NA	NA	NA	NA
WP_160230202.1|1530395_1530941_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	60.3	2.1e-58
1530592:1530606	attR	TCATCAACTGTTTCT	NA	NA	NA	NA
WP_160230203.1|1530930_1531260_-	DUF2591 family protein	NA	A0A1P8DTH6	Proteus_phage	49.1	5.0e-15
WP_160230204.1|1531595_1531754_-	hypothetical protein	NA	A0A1P8DTH4	Proteus_phage	74.4	1.6e-08
WP_160230205.1|1531753_1531933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230206.1|1531962_1532229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230207.1|1532314_1533190_-	recombinase RecT	NA	E5AGD9	Erwinia_phage	68.5	1.2e-105
WP_160230208.1|1533191_1534004_-	exodeoxyribonuclease VIII	NA	E5AGE0	Erwinia_phage	68.9	3.4e-113
WP_160230209.1|1534000_1534255_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	94.0	2.5e-38
WP_160230210.1|1534251_1534515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230211.1|1534731_1535673_-	cell envelope biogenesis protein TolA	NA	A0A2I7R804	Vibrio_phage	46.5	1.3e-20
WP_036935812.1|1535785_1536070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230212.1|1536087_1536276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109395763.1|1536312_1536588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230213.1|1536604_1536793_-	hypothetical protein	NA	A0A068C8G2	Acinetobacter_phage	50.0	2.2e-07
WP_160230214.1|1537169_1537349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230215.1|1537349_1537526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070486803.1|1537687_1537801_-	transcriptional regulator	NA	K7PJW2	Enterobacteria_phage	65.6	4.6e-05
WP_160230216.1|1538000_1538309_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	51.5	1.8e-14
WP_063693508.1|1538787_1539789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230217.1|1539893_1540538_-	helix-turn-helix domain-containing protein	NA	A0A077KGZ5	Edwardsiella_phage	64.0	1.1e-77
WP_160230218.1|1540643_1540853_+	helix-turn-helix domain-containing protein	NA	K7PKH4	Enterobacteria_phage	81.8	2.6e-25
WP_160230219.1|1541012_1541360_+	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	38.1	2.4e-07
WP_109391283.1|1542313_1543039_+	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	80.4	4.6e-106
WP_160230220.1|1543056_1543968_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	61.5	5.3e-99
WP_160230221.1|1544484_1544706_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160230222.1|1544692_1544926_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_160230223.1|1545109_1545559_+	hypothetical protein	NA	A0A2I7R8L6	Vibrio_phage	36.6	5.7e-14
WP_160230224.1|1545551_1545758_+	hypothetical protein	NA	L0AQP4	Klebsiella_phage	77.8	4.9e-21
WP_160230225.1|1545754_1546204_+	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	97.3	6.9e-76
WP_160230226.1|1546190_1546325_+	hypothetical protein	NA	A0A1P8DTE6	Proteus_phage	86.4	2.0e-15
WP_160230227.1|1546296_1546890_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	95.9	6.5e-98
WP_160230228.1|1547067_1547907_+	antitermination protein	NA	H6WRZ1	Salmonella_phage	43.8	3.0e-56
WP_160230229.1|1548314_1548632_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	66.7	7.6e-37
WP_160230230.1|1548624_1549029_+	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.0	2.9e-25
WP_160230231.1|1549025_1549478_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	77.8	7.0e-52
WP_160230232.1|1549474_1549894_+	hypothetical protein	NA	Q716E1	Shigella_phage	49.0	5.2e-25
WP_160230866.1|1550574_1550961_+	hypothetical protein	NA	Q9B021	Phage_GMSE-1	72.7	1.1e-13
WP_160230233.1|1551048_1551210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073743.1|1551229_1551415_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	73.8	3.4e-21
WP_160230234.1|1551562_1552003_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	66.4	1.3e-42
WP_160230235.1|1551983_1553228_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	74.0	3.2e-187
WP_160230236.1|1553227_1554583_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	62.6	1.6e-160
WP_160230237.1|1554533_1555463_+|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	56.3	7.1e-91
WP_160230238.1|1555466_1556744_+	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	69.8	9.8e-168
WP_160230239.1|1556743_1557181_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	69.2	6.5e-47
WP_160230240.1|1557197_1558292_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.6	7.7e-145
WP_004247764.1|1558301_1558475_+	hypothetical protein	NA	I6R9A3	Salmonella_phage	51.8	1.4e-08
WP_160230241.1|1558531_1558930_+	hypothetical protein	NA	I6S619	Salmonella_phage	78.0	1.7e-54
WP_160230242.1|1558929_1559268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230243.1|1559269_1559638_+	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	67.2	2.6e-41
WP_160230244.1|1559634_1560003_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	29.5	1.2e-09
WP_160230245.1|1560067_1560823_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	79.7	4.4e-107
WP_160230246.1|1560872_1561565_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.1	1.7e-89
WP_160230247.1|1561607_1561955_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	63.1	2.7e-35
WP_160230248.1|1562092_1562488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098943632.1|1562539_1562845_+	hypothetical protein	NA	A0A1P8DTJ8	Proteus_phage	36.7	2.5e-05
WP_098943630.1|1562878_1563187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230249.1|1563255_1566648_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	41.7	1.5e-162
WP_109409994.1|1566651_1567128_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	71.6	9.6e-60
WP_004247776.1|1567127_1567598_+	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	51.3	2.6e-41
WP_160230250.1|1567594_1567987_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	56.6	4.6e-44
WP_160230251.1|1567973_1570442_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	51.6	2.3e-250
WP_160230252.1|1570499_1572404_+	hypothetical protein	NA	F1C5A8	Cronobacter_phage	66.4	7.3e-50
WP_160230253.1|1572544_1574539_+	acyltransferase family protein	NA	W6MVL2	Pseudomonas_phage	38.2	4.2e-64
WP_160230254.1|1574572_1574803_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	93.4	4.1e-32
>prophage 5
NZ_CP043925	Proteus columbae strain T60 chromosome, complete genome	4114477	1618349	1659485	4114477	tail,protease,lysis,tRNA,portal,terminase,head,integrase,capsid	Morganella_phage(20.59%)	56	1612604:1612620	1638422:1638438
1612604:1612620	attL	AATAAAAAAGCCCTGCA	NA	NA	NA	NA
WP_109372906.1|1618349_1619453_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_109372907.1|1619561_1620011_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_160230263.1|1620003_1620633_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_023582546.1|1620771_1622025_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_072062659.1|1622134_1623268_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	72.2	6.5e-155
WP_017628380.1|1623242_1623494_-	excisionase	NA	NA	NA	NA	NA
WP_160230264.1|1623563_1624073_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	61.6	5.3e-56
WP_088495883.1|1624072_1624684_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	69.7	1.4e-74
WP_160230265.1|1624685_1625012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230266.1|1625024_1625210_-	host cell division inhibitory peptide Kil	NA	A0A1P8DTH8	Proteus_phage	63.8	2.1e-10
WP_004244711.1|1625315_1625546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230267.1|1625602_1626052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230268.1|1626179_1626500_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	51.4	1.2e-18
WP_160230269.1|1626847_1627672_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_160230270.1|1627668_1628412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230271.1|1628452_1629103_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	57.6	4.8e-62
WP_004244717.1|1629199_1629427_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD1	Pseudomonas_phage	42.9	7.6e-07
WP_004247478.1|1629569_1629917_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	8.3e-37
WP_004247479.1|1630012_1630186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230272.1|1630182_1630950_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.0e-23
WP_160230273.1|1630949_1632335_+	helicase	NA	Q716D2	Shigella_phage	47.5	2.3e-114
WP_088495870.1|1632360_1632810_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.2e-13
WP_167514948.1|1632840_1633482_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	71.4	5.8e-84
WP_160230275.1|1633531_1633930_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	54.3	1.2e-31
WP_004244726.1|1634269_1634482_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
WP_160230276.1|1634813_1635272_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_160230277.1|1635448_1635952_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160230278.1|1636595_1637018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046334538.1|1637082_1637352_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
WP_160230279.1|1637351_1637822_+	glycoside hydrolase family protein	NA	A0A1W6JNW4	Morganella_phage	62.5	1.4e-50
WP_167514939.1|1637803_1637962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230280.1|1637964_1638426_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	45.9	2.0e-22
WP_115065288.1|1638489_1639341_-	protein deglycase HchA	NA	NA	NA	NA	NA
1638422:1638438	attR	AATAAAAAAGCCCTGCA	NA	NA	NA	NA
WP_108716960.1|1640357_1640567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230281.1|1640598_1640907_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	67.3	4.9e-33
WP_036937620.1|1640939_1641278_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	68.8	8.3e-42
WP_160230282.1|1641396_1641864_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
WP_160230283.1|1641817_1643560_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.0	5.5e-145
WP_160230284.1|1643560_1644883_+|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	77.2	2.4e-201
WP_160230285.1|1644888_1645740_+|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	84.3	2.7e-129
WP_160230286.1|1645751_1646966_+|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	89.6	1.9e-200
WP_160230287.1|1647011_1647212_+	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	77.8	1.5e-11
WP_160230288.1|1647211_1647538_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	74.1	7.5e-40
WP_160230289.1|1647546_1647876_+|head	phage head closure protein	head	A0A0R6PHN1	Moraxella_phage	32.7	1.2e-05
WP_160230290.1|1647865_1648339_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.9	7.4e-12
WP_160230291.1|1648344_1648686_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_160230292.1|1648695_1649361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036900961.1|1649425_1649842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230868.1|1649838_1650117_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|1650141_1650333_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_160230293.1|1650457_1653709_+|tail	phage tail tape measure protein	tail	A0A220VZA0	Acinetobacter_phage	20.0	6.5e+02
WP_160230294.1|1653709_1654306_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	1.0e-50
WP_160230295.1|1654305_1654887_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	4.0e-52
WP_160230296.1|1654919_1655231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230297.1|1655328_1655727_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	2.7e-31
WP_160230298.1|1655726_1659485_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	51.5	3.4e-200
>prophage 6
NZ_CP043925	Proteus columbae strain T60 chromosome, complete genome	4114477	1720566	1732198	4114477	tRNA	Tupanvirus(50.0%)	12	NA	NA
WP_036937410.1|1720566_1721106_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	3.7e-15
WP_004263702.1|1721200_1721398_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_006537111.1|1721440_1721797_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_120655563.1|1721904_1721952_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_023582383.1|1722127_1723111_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	4.9e-34
WP_109372455.1|1723125_1725513_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.4	6.0e-09
WP_023582381.1|1725517_1725814_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_109372454.1|1726194_1727205_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_109372453.1|1727206_1727956_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.6	1.7e-10
WP_109372452.1|1728089_1729235_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.5	3.5e-39
WP_109372451.1|1729235_1730216_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.4	7.3e-38
WP_109372450.1|1730215_1732198_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	27.2	1.1e-21
>prophage 7
NZ_CP043925	Proteus columbae strain T60 chromosome, complete genome	4114477	1992146	2002662	4114477		Escherichia_phage(83.33%)	8	NA	NA
WP_160230366.1|1992146_1994585_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.0	3.4e-217
WP_023582154.1|1994596_1995214_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	1.7e-72
WP_160230367.1|1995215_1996073_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	37.7	2.1e-28
WP_160230368.1|1996248_1996860_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.1	3.0e-29
WP_109372299.1|1996914_1997895_-	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	37.5	3.4e-19
WP_109372298.1|1997891_1998479_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_160230369.1|1998889_2000593_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_160230371.1|2000604_2002662_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	27.4	1.9e-32
>prophage 8
NZ_CP043925	Proteus columbae strain T60 chromosome, complete genome	4114477	2338581	2427892	4114477	transposase,tail,protease,portal,tRNA,terminase,lysis,head,integrase,capsid	Proteus_phage(18.92%)	88	2360227:2360245	2430609:2430627
WP_109374219.1|2338581_2339961_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	81.6	1.9e-177
WP_109374218.1|2340259_2341153_+	lipid kinase YegS	NA	NA	NA	NA	NA
WP_160230445.1|2341202_2342252_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_109374217.1|2342303_2343101_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_109374216.1|2343557_2344202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230446.1|2344815_2345451_+	lipid IV(A) palmitoyltransferase PagP	NA	NA	NA	NA	NA
WP_109374214.1|2345555_2346938_-	amino acid permease	NA	NA	NA	NA	NA
WP_006533085.1|2347602_2347989_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160230447.1|2348116_2348923_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_109374212.1|2349225_2350572_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_109374211.1|2350712_2351552_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	30.8	5.0e-11
WP_160230448.1|2351651_2353124_-	amino acid carrier protein	NA	NA	NA	NA	NA
WP_100160381.1|2354457_2354691_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	65.6	1.7e-14
WP_109374209.1|2354797_2355187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109374208.1|2355283_2355466_-	YoaH family protein	NA	NA	NA	NA	NA
WP_160230449.1|2355578_2356964_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	38.2	4.6e-38
WP_160230450.1|2356950_2357514_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_160230451.1|2357698_2359060_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_160229872.1|2359099_2360310_-|transposase	IS3 family transposase	transposase	B6DZX3	Stx2-converting_phage	37.0	3.5e-21
2360227:2360245	attL	TTCGCCTTTTTCAACTTGG	NA	NA	NA	NA
WP_109374204.1|2361046_2361634_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_109374203.1|2361725_2362541_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_023581865.1|2362687_2363101_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_160230452.1|2363336_2363783_+	universal stress protein	NA	NA	NA	NA	NA
WP_109374201.1|2363974_2364793_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_100160390.1|2365007_2365442_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	47.9	6.8e-28
WP_109374200.1|2365625_2367029_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_160230453.1|2367603_2368293_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_160230878.1|2368295_2369621_-	fimbrial protein	NA	NA	NA	NA	NA
WP_109374198.1|2369671_2372200_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_109374197.1|2372216_2372942_-	molecular chaperone	NA	NA	NA	NA	NA
WP_109374196.1|2373005_2373536_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_160230454.1|2374159_2374606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230455.1|2374934_2375771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109374193.1|2375997_2376828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109374192.1|2376939_2378424_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_160230456.1|2378893_2382862_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_160230457.1|2383297_2383828_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_036912728.1|2383886_2384609_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_160230458.1|2385048_2386164_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_160230879.1|2386609_2387479_-	flagellin FliC	NA	NA	NA	NA	NA
WP_160230880.1|2387653_2387881_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	88.0	8.4e-30
WP_167514950.1|2388222_2388375_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_160230459.1|2388478_2389783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230460.1|2389803_2391084_-	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_160230461.1|2392198_2392477_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160230462.1|2392600_2393602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230463.1|2393605_2397382_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	50.8	1.7e-199
WP_160230464.1|2397381_2397780_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.0	1.2e-31
WP_049206484.1|2397848_2398397_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	38.4	5.2e-25
WP_160230465.1|2398415_2398997_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	48.5	5.8e-51
WP_160230466.1|2398996_2399593_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	53.3	9.2e-52
WP_160230467.1|2399593_2402845_-|tail	phage tail tape measure protein	tail	A0A220VZA0	Acinetobacter_phage	19.5	1.4e+03
WP_036894769.1|2402885_2403164_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036894767.1|2403160_2403577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230468.1|2403640_2404306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230469.1|2404315_2404657_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_160230470.1|2404662_2405136_-	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.1	9.7e-12
WP_160230471.1|2405119_2405455_-|head	phage head closure protein	head	B5WZS5	Pseudomonas_phage	38.7	1.2e-11
WP_058336093.1|2405463_2405790_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	75.0	5.8e-40
WP_160230472.1|2406095_2407310_-|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	89.6	8.4e-201
WP_160230473.1|2407321_2408173_-|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	84.6	4.1e-130
WP_160230474.1|2408178_2409501_-|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	77.0	7.0e-201
WP_160230475.1|2409501_2411244_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.9	1.9e-145
WP_036937618.1|2411197_2411665_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	57.1	5.7e-41
WP_160230476.1|2411783_2412122_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	9.2e-41
WP_160230477.1|2412118_2412526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207158.1|2412606_2413119_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	60.6	8.2e-57
WP_129586838.1|2414931_2415354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230478.1|2415886_2416348_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	51.2	2.4e-23
WP_167514943.1|2416350_2416509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230479.1|2416490_2416961_-	glycoside hydrolase family protein	NA	A0A1W6JNW4	Morganella_phage	61.2	3.4e-49
WP_160230480.1|2416960_2417230_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
WP_160230481.1|2417295_2417718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230482.1|2417950_2418184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230483.1|2418256_2418469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230484.1|2418905_2419307_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	72.8	5.4e-48
WP_160230485.1|2419334_2420360_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.5	4.0e-87
WP_160230486.1|2420359_2421067_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.3	1.6e-55
WP_160230487.1|2421238_2422330_-	replication protein	NA	H2DE83	Erwinia_phage	56.1	3.7e-30
WP_099659597.1|2422342_2422522_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	56.9	4.7e-12
WP_160230488.1|2422809_2423268_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	45.4	3.9e-26
WP_063108339.1|2423349_2423571_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH31	Moraxella_phage	47.5	3.6e-09
WP_099075719.1|2423699_2424167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230489.1|2424375_2424717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230490.1|2424890_2425265_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	70.6	1.2e-41
WP_160230491.1|2425330_2426158_+	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	55.1	1.5e-79
WP_160230492.1|2426215_2426665_+	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	50.0	1.3e-37
WP_099075724.1|2426872_2427892_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	35.5	1.1e-55
2430609:2430627	attR	CCAAGTTGAAAAAGGCGAA	NA	NA	NA	NA
>prophage 9
NZ_CP043925	Proteus columbae strain T60 chromosome, complete genome	4114477	2537840	2544237	4114477	holin,lysis	Burkholderia_phage(25.0%)	9	NA	NA
WP_109373850.1|2537840_2538299_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.6	2.1e-24
WP_109373851.1|2538362_2538815_-	hypothetical protein	NA	A0A0A1IWV3	Pseudomonas_phage	33.6	2.9e-13
WP_109373852.1|2538825_2540313_-	DUF3383 domain-containing protein	NA	Q6IWV2	Burkholderia_phage	30.6	4.8e-57
WP_109373853.1|2540321_2540834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109373854.1|2540927_2541377_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	44.1	5.7e-22
WP_109373855.1|2541373_2541778_-	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	4.5e-26
WP_109373856.1|2541770_2542079_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	54.5	6.9e-27
WP_160230517.1|2542445_2543261_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.7	2.1e-54
WP_160230518.1|2543499_2544237_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	45.9	3.1e-57
>prophage 10
NZ_CP043925	Proteus columbae strain T60 chromosome, complete genome	4114477	2998974	3037847	4114477	plate,protease,tRNA	Cronobacter_phage(25.0%)	31	NA	NA
WP_160230608.1|2998974_2999412_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_160230609.1|2999413_3001198_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_160230610.1|3001161_3002211_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_109371289.1|3002215_3003457_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_160230611.1|3003458_3004013_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_160230612.1|3004015_3005374_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_109371295.1|3005366_3006122_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_109371297.1|3006131_3008768_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.0	5.3e-83
WP_160230613.1|3008764_3009562_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_109371301.1|3009558_3010209_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_160230614.1|3010214_3011684_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_160230615.1|3011689_3015238_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_109371307.1|3015277_3016609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230616.1|3016668_3018405_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_109371311.1|3019205_3019514_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_109371313.1|3019662_3020202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109371315.1|3021055_3021928_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	3.3e-34
WP_109371317.1|3021931_3022144_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_109371319.1|3022798_3023740_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_109371321.1|3023977_3024421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109371323.1|3024510_3025902_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.2	9.4e-39
WP_006533972.1|3026277_3026772_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_109371325.1|3026784_3027507_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_109371327.1|3027641_3028163_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_109371329.1|3028159_3029227_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_109371331.1|3029350_3030628_+	MFS transporter	NA	NA	NA	NA	NA
WP_160230617.1|3030670_3031696_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_109371335.1|3031872_3034035_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_109371337.1|3034122_3036564_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_109371339.1|3036560_3037247_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	4.2e-32
WP_109371341.1|3037217_3037847_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 11
NZ_CP043925	Proteus columbae strain T60 chromosome, complete genome	4114477	3209928	3276538	4114477	tail,protease,portal,tRNA,terminase,head,integrase,capsid	uncultured_Caudovirales_phage(32.0%)	61	3261118:3261163	3276718:3276763
WP_072064290.1|3209928_3210582_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_109373082.1|3210825_3211626_-	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_109373081.1|3212056_3214429_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_109373080.1|3214479_3215817_+	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_109373079.1|3215806_3216805_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_156734007.1|3216797_3217616_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_006535978.1|3217641_3218019_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_109373077.1|3218021_3218843_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A2R4ALP3	Aeromonas_phage	45.6	2.1e-06
WP_088494660.1|3219277_3219763_-	type 3 dihydrofolate reductase	NA	A0A1I9S5V6	Bacillus_phage	43.8	8.6e-32
WP_109373076.1|3219938_3220553_+	LysE family translocator	NA	NA	NA	NA	NA
WP_109373075.1|3220599_3221676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109373074.1|3221786_3225017_-	autotransporter Pta	NA	NA	NA	NA	NA
WP_109373073.1|3225469_3226891_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_109373072.1|3227124_3227874_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_160230656.1|3227938_3230896_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.2	5.0e-82
WP_109373070.1|3230927_3232823_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.9	2.3e-96
WP_109373069.1|3232947_3233523_-	esterase YqiA	NA	NA	NA	NA	NA
WP_109373068.1|3233526_3234366_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_109373067.1|3234592_3235228_-	ADP-ribose diphosphatase	NA	NA	NA	NA	NA
WP_109373066.1|3235441_3236839_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_072070058.1|3237168_3237897_+	DUF1190 family protein	NA	A0A0K1YB89	Cronobacter_phage	35.3	2.0e-24
WP_109373065.1|3237905_3239069_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.3	1.3e-89
WP_160230657.1|3239166_3239487_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
WP_099074463.1|3239486_3239738_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_109373064.1|3240083_3240869_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_023582768.1|3241049_3241703_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	3.5e-44
WP_160230658.1|3242189_3242510_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_109373062.1|3242612_3243935_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_109373061.1|3243934_3245563_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_109373060.1|3245864_3246569_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109373059.1|3246676_3248101_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	1.3e-40
WP_109373058.1|3248196_3251037_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_109373057.1|3251063_3251987_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_109373056.1|3252206_3252827_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_160230659.1|3252853_3254092_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.5	2.6e-93
WP_109373054.1|3254092_3254443_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_023582777.1|3254547_3255204_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_098941951.1|3255284_3256307_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	1.2e-107
WP_001144069.1|3256649_3256865_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_109373137.1|3256977_3258726_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.5	6.6e-74
WP_109373053.1|3258912_3260769_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.2	2.7e-33
3261118:3261163	attL	ACTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCA	NA	NA	NA	NA
WP_160230660.1|3261510_3262734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230661.1|3263019_3264681_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	80.3	1.3e-273
WP_160230662.1|3264677_3265031_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	82.1	8.7e-50
WP_160230663.1|3265304_3265751_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	65.7	1.4e-52
WP_160230664.1|3265751_3266048_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	66.0	1.5e-31
WP_160230665.1|3266040_3267264_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	77.4	1.5e-189
WP_160230666.1|3267263_3267818_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	66.7	1.5e-64
WP_160230667.1|3267872_3269027_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	71.4	5.2e-152
WP_160230668.1|3269259_3269514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230669.1|3269809_3271483_-|integrase	integrase	integrase	A0A1L2C915	Pseudomonas_phage	34.3	3.9e-47
WP_151251034.1|3271479_3271839_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	46.7	2.7e-22
WP_151251035.1|3271828_3272134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230670.1|3272136_3272355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230671.1|3272357_3272528_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_157926015.1|3272520_3272697_-	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	56.8	4.1e-08
WP_100159941.1|3272896_3273079_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	46.3	6.7e-06
WP_151251038.1|3273491_3274085_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	66.9	2.8e-56
WP_160230672.1|3274117_3274321_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151251048.1|3274462_3274753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160230673.1|3275134_3276538_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	H7BV31	unidentified_phage	30.1	5.1e-08
3276718:3276763	attR	ACTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCA	NA	NA	NA	NA
>prophage 12
NZ_CP043925	Proteus columbae strain T60 chromosome, complete genome	4114477	3417144	3460480	4114477	transposase,integrase	Escherichia_phage(40.0%)	35	3454925:3454939	3461001:3461015
WP_002001451.1|3417144_3418329_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_160230711.1|3418359_3418626_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_000985631.1|3418667_3421646_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_001043260.1|3422116_3422932_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|3423018_3423321_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|3423214_3423466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|3423496_3424990_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_077782102.1|3425634_3426495_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_064754130.1|3426512_3427676_-	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_044502095.1|3427672_3428050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000602738.1|3430018_3430771_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|3431192_3432218_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|3432446_3433223_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_001067855.1|3433336_3434041_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001183556.1|3434080_3434482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160230712.1|3434618_3435434_-	APH(3')-I family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	97.8	4.8e-160
WP_001067856.1|3435563_3436268_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_000904906.1|3437503_3438118_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001082319.1|3439468_3440272_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3440271_3441108_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_167514945.1|3441079_3441409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|3441439_3442933_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|3443044_3443350_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|3443377_3444592_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|3444814_3445699_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|3445729_3447223_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|3447334_3447640_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|3447667_3448882_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|3449104_3449989_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|3450019_3451513_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000985631.1|3451930_3454909_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
3454925:3454939	attL	TATTAAATGTACGAT	NA	NA	NA	NA
WP_000348524.1|3457082_3457526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497807.1|3457990_3458965_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_001995600.1|3458967_3459237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218618.1|3459238_3460480_+|integrase	integrase family protein	integrase	A0A291AWU1	Escherichia_phage	39.8	1.3e-76
3461001:3461015	attR	ATCGTACATTTAATA	NA	NA	NA	NA
>prophage 13
NZ_CP043925	Proteus columbae strain T60 chromosome, complete genome	4114477	4009495	4060259	4114477	transposase,integrase,tRNA	Escherichia_phage(18.18%)	42	4010147:4010161	4068568:4068582
WP_109374156.1|4009495_4010524_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
4010147:4010161	attL	CTTGAAGATCCAAAA	NA	NA	NA	NA
WP_109374155.1|4010605_4010887_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	34.9	1.6e-06
WP_109374154.1|4010867_4011197_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	42.2	1.7e-15
WP_160230825.1|4011342_4012017_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_075672604.1|4012132_4012756_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	8.4e-64
WP_109374152.1|4013128_4015087_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.5	3.3e-90
WP_109374151.1|4015245_4015557_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_160230826.1|4015553_4017209_+	cation/acetate symporter ActP	NA	NA	NA	NA	NA
WP_109374149.1|4017643_4019227_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_160230827.1|4025440_4026127_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_160230828.1|4026209_4027604_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_160230829.1|4027671_4028601_-	ribokinase	NA	NA	NA	NA	NA
WP_160230830.1|4028882_4030382_+	ATPase RavA	NA	NA	NA	NA	NA
WP_160230831.1|4030389_4031847_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_160230832.1|4031847_4032840_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.2	2.0e-51
WP_023583317.1|4032999_4033461_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_109373319.1|4033561_4034002_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_160230833.1|4034378_4036277_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_109373321.1|4036273_4036900_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_109373322.1|4037513_4037891_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_072071088.1|4037922_4038747_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|4038792_4039032_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_109373323.1|4039093_4039564_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_006534344.1|4039576_4040110_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_006534343.1|4040124_4041666_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_006534342.1|4041724_4042588_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_023583323.1|4042622_4044005_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_109373324.1|4044026_4044443_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_109373325.1|4044595_4045969_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	34.3	1.3e-29
WP_109373326.1|4046129_4047956_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.2	3.4e-129
WP_001029679.1|4048115_4048937_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000267723.1|4048923_4051032_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|4051028_4052696_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001243518.1|4052698_4054225_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000251879.1|4054225_4055842_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001271300.1|4056072_4056450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|4056859_4057231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|4057291_4057789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704156.1|4057857_4058382_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|4058476_4058950_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000071896.1|4059281_4059818_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|4059932_4060259_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
4068568:4068582	attR	CTTGAAGATCCAAAA	NA	NA	NA	NA
