The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031694	Bacillus velezensis strain SRCM101368 chromosome, complete genome	4088134	282264	292155	4088134		Synechococcus_phage(50.0%)	9	NA	NA
WP_160249086.1|282264_283803_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	8.7e-78
WP_160249087.1|283799_284387_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.1e-25
WP_003155753.1|284383_285424_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	2.4e-63
WP_070081465.1|285515_286946_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	4.8e-54
WP_160249088.1|286921_289150_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	1.6e-157
WP_007408898.1|289133_289817_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003155758.1|289813_290068_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_146283754.1|290067_290787_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	44.3	3.7e-47
WP_003155764.1|290862_292155_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
>prophage 2
NZ_CP031694	Bacillus velezensis strain SRCM101368 chromosome, complete genome	4088134	1185627	1227552	4088134	lysis,holin,coat	Bacillus_phage(50.0%)	47	NA	NA
WP_012118753.1|1185627_1186308_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_094247391.1|1186289_1186676_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003150908.1|1186782_1187691_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069013132.1|1187693_1188512_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_069013131.1|1188508_1189183_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_024085949.1|1189198_1189378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150912.1|1189586_1190843_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_015387528.1|1190930_1191533_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_024085947.1|1191553_1192228_-	streptomycin biosynthesis StrF domain-containing protein	NA	NA	NA	NA	NA
WP_003150915.1|1192227_1192908_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003150917.1|1193125_1193287_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
WP_003150919.1|1193622_1194246_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032857211.1|1194325_1194712_+	GtrA family protein	NA	NA	NA	NA	NA
WP_095318301.1|1194959_1196501_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003150926.1|1196517_1196763_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014306059.1|1197265_1198231_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_012118743.1|1198258_1200208_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003150930.1|1200222_1200837_+	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_014419185.1|1200838_1201207_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003150937.1|1201250_1201511_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_014306057.1|1201765_1202263_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007407709.1|1202464_1203652_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_069449087.1|1203755_1204505_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_003150946.1|1204668_1205670_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069473638.1|1205711_1208123_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.8	3.8e-19
WP_003150952.1|1208648_1208963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024085942.1|1208986_1209817_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_069473637.1|1210033_1211416_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_025853636.1|1211412_1212852_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.3	2.4e-21
WP_003150958.1|1212951_1213191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150959.1|1213221_1214034_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003150960.1|1214183_1214522_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014306054.1|1214514_1215150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014306053.1|1215194_1215722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014306052.1|1215806_1216613_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012118732.1|1216627_1217311_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	3.2e-48
WP_015387535.1|1217369_1217792_+	YwdI family protein	NA	NA	NA	NA	NA
WP_160249158.1|1217810_1219130_+	purine permease	NA	NA	NA	NA	NA
WP_003150969.1|1219193_1219565_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_003150971.1|1219611_1220157_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_024085938.1|1220437_1221208_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
WP_160249159.1|1221212_1222637_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_003150976.1|1222658_1223828_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_024085937.1|1223828_1224692_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024085936.1|1224691_1225813_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014306047.1|1225802_1226546_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_024085935.1|1226547_1227552_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP031694	Bacillus velezensis strain SRCM101368 chromosome, complete genome	4088134	2581359	2587612	4088134		Staphylococcus_phage(66.67%)	9	NA	NA
WP_024085544.1|2581359_2582475_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.9	5.2e-56
WP_032857114.1|2582455_2583103_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	3.3e-39
WP_032857112.1|2583117_2584314_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	8.2e-116
WP_003153372.1|2584346_2584811_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153373.1|2584927_2585302_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_012117889.1|2585367_2585889_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153376.1|2585976_2586066_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003153377.1|2586273_2587029_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	6.5e-10
WP_003153378.1|2587018_2587612_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
>prophage 4
NZ_CP031694	Bacillus velezensis strain SRCM101368 chromosome, complete genome	4088134	2757412	2794885	4088134	integrase,holin,tail	Bacillus_phage(92.31%)	35	2748749:2748764	2802460:2802475
2748749:2748764	attL	ATACGGATATGGCTAC	NA	NA	NA	NA
WP_160249295.1|2757412_2758378_-	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.4	9.9e-80
WP_160249453.1|2758641_2759076_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_077723157.1|2759119_2759890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160249296.1|2760398_2762153_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	70.4	7.0e-241
WP_014472060.1|2762152_2762713_+	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	58.2	3.9e-52
WP_009967548.1|2763020_2763137_-	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	100.0	9.8e-11
WP_057080536.1|2763386_2763590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249297.1|2763717_2764476_+	sporulation protein YunB	NA	NA	NA	NA	NA
WP_038458779.1|2764692_2765025_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	74.5	1.8e-41
WP_160249298.1|2765017_2766268_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	92.3	5.5e-224
WP_076983515.1|2766432_2767593_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.5	1.3e-33
WP_014472510.1|2767744_2768005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160249299.1|2768361_2768613_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	86.7	1.8e-33
WP_160249300.1|2768632_2769025_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	96.9	1.2e-60
WP_160249301.1|2769139_2770186_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	51.7	1.3e-80
WP_160249302.1|2770358_2772908_-	hypothetical protein	NA	D6R401	Bacillus_phage	37.2	3.5e-140
WP_064778352.1|2772921_2773737_-	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	63.2	2.1e-94
WP_160249303.1|2774246_2774834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249304.1|2774940_2777574_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	70.5	0.0e+00
WP_102421756.1|2777588_2778350_-|tail	phage tail protein	tail	A0A1P8CWP8	Bacillus_phage	79.2	9.5e-110
WP_160249305.1|2778394_2785279_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	79.8	0.0e+00
WP_045207988.1|2785342_2785969_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	31.7	2.1e-22
WP_045207987.1|2786054_2786483_-	hypothetical protein	NA	O64047	Bacillus_phage	37.4	1.4e-14
WP_160249306.1|2786558_2787095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104679146.1|2787438_2788455_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2FM05	Brevibacillus_phage	59.7	3.7e-109
WP_160249307.1|2788429_2788846_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	69.1	3.1e-46
WP_160249454.1|2788845_2789088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079978476.1|2789449_2789644_-	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	63.0	2.6e-11
WP_160249308.1|2789977_2791312_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	35.0	4.3e-25
WP_062623492.1|2791311_2791668_-	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
WP_160249309.1|2791739_2792141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077722247.1|2792161_2792956_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	34.9	9.8e-17
WP_077722248.1|2792994_2793720_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	33.6	6.6e-28
WP_104679140.1|2793716_2794223_-	hypothetical protein	NA	O64060	Bacillus_phage	67.9	2.0e-63
WP_160249310.1|2794219_2794885_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	50.0	2.0e-47
2802460:2802475	attR	GTAGCCATATCCGTAT	NA	NA	NA	NA
>prophage 5
NZ_CP031694	Bacillus velezensis strain SRCM101368 chromosome, complete genome	4088134	2800189	2812186	4088134		Bacillus_phage(44.44%)	13	NA	NA
WP_069007107.1|2800189_2800999_-	hypothetical protein	NA	A0A0K2FLD6	Brevibacillus_phage	29.9	6.3e-19
WP_096034956.1|2801967_2802867_-	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	27.3	4.1e-11
WP_160249313.1|2803007_2803487_-	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	38.7	6.8e-13
WP_072589294.1|2803647_2804835_-	metallophosphoesterase	NA	A0A0N9SK37	Staphylococcus_phage	37.7	2.8e-68
WP_077722256.1|2804846_2805056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160249314.1|2805334_2805997_-	hypothetical protein	NA	K7PJU1	Enterobacteria_phage	39.9	7.1e-29
WP_072589291.1|2806073_2806343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589290.1|2806975_2807251_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	94.5	2.7e-38
WP_160249315.1|2807509_2810035_-	hypothetical protein	NA	O64076	Bacillus_phage	83.2	0.0e+00
WP_038458720.1|2810075_2810255_-	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	71.2	1.2e-18
WP_038458718.1|2810374_2810611_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104843421.1|2810789_2811074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249316.1|2811073_2812186_+	cell division protein FtsZ	NA	G3MBK4	Bacillus_virus	29.5	7.0e-29
>prophage 6
NZ_CP031694	Bacillus velezensis strain SRCM101368 chromosome, complete genome	4088134	2822160	2876226	4088134	integrase	Bacillus_phage(94.64%)	83	2813099:2813121	2850375:2850397
2813099:2813121	attL	CATTTTAAGAGTAAAAATAAAAT	NA	NA	NA	NA
WP_052749758.1|2822160_2822547_+	hypothetical protein	NA	F8WPL1	Bacillus_phage	48.4	4.0e-32
WP_046559787.1|2822589_2823687_-	acyltransferase	NA	NA	NA	NA	NA
WP_046559786.1|2823991_2824429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470137.1|2824522_2824726_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	80.3	4.0e-23
WP_041482335.1|2824815_2825037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559785.1|2825134_2825398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021493570.1|2825534_2826086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021493569.1|2826128_2826356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021493568.1|2826380_2826605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041482308.1|2826617_2826800_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.7	1.0e-25
WP_021493566.1|2826870_2827122_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	62.2	9.3e-22
WP_046559784.1|2827124_2827340_+	hypothetical protein	NA	O64089	Bacillus_phage	50.7	2.6e-12
WP_021493564.1|2827351_2827483_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	86.0	1.0e-16
WP_046559783.1|2827531_2828077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021493562.1|2828082_2828415_+	hypothetical protein	NA	A0A1P8CWV8	Bacillus_phage	52.9	3.1e-25
WP_022553109.1|2828497_2828908_+	HicB family protein	NA	A0A1L2JY34	Aeribacillus_phage	58.1	3.1e-38
WP_046559782.1|2829069_2830209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154018564.1|2830238_2830370_+	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_014472000.1|2830807_2831020_+	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	1.6e-22
WP_046559781.1|2831034_2831265_+	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	5.5e-21
WP_046559780.1|2831477_2832536_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	76.7	1.1e-153
WP_046559779.1|2832612_2833962_+	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	75.2	2.8e-189
WP_046559778.1|2833982_2834966_+	hypothetical protein	NA	A0A1P8CWX4	Bacillus_phage	77.7	7.4e-139
WP_021493552.1|2835186_2835408_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	79.5	2.2e-27
WP_020954129.1|2835573_2835873_+	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	50.0	1.0e-19
WP_020954128.1|2835947_2836193_+	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
WP_160249320.1|2836561_2836771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139890181.1|2836782_2836974_+	hypothetical protein	NA	R4JF30	Bacillus_phage	79.4	2.2e-23
WP_139890180.1|2836970_2837276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139890179.1|2837272_2837611_+	hypothetical protein	NA	O64111	Bacillus_phage	78.6	2.0e-43
WP_139890178.1|2837617_2838025_+	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	88.9	2.9e-65
WP_160249321.1|2838076_2838874_+	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	55.0	1.4e-71
WP_160249322.1|2838981_2839356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076983647.1|2840006_2840267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160249323.1|2840390_2840906_+	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	55.3	5.0e-46
WP_160249324.1|2840927_2841218_+	hypothetical protein	NA	A0A1P8CWY9	Bacillus_phage	92.7	1.3e-46
WP_038458648.1|2841258_2841621_+	hypothetical protein	NA	A0A140HLN5	Bacillus_phage	48.4	4.9e-32
WP_160249455.1|2841954_2842791_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	60.9	3.7e-75
WP_160249325.1|2843021_2843834_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	87.0	4.7e-139
WP_160249326.1|2843903_2844578_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	95.1	7.9e-76
WP_160249456.1|2844645_2844864_+	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	92.8	5.6e-31
WP_160249327.1|2845223_2845679_+	hypothetical protein	NA	A0A2P0ZLC1	Lactobacillus_phage	53.7	1.3e-18
WP_160249328.1|2845675_2846011_+	hypothetical protein	NA	A0A2H4J4P5	uncultured_Caudovirales_phage	72.5	7.8e-32
WP_125122798.1|2846048_2846444_+	hypothetical protein	NA	O64133	Bacillus_phage	83.2	6.1e-60
WP_160249329.1|2846527_2847349_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	66.9	2.8e-99
WP_160249330.1|2847345_2849088_+	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	68.8	1.9e-222
WP_020954103.1|2849126_2849504_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	77.0	3.4e-52
WP_160249331.1|2850026_2850401_+	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	77.4	1.2e-52
2850375:2850397	attR	CATTTTAAGAGTAAAAATAAAAT	NA	NA	NA	NA
WP_160228904.1|2850429_2851344_+	hypothetical protein	NA	O64140	Bacillus_phage	89.1	1.3e-153
WP_038458615.1|2851433_2852405_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	91.6	4.8e-167
WP_072589237.1|2852446_2852917_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	90.4	4.4e-81
WP_160249332.1|2852931_2854449_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	71.5	1.3e-211
WP_160249333.1|2854464_2855601_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	89.4	1.2e-204
WP_160249334.1|2855600_2857328_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	81.2	3.6e-274
WP_160249335.1|2857340_2861270_+	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	81.4	0.0e+00
WP_046559748.1|2861296_2862004_+	hypothetical protein	NA	O64147	Bacillus_phage	32.3	1.6e-23
WP_046559747.1|2862015_2862219_+	YorP family protein	NA	O64150	Bacillus_phage	73.1	3.6e-24
WP_046559746.1|2862378_2862876_+	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	77.6	6.9e-69
WP_046559745.1|2862915_2863263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559744.1|2863390_2863951_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_160249336.1|2863994_2864204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249337.1|2864255_2864471_+	hypothetical protein	NA	O64155	Bacillus_phage	62.9	6.5e-16
WP_160249338.1|2864746_2864944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249339.1|2865135_2865885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249340.1|2866401_2866575_+	hypothetical protein	NA	A0A1P8CX41	Bacillus_phage	78.9	6.0e-20
WP_160249341.1|2866648_2866912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249342.1|2866933_2867488_+	metallophosphoesterase	NA	A0A223LD99	Bacillus_phage	56.5	1.2e-53
WP_160249343.1|2867548_2867860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249344.1|2867875_2868052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249345.1|2868083_2868554_+	hypothetical protein	NA	O64162	Bacillus_phage	87.8	2.7e-75
WP_160249346.1|2869042_2869450_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	63.6	1.3e-36
WP_014471948.1|2869464_2869812_+	hypothetical protein	NA	O64164	Bacillus_phage	88.7	3.2e-49
WP_160249347.1|2869892_2870210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249348.1|2870255_2870573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148230871.1|2870682_2870901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080491678.1|2870935_2871163_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	81.2	5.4e-29
WP_160249349.1|2871176_2871509_+	hypothetical protein	NA	O64168	Bacillus_phage	83.7	4.7e-13
WP_020954075.1|2871543_2871693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038458556.1|2871711_2872062_+	hypothetical protein	NA	O64171	Bacillus_phage	47.5	4.5e-22
WP_160249350.1|2872058_2872454_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	85.5	9.7e-58
WP_160249457.1|2872461_2873139_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	96.4	4.8e-121
WP_038458547.1|2874787_2875012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038458545.1|2875704_2876226_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	91.9	7.5e-90
>prophage 7
NZ_CP031694	Bacillus velezensis strain SRCM101368 chromosome, complete genome	4088134	2881857	2889255	4088134		Bacillus_phage(88.89%)	14	NA	NA
WP_046559723.1|2881857_2882364_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	38.0	2.2e-30
WP_046559722.1|2882493_2882859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559721.1|2882918_2883275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559720.1|2883858_2884152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249353.1|2884512_2884692_+	hypothetical protein	NA	A0A1P8CX75	Bacillus_phage	94.8	1.3e-22
WP_072589197.1|2884795_2885008_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	98.6	1.6e-30
WP_094246821.1|2885166_2885997_+	metallophosphatase family protein	NA	O64184	Bacillus_phage	88.4	2.9e-152
WP_068947579.1|2886032_2886254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249458.1|2886280_2886616_+	hypothetical protein	NA	F8WPK8	Bacillus_phage	65.1	7.7e-40
WP_094246823.1|2886648_2886795_+	hypothetical protein	NA	A0A1P8CX49	Bacillus_phage	89.6	1.3e-15
WP_160249459.1|2887406_2887718_+	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	89.3	9.4e-48
WP_160249354.1|2887911_2888055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470254.1|2888329_2888569_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_160249355.1|2888667_2889255_+	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	85.1	9.0e-92
>prophage 8
NZ_CP031694	Bacillus velezensis strain SRCM101368 chromosome, complete genome	4088134	3160131	3166344	4088134		Bacillus_phage(50.0%)	7	NA	NA
WP_015417523.1|3160131_3161100_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
WP_003154054.1|3161148_3161373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069013563.1|3161406_3162165_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	6.2e-53
WP_160249380.1|3162213_3162834_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.4	6.0e-46
WP_024085331.1|3162882_3163872_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.3	2.5e-155
WP_003154060.1|3163889_3165992_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
WP_014305044.1|3165951_3166344_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	6.5e-30
>prophage 9
NZ_CP031694	Bacillus velezensis strain SRCM101368 chromosome, complete genome	4088134	3720780	3752589	4088134	portal,tail,plate,terminase,holin	Bacillus_phage(32.26%)	42	NA	NA
WP_014304858.1|3720780_3721659_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	2.8e-81
WP_003154813.1|3721672_3721936_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_003154815.1|3721949_3722213_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_046559521.1|3722264_3723026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154819.1|3723082_3723280_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	4.3e-14
WP_024085193.1|3723285_3723657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085192.1|3723669_3725292_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.3	5.3e-41
WP_014304854.1|3725294_3725567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154823.1|3725563_3726142_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	2.4e-12
WP_003154824.1|3726125_3727172_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	7.7e-70
WP_003154825.1|3727164_3727590_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_007610818.1|3727693_3727960_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_014304851.1|3727959_3728937_-	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.9	3.7e-34
WP_007610816.1|3728950_3729610_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_160249417.1|3729602_3734648_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	1.9e-41
WP_015239684.1|3734635_3734788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032874591.1|3734829_3735276_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_003154837.1|3735352_3735796_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_160249418.1|3735797_3737195_-|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	40.4	2.6e-81
WP_063095512.1|3737194_3737404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473357.1|3737400_3737847_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_160249419.1|3737843_3738347_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.7	5.4e-37
WP_007610806.1|3738343_3738700_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_015388357.1|3738696_3739080_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_003154848.1|3739096_3740032_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	2.5e-104
WP_015417286.1|3740058_3740904_-	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	57.6	4.3e-55
WP_099762611.1|3740935_3742315_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.4	5.1e-138
WP_003154853.1|3742363_3743662_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.6	8.5e-151
WP_003154855.1|3743658_3744456_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	50.6	9.4e-60
WP_063174226.1|3744568_3745081_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	42.7	5.0e-22
WP_003154859.1|3745193_3745397_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_063174227.1|3745386_3745728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063174228.1|3745992_3746793_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.1	6.1e-59
WP_109567437.1|3746692_3747520_-|portal	phage portal protein	portal	S6BFM4	Thermus_phage	27.9	6.4e-19
WP_003154869.1|3747509_3747689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154871.1|3747880_3748219_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_003154873.1|3748367_3748958_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154876.1|3749112_3749718_-	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.8	7.4e-41
WP_003154878.1|3749817_3750195_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	40.6	1.1e-15
WP_003154880.1|3750232_3751186_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_003154881.1|3751328_3751463_-	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_087920760.1|3751452_3752589_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
>prophage 10
NZ_CP031694	Bacillus velezensis strain SRCM101368 chromosome, complete genome	4088134	3808337	3857853	4088134	capsid,portal,tail,protease,plate,terminase,integrase,holin	Bacillus_phage(44.19%)	63	3814467:3814486	3846865:3846884
WP_069473337.1|3808337_3810167_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	60.2	8.3e-128
WP_060386872.1|3810163_3810520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473336.1|3810951_3811737_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	29.5	8.2e-16
WP_069473335.1|3811868_3812075_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069473334.1|3812099_3812345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473333.1|3812404_3812740_+	YolD-like family protein	NA	O64030	Bacillus_phage	33.7	9.9e-11
WP_069473332.1|3812754_3813120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473331.1|3813247_3813505_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.0e-23
WP_069473330.1|3813526_3814465_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	62.3	5.6e-96
3814467:3814486	attL	AAATCGTCCCCTTTTCGTTT	NA	NA	NA	NA
WP_045509347.1|3814546_3814756_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	3.4e-09
WP_069473329.1|3814759_3814948_-	XkdX family protein	NA	NA	NA	NA	NA
WP_014470931.1|3814948_3815218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076982805.1|3815232_3816816_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	52.8	6.0e-58
WP_069473328.1|3816828_3819393_-	peptidase G2	NA	D6R401	Bacillus_phage	74.6	0.0e+00
WP_069473327.1|3819407_3820808_-	endopeptidase	NA	A6M966	Geobacillus_virus	31.2	8.6e-40
WP_069473326.1|3820819_3822244_-|tail	phage tail protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	44.0	1.1e-61
WP_079890903.1|3822250_3825049_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	39.1	7.3e-99
WP_069473325.1|3825381_3825753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351570.1|3825810_3826365_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_069473324.1|3826389_3826779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473323.1|3826785_3827193_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	8.0e-31
WP_079890912.1|3827189_3827510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473321.1|3827525_3827912_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	2.1e-20
WP_069473320.1|3827926_3828145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154021547.1|3828147_3828402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473319.1|3828453_3829557_-	hypothetical protein	NA	A0A2I7S650	Vibrio_phage	27.0	1.4e-29
WP_069473318.1|3829568_3830240_-|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	46.0	7.8e-15
WP_069473317.1|3830329_3831154_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	52.7	3.1e-74
WP_069473316.1|3831153_3832785_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	58.4	1.5e-168
WP_069473315.1|3832787_3833219_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	50.4	1.7e-31
WP_014470950.1|3833235_3834990_-|terminase	phage terminase large subunit	terminase	A0A2H4J484	uncultured_Caudovirales_phage	71.6	5.7e-251
WP_069473314.1|3835072_3835621_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	2.4e-38
WP_069473313.1|3835818_3836082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473312.1|3836101_3836302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473311.1|3836384_3836654_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	53.6	6.7e-18
WP_154021546.1|3836886_3837048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473310.1|3838036_3839059_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	44.1	2.5e-12
WP_069473309.1|3839157_3839382_-	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	71.8	6.2e-09
WP_069473308.1|3839512_3840310_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	48.5	1.2e-54
WP_079890902.1|3840309_3842073_+	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	47.7	2.6e-150
WP_069473307.1|3842434_3842638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473306.1|3842743_3843181_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	72.3	4.7e-53
WP_013351549.1|3843311_3843491_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
WP_154021545.1|3843516_3843678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473305.1|3843791_3844592_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	9.1e-71
WP_069473304.1|3844679_3845222_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	45.6	8.5e-20
WP_069473302.1|3845638_3846817_-	N-6 DNA methylase	NA	A0A0N9ST12	Paenibacillus_phage	65.3	2.0e-146
WP_128969811.1|3846933_3847326_+	hypothetical protein	NA	NA	NA	NA	NA
3846865:3846884	attR	AAATCGTCCCCTTTTCGTTT	NA	NA	NA	NA
WP_069473301.1|3847308_3847884_-	hypothetical protein	NA	M4HPU2	Bacillus_phage	38.9	9.2e-33
WP_069473300.1|3847981_3848794_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	53.7	3.2e-31
WP_069473299.1|3848906_3849452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473298.1|3849470_3850037_-	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	61.8	6.8e-28
WP_069473676.1|3850063_3850813_-	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	69.6	2.6e-88
WP_069473297.1|3850828_3851107_-	hypothetical protein	NA	A0A2D0YUP5	Vibrio_phage	47.8	7.1e-15
WP_069473296.1|3851129_3851330_-	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	87.7	6.9e-28
WP_069473295.1|3851330_3851954_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	54.8	2.8e-43
WP_154021544.1|3851950_3852097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076982823.1|3852207_3853173_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	77.7	1.7e-143
WP_069473294.1|3853207_3853720_-	HNH endonuclease	NA	A0A1V0DYB1	Dinoroseobacter_phage	42.9	3.3e-13
WP_154021543.1|3854900_3855515_-	GIY-YIG nuclease family protein	NA	A0A249XZW2	Enterococcus_phage	67.0	1.4e-66
WP_069473292.1|3856697_3857054_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	54.2	2.1e-27
WP_025851616.1|3857058_3857244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473291.1|3857490_3857853_-	hypothetical protein	NA	A0A140HLL8	Bacillus_phage	36.8	3.3e-12
>prophage 11
NZ_CP031694	Bacillus velezensis strain SRCM101368 chromosome, complete genome	4088134	3867618	3893192	4088134	integrase,coat	Bacillus_phage(53.85%)	33	3876963:3876978	3878457:3878472
WP_069473278.1|3867618_3868797_-	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	31.3	2.5e-48
WP_079890901.1|3869157_3869397_+	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	39.7	8.0e-07
WP_069473276.1|3869413_3870409_-	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	46.2	1.8e-71
WP_025851649.1|3870543_3871938_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.9	2.6e-129
WP_069473275.1|3871934_3872159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473274.1|3872155_3872683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473273.1|3872679_3873459_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	55.2	8.3e-77
WP_069473272.1|3873478_3873691_-	hypothetical protein	NA	U5Q038	Bacillus_phage	68.1	1.3e-19
WP_160249427.1|3873687_3874731_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	47.5	2.0e-70
WP_069473270.1|3874992_3875361_-	hypothetical protein	NA	A0A142F1P2	Bacillus_phage	41.9	1.7e-27
WP_069473269.1|3875773_3876097_-	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	36.8	1.7e-07
WP_025851674.1|3876506_3876926_-	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	2.7e-34
3876963:3876978	attL	CCGTCAATTTTGCGAC	NA	NA	NA	NA
WP_069473267.1|3877067_3878114_-|integrase	tyrosine-type recombinase/integrase	integrase	Q938N9	Temperate_phage	27.0	1.1e-07
WP_003154961.1|3878484_3879660_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
3878457:3878472	attR	GTCGCAAAATTGACGG	NA	NA	NA	NA
WP_015388436.1|3879652_3880774_-	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_015388437.1|3881143_3881866_+	esterase family protein	NA	NA	NA	NA	NA
WP_003154969.1|3881891_3882407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154971.1|3882411_3882843_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003154973.1|3883003_3883237_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_139890380.1|3883237_3883975_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.3	5.2e-28
WP_160249428.1|3883967_3884690_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_139890382.1|3884731_3885481_-	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_003154980.1|3885549_3885804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160249429.1|3885924_3888210_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.6	1.4e-84
WP_003154986.1|3888278_3888533_-	sporulation protein	NA	NA	NA	NA	NA
WP_003154988.1|3888695_3888863_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_160249430.1|3888954_3889152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388440.1|3889437_3889794_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_003154992.1|3889964_3890351_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_070081638.1|3890388_3890703_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154995.1|3891453_3891936_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154997.1|3892081_3892525_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_077722066.1|3892583_3893192_-|coat	spore coat protein	coat	NA	NA	NA	NA
