The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028273	Mixta theicola strain SRCM103227 chromosome, complete genome	4564909	10861	99315	4564909	head,tail,portal,integrase,holin,plate,tRNA,lysis,capsid,terminase	Salmonella_phage(47.5%)	110	29044:29076	61674:61706
WP_141177222.1|10861_12277_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	29.0	1.6e-14
WP_141177223.1|12332_12542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160249614.1|12654_13257_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_141177244.1|13505_13871_-	hypothetical protein	NA	R9TR46	Vibrio_phage	59.3	1.7e-19
WP_160249615.1|14272_14860_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	52.8	1.1e-52
WP_141177226.1|14992_15256_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	60.9	2.1e-24
WP_141177245.1|15354_15738_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	71.2	1.2e-44
WP_160249616.1|15818_16034_+	DUF2732 family protein	NA	F1BUS3	Erwinia_phage	53.3	1.9e-07
WP_141177228.1|16033_16255_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	67.6	8.2e-22
WP_160249617.1|16254_18489_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	73.1	0.0e+00
WP_141177230.1|18692_18878_+	hypothetical protein	NA	F1BUR9	Erwinia_phage	60.0	2.1e-10
WP_160249618.1|19552_19858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141177232.1|19854_20058_+|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	83.6	4.1e-28
WP_141177233.1|20064_20271_+	hypothetical protein	NA	F1BUQ4	Erwinia_phage	79.1	3.9e-26
WP_160249619.1|20274_20784_+	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	63.5	2.9e-54
WP_160249620.1|20780_21230_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	74.8	4.5e-51
WP_160251305.1|21304_21772_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	69.3	4.4e-57
WP_160249621.1|22197_22782_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	80.9	6.6e-87
WP_141177237.1|22778_23129_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	83.6	8.6e-50
WP_160249622.1|23133_24042_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	86.4	5.2e-139
WP_141177239.1|24034_24643_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	87.1	4.2e-100
WP_160249623.1|24639_25590_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	82.2	3.1e-78
WP_167519760.1|25576_25750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249624.1|25926_26400_+|tail	tail fiber assembly protein	tail	F1BUP0	Erwinia_phage	65.0	1.6e-59
WP_167519756.1|26519_26807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160249626.1|26868_27279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141177758.1|27315_27906_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	76.2	4.7e-72
WP_160249627.1|27975_29145_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	93.8	1.0e-208
29044:29076	attL	GATTACGACTATACGCCGGTGCCGCCGCTGGAA	NA	NA	NA	NA
WP_141177756.1|29157_29670_+|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	93.5	2.0e-87
WP_141177755.1|29729_30026_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	79.6	1.0e-35
WP_141177754.1|30040_30163_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	75.0	2.5e-09
WP_160249628.1|30155_32327_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	40.9	1.7e-119
WP_141177752.1|32330_32828_+|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	65.2	8.8e-48
WP_160249629.1|32833_33976_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	48.0	1.9e-98
WP_141177750.1|34060_34279_+	transcriptional regulator	NA	F1BUT0	Erwinia_phage	76.1	2.3e-24
WP_141177748.1|35815_36253_+	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	70.1	3.6e-53
WP_160251306.1|36258_36576_+	DUF1493 family protein	NA	A0A218M4K1	Erwinia_phage	57.4	8.1e-31
WP_160249630.1|36800_37853_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.2	5.0e-117
WP_160249631.1|37858_38407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160249632.1|38430_39045_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	41.3	6.6e-37
WP_160249633.1|39145_39382_+	regulator	NA	NA	NA	NA	NA
WP_160249634.1|39416_39926_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	91.7	1.6e-81
WP_160249635.1|39933_40134_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	86.4	4.0e-28
WP_160249636.1|40097_40439_+	DUF5347 family protein	NA	E5G6L5	Salmonella_phage	87.6	2.0e-51
WP_160249637.1|40506_40734_+	DUF2732 family protein	NA	A0A0M3UL87	Salmonella_phage	68.8	9.9e-15
WP_160249638.1|40733_40961_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	85.3	2.6e-31
WP_160249639.1|40957_41284_+	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	50.6	1.7e-12
WP_160249640.1|41268_42123_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	79.9	5.1e-128
WP_160249641.1|42119_44522_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	93.7	0.0e+00
WP_167519761.1|44638_44812_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	70.2	7.1e-13
WP_160249642.1|44856_45090_+	DinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	62.3	1.2e-20
WP_160249643.1|45195_45885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249644.1|45886_46066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160249645.1|46374_47430_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	1.8e-175
WP_160249646.1|47426_48134_-|terminase	terminase-like family protein	terminase	A0A1S6KZW3	Salmonella_phage	32.1	3.3e-24
WP_160249647.1|48133_49900_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	95.1	0.0e+00
WP_160249648.1|50041_50875_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.1	3.4e-129
WP_160249649.1|50891_51953_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.1	1.9e-188
WP_160249650.1|51985_52636_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	97.7	6.0e-113
WP_160249651.1|52729_53194_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	90.3	4.5e-78
WP_160249652.1|53193_53397_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	94.0	2.3e-31
WP_160249653.1|53400_53616_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	2.3e-29
WP_160249654.1|53596_54109_+	glycoside hydrolase family protein	NA	A0A1S6KZY9	Salmonella_phage	92.3	1.1e-88
WP_167519762.1|54105_54534_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	56.0	1.8e-33
WP_160249656.1|54629_55055_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	75.7	9.8e-56
WP_160249657.1|55054_55501_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	2.5e-62
WP_160249658.1|55442_56246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160249659.1|56348_56927_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	95.8	1.6e-104
WP_160249660.1|56923_57283_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	93.3	1.4e-55
WP_160249661.1|57269_58178_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	3.0e-142
WP_160249662.1|58170_58776_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	92.5	2.9e-109
WP_160249663.1|58772_59876_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	45.8	9.2e-106
WP_160249664.1|59875_60475_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	43.3	3.3e-41
WP_160249665.1|60602_61775_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.3	6.2e-209
61674:61706	attR	GATTACGACTATACGCCGGTGCCGCCGCTGGAA	NA	NA	NA	NA
WP_160249666.1|61787_62303_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	95.9	5.6e-90
WP_160249667.1|62352_62655_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	92.0	2.2e-41
WP_160249668.1|62669_62789_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	8.2e-13
WP_160249669.1|62781_65589_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.7	3.9e-294
WP_160249670.1|65585_66071_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	87.0	4.5e-65
WP_160249671.1|66067_67168_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	89.6	1.3e-184
WP_160249672.1|67237_67456_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	79.2	1.2e-28
WP_160249673.1|67886_68405_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_141177746.1|68536_70381_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_160249674.1|70652_72398_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.9	7.1e-76
WP_001144069.1|72519_72735_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_141177744.1|73035_74052_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.1e-108
WP_141177743.1|74522_74732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141177742.1|75040_75640_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_141177741.1|75747_76107_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_141177740.1|76274_77093_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_160249675.1|77142_78369_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	45.3	1.9e-88
WP_141177762.1|78554_79175_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_160249676.1|79382_80687_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_160249677.1|80706_83565_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_160249678.1|83646_85068_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	31.1	6.6e-40
WP_160249679.1|85219_85612_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_141177734.1|86006_86663_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	42.4	8.6e-43
WP_141177733.1|86811_87195_-	cell wall hydrolase	NA	M1F286	Cronobacter_phage	45.2	5.6e-18
WP_141177732.1|87336_88104_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_160249680.1|88299_89085_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_141177730.1|89122_90283_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	4.5e-87
WP_141177729.1|90291_90951_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	50.0	1.0e-43
WP_160249681.1|91152_92622_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_141177727.1|92837_93473_+	ADP-ribose diphosphatase	NA	NA	NA	NA	NA
WP_141177726.1|93469_93895_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_160249682.1|93937_94765_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_141177724.1|94768_95350_+	esterase YqiA	NA	NA	NA	NA	NA
WP_141177723.1|95400_97296_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.4	3.2e-90
WP_141177722.1|97740_98541_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_141177721.1|99003_99315_+|holin	holin	holin	NA	NA	NA	NA
>prophage 2
NZ_CP028273	Mixta theicola strain SRCM103227 chromosome, complete genome	4564909	1806999	1821064	4564909	tRNA	Pandoravirus(11.11%)	14	NA	NA
WP_141174273.1|1806999_1808046_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	48.0	2.0e-81
WP_160250315.1|1808111_1809551_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	41.0	4.2e-58
WP_160250316.1|1809627_1810368_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_141174276.1|1810737_1811199_-	endopeptidase	NA	A0A217EQL1	Bacillus_phage	32.2	3.8e-13
WP_160250317.1|1811270_1812020_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	1.5e-06
WP_141174278.1|1812022_1812568_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_160250318.1|1812602_1813586_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_038626354.1|1813895_1814195_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	9.4e-13
WP_160250319.1|1814199_1816587_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.1	1.5e-07
WP_141174281.1|1816601_1817585_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.1	1.4e-33
WP_010616241.1|1817897_1818254_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_038626362.1|1818294_1818492_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_038626364.1|1818589_1819132_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.3	6.3e-15
WP_141174282.1|1819135_1821064_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	2.1e-129
>prophage 3
NZ_CP028273	Mixta theicola strain SRCM103227 chromosome, complete genome	4564909	1932469	1961352	4564909	bacteriocin,plate	Leptospira_phage(25.0%)	23	NA	NA
WP_160250359.1|1932469_1932919_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_048961337.1|1932932_1933208_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_127353648.1|1933211_1933421_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_048961353.1|1933518_1933782_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_167519770.1|1933785_1937355_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_048961339.1|1937359_1937884_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_160250360.1|1937919_1939002_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_160250361.1|1938965_1940735_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_160250362.1|1940768_1942376_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_160250363.1|1942372_1943392_-	hypothetical protein	NA	S5WA20	Leptospira_phage	22.7	1.4e-07
WP_160250364.1|1943394_1946766_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_160250365.1|1946758_1947967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418592.1|1947969_1948233_-	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	8.8e-07
WP_160251340.1|1948295_1948595_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_160250366.1|1948854_1949241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160250367.1|1949242_1949599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160250368.1|1949588_1951937_-	hypothetical protein	NA	S5VZH2	Pseudomonas_phage	40.6	5.1e-29
WP_160250369.1|1951952_1954310_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_160250370.1|1954306_1956979_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.7	1.2e-93
WP_021241774.1|1957142_1957634_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_160250371.1|1957649_1959317_-	OmpA family protein	NA	NA	NA	NA	NA
WP_048959595.1|1959316_1960006_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_048959594.1|1960002_1961352_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 4
NZ_CP028273	Mixta theicola strain SRCM103227 chromosome, complete genome	4564909	1968713	1976540	4564909	integrase	Burkholderia_phage(33.33%)	7	1971166:1971179	1981685:1981698
WP_048959589.1|1968713_1969946_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	40.1	3.2e-75
WP_167519784.1|1970039_1971443_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	51.4	6.2e-107
1971166:1971179	attL	CCTGCAAAAAGATC	NA	NA	NA	NA
WP_160250372.1|1971757_1972123_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	43.0	1.6e-14
WP_160250373.1|1972128_1973085_-	recombinase	NA	A0A222YXF2	Escherichia_phage	69.8	2.2e-127
WP_048959586.1|1973579_1973798_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	40.0	8.1e-06
WP_160250374.1|1973958_1975191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048959584.1|1975337_1976540_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	38.2	8.1e-55
1981685:1981698	attR	CCTGCAAAAAGATC	NA	NA	NA	NA
>prophage 5
NZ_CP028273	Mixta theicola strain SRCM103227 chromosome, complete genome	4564909	2580889	2588233	4564909	protease	Bacillus_virus(33.33%)	6	NA	NA
WP_141177094.1|2580889_2581162_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	58.4	2.2e-21
WP_141177095.1|2581374_2583729_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.0	6.5e-226
WP_160250601.1|2583919_2585194_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	3.9e-132
WP_141178109.1|2585451_2586042_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	35.8	5.6e-25
WP_160250602.1|2586225_2587500_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.1	1.5e-131
WP_141176754.1|2587609_2588233_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	8.4e-64
>prophage 6
NZ_CP028273	Mixta theicola strain SRCM103227 chromosome, complete genome	4564909	2753856	2763495	4564909	lysis,integrase	Enterobacteria_phage(36.36%)	12	2757802:2757815	2760669:2760682
WP_160250666.1|2753856_2754435_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	62.3	2.6e-59
WP_160250667.1|2754741_2755197_-|lysis	lysis protein	lysis	K7P6Y5	Enterobacteria_phage	51.4	7.1e-28
WP_167519791.1|2755177_2755684_-	glycoside hydrolase family protein	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	71.3	6.0e-68
WP_160250669.1|2755693_2755924_-|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	82.9	7.2e-29
WP_160250670.1|2756183_2756477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160250671.1|2756774_2757389_-	hypothetical protein	NA	A0A2H4JCH5	uncultured_Caudovirales_phage	41.7	1.6e-38
WP_160250672.1|2757614_2757812_-	hypothetical protein	NA	M9NZE6	Enterobacteria_phage	81.5	2.2e-26
2757802:2757815	attL	TCATAAATCACGCC	NA	NA	NA	NA
WP_160251357.1|2757808_2758300_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	56.5	3.4e-44
WP_160250673.1|2758417_2759578_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PKD7	Enterobacteria_phage	85.2	3.8e-203
WP_160250674.1|2759773_2761027_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.8	7.0e-94
2760669:2760682	attR	TCATAAATCACGCC	NA	NA	NA	NA
WP_160250675.1|2761037_2762141_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	1.9e-58
WP_160250676.1|2762385_2763495_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	51.2	1.2e-97
>prophage 7
NZ_CP028273	Mixta theicola strain SRCM103227 chromosome, complete genome	4564909	3256534	3273316	4564909	tail,integrase	Salmonella_phage(25.0%)	16	3243905:3243919	3278395:3278409
3243905:3243919	attL	GGCTTTACCACCGTC	NA	NA	NA	NA
WP_160250849.1|3256534_3259669_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	27.7	7.2e-79
WP_160250850.1|3259743_3260622_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_163219497.1|3261539_3263939_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	32.1	2.2e-99
WP_001747644.1|3264165_3264285_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_001292737.1|3264299_3264611_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	66.0	2.4e-27
WP_001185338.1|3264987_3265260_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	6.3e-08
WP_032435931.1|3265259_3266021_-	septation initiation protein	NA	NA	NA	NA	NA
WP_000211874.1|3266420_3269093_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	2.1e-58
WP_040172563.1|3269089_3269473_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001027149.1|3269469_3269754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418135.1|3269785_3270145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118612.1|3270137_3270314_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_000190567.1|3270501_3270687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000455466.1|3270783_3271014_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_032428940.1|3271384_3272023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077139007.1|3272053_3273316_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	35.6	2.8e-66
3278395:3278409	attR	GGCTTTACCACCGTC	NA	NA	NA	NA
>prophage 8
NZ_CP028273	Mixta theicola strain SRCM103227 chromosome, complete genome	4564909	3773611	3854746	4564909	bacteriocin,integrase,tRNA	Enterobacteria_phage(18.18%)	60	3768753:3768768	3795031:3795046
3768753:3768768	attL	GCGCTGCTGATGAAAG	NA	NA	NA	NA
WP_141176225.1|3773611_3774523_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_160251013.1|3774748_3775747_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.8	2.4e-12
WP_141176223.1|3775801_3777268_-	xylulokinase	NA	NA	NA	NA	NA
WP_141176222.1|3777286_3778609_-	xylose isomerase	NA	NA	NA	NA	NA
WP_141176221.1|3778969_3779962_+	D-xylose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160251014.1|3780079_3781612_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	8.5e-17
WP_141176219.1|3781604_3782780_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_141176218.1|3782870_3784046_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_160251015.1|3784478_3785684_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.3	8.7e-158
WP_160251016.1|3785721_3786810_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	32.7	1.5e-39
WP_160251017.1|3786793_3787423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160251018.1|3788093_3788567_-	adhesin	NA	NA	NA	NA	NA
WP_160251019.1|3788529_3788928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160251020.1|3789057_3789774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160251021.1|3789988_3797659_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	38.3	2.7e-50
3795031:3795046	attR	CTTTCATCAGCAGCGC	NA	NA	NA	NA
WP_141177826.1|3797749_3798358_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	32.6	1.3e-16
WP_160251022.1|3798407_3798935_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_160251023.1|3798934_3800629_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_141177784.1|3801648_3802449_-	NLPA lipoprotein	NA	NA	NA	NA	NA
WP_160251024.1|3802467_3803364_-	DUF169 domain-containing protein	NA	NA	NA	NA	NA
WP_141177782.1|3803332_3804007_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_160251025.1|3804049_3805018_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.6	3.1e-25
WP_160251026.1|3805247_3806495_-	response regulator	NA	NA	NA	NA	NA
WP_160251027.1|3806484_3808494_-	two-component system sensor histidine kinase PgtB	NA	NA	NA	NA	NA
WP_160251028.1|3808490_3809762_-	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
WP_160251029.1|3810113_3811499_+	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
WP_141177776.1|3811557_3812874_-	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_141177775.1|3812870_3815069_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_106875989.1|3815325_3815430_-	DUF2618 domain-containing protein	NA	NA	NA	NA	NA
WP_141177774.1|3815777_3816299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141177773.1|3816453_3816906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160251030.1|3816982_3820528_-	AAA family ATPase	NA	G3MAX6	Bacillus_virus	40.7	7.0e-46
WP_160251031.1|3820958_3822338_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_141177770.1|3822352_3822850_-	carbohydrate transporter	NA	NA	NA	NA	NA
WP_141177769.1|3822937_3824323_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_141177768.1|3824337_3825303_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_160251032.1|3825299_3826643_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_160251033.1|3826666_3828064_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_141177765.1|3828231_3829083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160251034.1|3829098_3830061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160251035.1|3830409_3831114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160251036.1|3831110_3831548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160251037.1|3831612_3832830_-	ROK family protein	NA	NA	NA	NA	NA
WP_160251038.1|3832945_3836221_+	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_141178069.1|3836293_3837733_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_160251039.1|3837732_3838554_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_160251040.1|3839065_3840223_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	29.2	4.3e-21
WP_160251041.1|3840215_3841505_+	MFS transporter	NA	NA	NA	NA	NA
WP_160251042.1|3842238_3842475_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_160251043.1|3843437_3844520_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	61.6	1.4e-114
WP_160251375.1|3844650_3847746_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	70.6	0.0e+00
WP_160251044.1|3847814_3849077_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_160251045.1|3849433_3850873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160251046.1|3850883_3851234_+	DUF596 domain-containing protein	NA	NA	NA	NA	NA
WP_160251047.1|3851518_3851776_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_160251376.1|3852012_3852807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160251048.1|3852818_3853076_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_160251049.1|3853371_3853629_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_160251050.1|3853919_3854177_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_160251051.1|3854491_3854746_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 9
NZ_CP028273	Mixta theicola strain SRCM103227 chromosome, complete genome	4564909	4075359	4126462	4564909	protease,head,portal,tail,integrase,holin,tRNA,capsid,terminase	Cronobacter_phage(54.29%)	60	4078634:4078681	4108105:4108152
WP_160251132.1|4075359_4075833_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_141177534.1|4075868_4077242_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	2.1e-14
WP_141177533.1|4077238_4077937_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_141177532.1|4078088_4078604_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4078634:4078681	attL	CACCATCCCTGTCTTCCCCGCCATGATGGCGGGGTTTTTTTTATCAGG	NA	NA	NA	NA
WP_160251133.1|4078786_4079767_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	80.7	5.8e-152
WP_160251134.1|4079879_4080173_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	58.8	2.9e-27
WP_160251135.1|4080330_4080603_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	82.2	1.2e-38
WP_160251136.1|4080613_4080835_+	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	51.5	1.0e-11
WP_160251137.1|4080850_4081249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160251138.1|4081324_4081555_+	DUF2732 family protein	NA	A0A218M4I9	Erwinia_phage	54.2	3.4e-10
WP_160251139.1|4081554_4081788_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	77.9	1.8e-27
WP_160251140.1|4081784_4082111_+	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	50.6	1.3e-12
WP_160251141.1|4082095_4082950_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	79.9	1.9e-127
WP_160251142.1|4085476_4085740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160251143.1|4085720_4086230_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_160251144.1|4086293_4086776_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_167519793.1|4086978_4087266_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	56.8	2.9e-27
WP_160251384.1|4087301_4088324_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	63.4	2.5e-121
WP_160251146.1|4088362_4090177_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	55.0	2.3e-186
WP_160251147.1|4090351_4091410_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	42.2	1.7e-32
WP_160251148.1|4091434_4092463_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	52.9	2.3e-95
WP_160251149.1|4092466_4093171_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	58.8	9.5e-72
WP_160251150.1|4093274_4093748_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	55.8	2.0e-33
WP_160251151.1|4093744_4094221_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	38.7	2.8e-27
WP_160251152.1|4094256_4094913_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	58.9	4.2e-66
WP_160251153.1|4094915_4096058_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	61.1	3.7e-126
WP_160251154.1|4096060_4096516_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	52.3	2.3e-39
WP_160251155.1|4096519_4096822_+|holin	holin	holin	NA	NA	NA	NA
WP_160251156.1|4096818_4097160_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	82.2	3.3e-46
WP_160251157.1|4097159_4097540_+	hypothetical protein	NA	A0A2I6PD12	Escherichia_phage	40.0	8.3e-06
WP_160251158.1|4097645_4097915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160251159.1|4097923_4098103_+	hypothetical protein	NA	A5X9I8	Aeromonas_virus	65.2	3.2e-08
WP_160251160.1|4098104_4100090_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	40.4	1.4e-133
WP_160251161.1|4100086_4100422_+	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	58.4	4.0e-28
WP_160251162.1|4100414_4101599_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	71.2	5.3e-160
WP_160251163.1|4101591_4102176_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	67.7	1.1e-76
WP_160251164.1|4102185_4103943_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	77.3	7.0e-124
WP_160251165.1|4103952_4104480_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	52.6	4.2e-40
WP_160251166.1|4104479_4105202_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	40.2	1.1e-30
WP_160251167.1|4105173_4105707_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	53.8	1.7e-41
WP_160251168.1|4105714_4107439_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	55.0	4.3e-174
WP_160251169.1|4107540_4107906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160251170.1|4108781_4109837_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
4108105:4108152	attR	CACCATCCCTGTCTTCCCCGCCATGATGGCGGGGTTTTTTTTATCAGG	NA	NA	NA	NA
WP_141177530.1|4110224_4111121_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_141177529.1|4111334_4112297_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_141177528.1|4112437_4113427_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160251171.1|4113509_4114301_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_141177526.1|4114305_4115070_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_141177525.1|4115193_4115799_-	DUF1454 family protein	NA	NA	NA	NA	NA
WP_141177524.1|4115903_4116338_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_160251172.1|4116344_4117091_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_160251173.1|4117395_4118574_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	21.7	7.3e-08
WP_141177521.1|4118577_4119588_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_160251385.1|4119684_4121199_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_141177519.1|4121229_4122087_-	MIP family channel protein	NA	NA	NA	NA	NA
WP_141177518.1|4122536_4122776_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_141177517.1|4122914_4123400_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_141177516.1|4123507_4124431_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_141177515.1|4124588_4125920_-	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	29.2	7.9e-43
WP_160251174.1|4125931_4126462_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 1
NZ_CP028274	Mixta theicola strain SRCM103227 plasmid unnamed1, complete sequence	82504	28863	33965	82504	integrase	Escherichia_phage(50.0%)	7	25682:25695	38429:38442
25682:25695	attL	GGCCTGTAACCACT	NA	NA	NA	NA
WP_032650502.1|28863_29643_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	1.3e-50
WP_032650503.1|29740_30019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032650505.1|30018_30657_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	45.8	1.2e-44
WP_032650507.1|30896_31868_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.6	8.2e-66
WP_032650508.1|31872_32262_+	plasmid stability protein	NA	A0A222YWJ6	Escherichia_phage	46.0	7.2e-05
WP_155026682.1|32265_33537_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.2	5.9e-157
WP_032650510.1|33536_33965_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.3	2.1e-29
38429:38442	attR	GGCCTGTAACCACT	NA	NA	NA	NA
