The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040391	Klebsiella pneumoniae strain LSH-KPN25 chromosome, complete genome	5441138	445081	510672	5441138	protease,head,tail,capsid,tRNA,integrase,terminase,portal,transposase	uncultured_Caudovirales_phage(57.89%)	72	457596:457613	474897:474914
WP_002919147.1|445081_446029_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|446043_446553_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|446681_447806_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|447777_448251_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|448276_448819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|448823_449396_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|449399_450218_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|450214_450472_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|450447_451002_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|451704_451926_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|452219_455330_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|455342_456482_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|456860_457511_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
457596:457613	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|457786_459013_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|459105_460047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|460228_460513_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|460523_461303_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|461754_462024_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|462016_462205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|462197_462512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|462508_462877_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|462873_463239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|463238_465374_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|465716_466052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|466100_466613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|466876_468043_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|468094_468655_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|468656_469898_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|469894_470230_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|470226_470526_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_085955245.1|470841_472033_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_075666936.1|472077_472275_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	86.2	1.5e-27
WP_000113647.1|472550_472907_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|472890_474552_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_004150954.1|474554_474746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462905.1|474899_475196_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
474897:474914	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004144972.1|475220_476186_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002918745.1|476543_477425_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_002918742.1|477436_478888_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918740.1|478877_479120_-	YhdT family protein	NA	NA	NA	NA	NA
WP_002918738.1|479230_480580_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918736.1|480590_481058_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918732.1|481080_481533_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918689.1|481756_482365_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918688.1|482364_483366_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918687.1|483594_483786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918686.1|483865_485806_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918653.1|486111_487155_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_004149974.1|487225_488218_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918648.1|488217_488706_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002918646.1|488713_489295_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918644.1|489297_490767_+	ribonuclease G	NA	NA	NA	NA	NA
WP_004150952.1|490804_494602_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918642.1|494690_496136_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002918641.1|496171_497101_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918640.1|497232_497436_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002918639.1|497443_498376_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918632.1|498381_500349_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918629.1|500428_500704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918627.1|500754_501021_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918626.1|501119_501383_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918625.1|501758_502229_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918570.1|502643_503582_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918568.1|503718_504777_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918566.1|504864_506232_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918565.1|506405_506804_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_004144945.1|506994_508122_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918559.1|508387_508816_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|508831_509224_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_135801240.1|509281_509566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918467.1|509535_510174_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002918465.1|510177_510672_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
NZ_CP040391	Klebsiella pneumoniae strain LSH-KPN25 chromosome, complete genome	5441138	662951	683427	5441138	integrase,transposase	Salmonella_phage(50.0%)	19	662032:662045	673166:673179
662032:662045	attL	CGGCGGCCTTCGTC	NA	NA	NA	NA
WP_000290290.1|662951_664268_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	3.5e-35
WP_000268404.1|664397_664994_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	9.4e-97
WP_000256688.1|665076_666681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265818.1|667460_667688_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_024201514.1|667750_668497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001428286.1|668778_669279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000628304.1|669660_670275_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000287905.1|670302_670869_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_160221292.1|671075_672059_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.9	1.4e-166
WP_001067855.1|672088_672793_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000454193.1|673059_673410_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
673166:673179	attR	CGGCGGCCTTCGTC	NA	NA	NA	NA
WP_000147567.1|673535_674096_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_160221288.1|674098_677050_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|677058_677460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|677544_678249_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|679173_680058_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|680274_681489_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|681516_681822_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|681933_683427_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP040391	Klebsiella pneumoniae strain LSH-KPN25 chromosome, complete genome	5441138	1283429	1358560	5441138	head,tail,capsid,tRNA,integrase,terminase,lysis,portal,plate	Salmonella_phage(81.82%)	81	1282262:1282308	1317510:1317556
1282262:1282308	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000155498.1|1283429_1284470_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
WP_031591564.1|1284473_1285106_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	57.1	3.8e-64
WP_000102105.1|1285222_1285465_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_031591568.1|1285497_1286007_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	3.9e-83
WP_000956190.1|1286014_1286215_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_031591570.1|1286178_1286520_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	1.7e-55
WP_016529331.1|1286587_1286821_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	1.2e-31
WP_031591572.1|1286820_1287048_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	3.0e-35
WP_065953674.1|1287044_1287902_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	7.1e-162
WP_042943241.1|1287898_1290313_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.4	0.0e+00
WP_001154434.1|1290466_1290655_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_032357588.1|1290665_1290899_+	DinI family protein	NA	E5G6M1	Salmonella_phage	88.3	1.1e-32
WP_000020981.1|1291296_1291767_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.2	8.4e-24
WP_001369944.1|1291770_1292352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001555843.1|1292329_1292701_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	48.4	2.6e-28
WP_042943469.1|1292695_1293241_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_072042792.1|1293306_1293684_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_040149917.1|1293695_1294487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042943442.1|1294483_1295527_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	86.1	2.9e-170
WP_031591583.1|1295526_1297293_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_002895967.1|1297435_1298269_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_065811136.1|1298285_1299344_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059191.1|1299347_1299998_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|1300093_1300558_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_031591593.1|1300557_1300761_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	5.2e-31
WP_000171568.1|1300764_1300980_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_031591597.1|1300960_1301476_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.8	4.0e-88
WP_031591599.1|1301472_1301901_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.5e-59
WP_001039947.1|1301996_1302428_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_031591600.1|1302420_1302885_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	5.5e-60
WP_042943378.1|1302972_1304484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031591602.1|1304610_1305189_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
WP_031591604.1|1305185_1305545_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_031591606.1|1305531_1306440_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_001086836.1|1306432_1307038_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_040197578.1|1308469_1308946_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	50.5	1.4e-15
WP_040197576.1|1309079_1310252_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	8.6e-203
WP_001504081.1|1310261_1310777_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281009.1|1310831_1311134_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1311148_1311268_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_042943375.1|1311260_1314338_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.6	0.0e+00
WP_016529761.1|1314334_1314820_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_031591350.1|1314816_1315917_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.2	1.4e-175
WP_065953673.1|1316007_1316226_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	70.3	7.1e-18
WP_042943290.1|1316629_1317403_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_002914164.1|1318018_1318501_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1317510:1317556	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1318611_1319088_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1319077_1319368_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1319434_1319776_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1319923_1321585_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1321671_1322550_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1322674_1323265_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1323384_1324671_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1324690_1325482_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1325645_1327010_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1327269_1327518_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1327536_1328085_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1328116_1328884_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|1328923_1329271_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914119.1|1329390_1329849_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914118.1|1329905_1331276_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914117.1|1331284_1331767_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002914116.1|1331780_1333004_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004174804.1|1332996_1333506_-	YfiR family protein	NA	NA	NA	NA	NA
WP_002914114.1|1333848_1334919_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_002914113.1|1334928_1336050_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914112.1|1336112_1336985_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004150975.1|1336981_1338142_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100250063.1|1338242_1338290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914111.1|1338396_1338732_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004145664.1|1339002_1339740_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914110.1|1339871_1340852_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_002914109.1|1340848_1341580_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_004150973.1|1341709_1344283_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914097.1|1350248_1351547_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_002914095.1|1351550_1351874_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914094.1|1351915_1353271_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004188841.1|1353391_1356043_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914092.1|1356077_1356776_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_002914091.1|1356845_1357271_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914089.1|1357474_1358560_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP040391	Klebsiella pneumoniae strain LSH-KPN25 chromosome, complete genome	5441138	1769222	1776127	5441138	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1769222_1770086_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_023307294.1|1770096_1770870_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1771110_1772004_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1772249_1773611_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1773929_1774652_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1774648_1776127_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
NZ_CP040391	Klebsiella pneumoniae strain LSH-KPN25 chromosome, complete genome	5441138	1819249	1828698	5441138		Enterobacteria_phage(25.0%)	9	NA	NA
WP_077271909.1|1819249_1820092_+	glycosyltransferase	NA	A0A0N9QZR6	Chrysochromulina_ericina_virus	30.3	2.4e-13
WP_014343305.1|1820319_1821726_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_042943911.1|1821948_1823013_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	7.5e-105
WP_004175258.1|1823039_1823909_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_029498787.1|1823940_1824831_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_064449913.1|1824845_1825400_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	8.6e-52
WP_009484573.1|1825580_1826747_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	4.1e-112
WP_004144151.1|1827170_1827293_-	small membrane protein	NA	NA	NA	NA	NA
WP_042943910.1|1827693_1828698_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	2.3e-31
>prophage 6
NZ_CP040391	Klebsiella pneumoniae strain LSH-KPN25 chromosome, complete genome	5441138	2826672	2837559	5441138		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2826672_2829780_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2829834_2831100_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2831130_2832219_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2832305_2832566_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2832863_2833724_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2833744_2834506_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2834766_2835669_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2835680_2836946_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2836938_2837559_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP040391	Klebsiella pneumoniae strain LSH-KPN25 chromosome, complete genome	5441138	3067263	3105729	5441138	terminase,integrase	uncultured_Caudovirales_phage(34.04%)	56	3096842:3096856	3102851:3102865
WP_004152576.1|3067263_3068130_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3068129_3068903_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3068899_3070096_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3070095_3070449_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3070450_3071104_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3071157_3071724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|3071766_3071949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3071998_3072340_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3072339_3073362_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3073364_3073667_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3073667_3074267_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3074266_3076270_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3076259_3076412_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3076447_3076873_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3076876_3077317_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3077327_3078473_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3078476_3078917_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3079011_3079398_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3079397_3079904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3079900_3080320_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3080288_3080570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3080609_3081551_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3081562_3082057_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3082060_3083263_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3083314_3083863_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3083918_3085370_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3085607_3087008_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3086958_3087711_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3087812_3088133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3088367_3088757_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3088753_3089284_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3089286_3089535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3089940_3090723_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3090719_3091196_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3091192_3092155_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3092156_3093815_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3094391_3094613_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3094710_3095379_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3095549_3095864_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3095856_3096045_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3096214_3096580_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3096572_3096827_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3096798_3097017_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3096842:3096856	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3097013_3097439_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3097435_3097630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3097626_3098454_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3098558_3099077_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3099082_3099793_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3099782_3100007_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3100003_3100216_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3100212_3100692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3100870_3101113_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3101093_3102275_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3102471_3103020_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3102851:3102865	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3103218_3104751_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3104967_3105729_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
NZ_CP040391	Klebsiella pneumoniae strain LSH-KPN25 chromosome, complete genome	5441138	3138662	3191702	5441138	tail,integrase,terminase,holin,transposase	Klebsiella_phage(19.61%)	66	3138444:3138459	3189008:3189023
3138444:3138459	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3138662_3139334_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3139520_3140348_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3140423_3141689_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3141690_3142110_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_160221289.1|3142189_3142549_-	retA reverse transcriptase	NA	NA	NA	NA	NA
WP_001067855.1|3142607_3143312_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152700.1|3143671_3144403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160221290.1|3144406_3147361_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152652.1|3147437_3150506_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|3150502_3150883_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|3150892_3151375_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152649.1|3151555_3152020_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152648.1|3152334_3152670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217331.1|3152753_3155651_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_099119318.1|3155912_3156104_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217333.1|3156328_3156685_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|3156761_3156968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|3157105_3157588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|3157641_3158814_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|3158837_3159230_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|3159226_3159778_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|3159779_3160163_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|3160149_3160383_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|3160392_3160647_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|3160648_3161044_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_142689607.1|3161084_3161357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190653.1|3161365_3162319_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|3162329_3163115_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_019405022.1|3163645_3164758_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|3164741_3166142_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|3166141_3167449_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|3167426_3168431_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|3169293_3169539_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|3170497_3170773_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|3170769_3171114_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|3171110_3171650_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3171646_3171946_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|3172424_3173471_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3173696_3174386_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3174385_3174526_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3174522_3175161_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3175153_3175822_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3175818_3175986_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3175966_3176434_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3176954_3177983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3178190_3178436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3178491_3178794_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3178790_3179639_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3179635_3180496_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3180581_3180803_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3180843_3181071_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3181182_3181881_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3181903_3182023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3182168_3183245_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3183326_3183530_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3183958_3184153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3184241_3184526_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3184541_3185387_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3185383_3185671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3185672_3186353_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3186349_3186778_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3186774_3187437_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|3187644_3188832_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3189008_3189899_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3189008:3189023	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3189898_3190891_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3190892_3191702_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 9
NZ_CP040391	Klebsiella pneumoniae strain LSH-KPN25 chromosome, complete genome	5441138	3568155	3653833	5441138	protease,head,tail,capsid,tRNA,integrase,lysis,terminase,plate,portal	Salmonella_phage(50.0%)	83	3623609:3623627	3653908:3653926
WP_002898139.1|3568155_3569448_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3569538_3570882_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3570890_3571502_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004153815.1|3571624_3575806_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.1e-88
WP_000228469.1|3575941_3576436_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3576941_3577937_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3578051_3579818_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_042943346.1|3579818_3581540_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3581584_3582286_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3582639_3582858_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3582978_3585258_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3585288_3585606_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3585931_3586153_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3586229_3588170_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3588166_3589282_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3589428_3591087_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3591506_3592202_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3592317_3593217_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3593360_3595013_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3595023_3595992_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3596203_3596638_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3596789_3598508_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3598546_3599548_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3599558_3601001_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3601088_3602102_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3602098_3602929_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3602960_3604100_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3604977_3605493_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3605719_3606448_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3606468_3607200_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3607206_3607923_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3607922_3608591_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3608774_3609506_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3609548_3611021_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3611017_3611734_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3611812_3612940_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3612981_3613470_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3613527_3614373_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3614369_3615323_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3615333_3616467_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3616630_3617743_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3618091_3618571_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3618659_3619562_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3620383_3620671_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3620873_3621137_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3621143_3621527_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3621793_3623479_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3623609:3623627	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3623698_3623917_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3624008_3625109_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3625105_3625591_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3625587_3628215_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3628207_3628327_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3628341_3628641_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3628693_3629209_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3629218_3630391_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3630529_3631606_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3631635_3631839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3631835_3632567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3632570_3635522_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3635523_3636123_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3636115_3637024_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3637010_3637373_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3637369_3637942_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3638036_3638729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3638725_3639172_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3639164_3639596_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3639691_3640120_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3640116_3640500_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3640504_3641014_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3640994_3641210_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3641213_3641417_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3641416_3641881_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3641976_3642627_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_065811136.1|3642630_3643689_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_002895967.1|3643705_3644539_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_031591583.1|3644681_3646448_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_002895959.1|3646447_3647473_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3647534_3649277_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3649552_3650230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3650344_3650578_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3650588_3650777_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004152765.1|3650877_3652362_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|3652780_3653833_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3653908:3653926	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 10
NZ_CP040391	Klebsiella pneumoniae strain LSH-KPN25 chromosome, complete genome	5441138	4305833	4317487	5441138	integrase	Enterobacteria_phage(70.0%)	13	4306283:4306297	4329340:4329354
WP_004144574.1|4305833_4306937_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4306283:4306297	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4306947_4308201_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4308553_4309744_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4309731_4310682_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4310681_4311107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4311675_4312242_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4312259_4312505_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4312501_4313239_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4313780_4314047_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4314043_4314601_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4314597_4314825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4314821_4315142_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4315153_4317487_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4329340:4329354	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
