The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	0	8429	3223644		Lactobacillus_phage(100.0%)	13	NA	NA
WP_087615016.1|370_619_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IX93	Lactobacillus_phage	65.7	7.3e-19
WP_087615017.1|619_1405_+	phage antirepressor KilAC domain-containing protein	NA	E9LUT0	Lactobacillus_phage	97.3	3.0e-58
WP_157664745.1|1932_2136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087615019.1|2101_2545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087615020.1|2955_3216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087615021.1|3358_3613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033614714.1|3928_4462_+	hypothetical protein	NA	E9LUU0	Lactobacillus_phage	98.3	1.1e-91
WP_087615022.1|4470_5133_+	AAA family ATPase	NA	E9LUU1	Lactobacillus_phage	97.7	4.4e-119
WP_087615023.1|5134_5794_+	DUF669 domain-containing protein	NA	O03912	Lactobacillus_phage	80.8	2.6e-95
WP_087615024.1|5840_6533_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	97.8	2.0e-130
WP_157664746.1|6574_7411_+	helix-turn-helix domain-containing protein	NA	U5U793	Lactobacillus_phage	42.6	2.5e-39
WP_003644539.1|7414_7723_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	92.2	2.7e-47
WP_087615026.1|7997_8429_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	90.2	1.3e-71
>prophage 2
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	11505	52782	3223644	holin,terminase,capsid,tail,head,protease,tRNA,portal	Lactobacillus_phage(84.62%)	41	NA	NA
WP_087615030.1|11505_11685_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	72.9	1.6e-15
WP_160244447.1|11653_12175_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	99.3	6.8e-83
WP_085776089.1|12385_12841_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	97.4	6.1e-80
WP_160244449.1|12850_14749_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	93.5	0.0e+00
WP_063488413.1|14738_14933_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	95.3	1.8e-25
WP_160244450.1|14935_16129_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.7	1.5e-223
WP_160244451.1|16106_16865_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	94.8	3.8e-127
WP_160244452.1|16864_18097_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	92.4	1.7e-209
WP_087615033.1|18169_18502_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	86.4	4.2e-46
WP_087615034.1|18491_18839_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	72.2	2.0e-43
WP_087615035.1|18841_19249_+	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	91.5	3.2e-64
WP_087615036.1|19248_19629_+	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	90.5	1.0e-59
WP_085764053.1|19645_20299_+|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	95.4	5.4e-114
WP_087615037.1|20371_20746_+	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	96.0	3.2e-58
WP_003644519.1|20784_20976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087615038.1|21007_25756_+	peptidase M23	NA	A0A2P0ZLG0	Lactobacillus_phage	62.3	0.0e+00
WP_087615039.1|25830_27600_+|tail	phage tail protein	tail	E9LUR2	Lactobacillus_phage	94.0	0.0e+00
WP_087615040.1|27669_30039_+	hypothetical protein	NA	E9LUR3	Lactobacillus_phage	96.8	0.0e+00
WP_087615041.1|30055_32845_+|tail	phage tail protein	tail	E9LUR4	Lactobacillus_phage	98.8	0.0e+00
WP_087615042.1|32837_33089_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	95.8	2.1e-29
WP_087615043.1|34267_35440_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	92.1	6.4e-198
WP_087615044.1|35439_35703_+|holin	holin	holin	E9LUR9	Lactobacillus_phage	97.7	7.4e-38
WP_087615270.1|35717_36095_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	62.5	1.7e-14
WP_003644508.1|36834_38046_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_087615045.1|38524_40267_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003645638.1|40285_41077_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.5e-30
WP_003644505.1|41057_42242_+	LCP family protein	NA	NA	NA	NA	NA
WP_063722578.1|42393_42966_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003644504.1|43717_44659_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	49.0	2.4e-78
WP_003644503.1|45103_45496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640750.1|45659_46052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640749.1|46087_47257_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003644502.1|47306_47936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262971.1|48309_48402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640747.1|48490_49123_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_003644501.1|49274_49514_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640745.1|49611_49848_+	YneF family protein	NA	NA	NA	NA	NA
WP_003645630.1|49904_50540_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003644499.1|50651_51410_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003640742.1|51393_51699_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003640741.1|51783_52782_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
>prophage 3
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	57408	58188	3223644		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003640735.1|57408_58188_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
>prophage 4
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	62546	72088	3223644		Bradyrhizobium_phage(50.0%)	6	NA	NA
WP_003640729.1|62546_66860_+	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_003640728.1|67155_67632_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003640727.1|67652_68870_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003640726.1|68914_69214_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003640725.1|69203_69509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046947639.1|69523_72088_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
>prophage 5
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	84431	95653	3223644		Tupanvirus(40.0%)	9	NA	NA
WP_003640711.1|84431_86300_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	47.2	7.7e-137
WP_003640710.1|86401_87544_+	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	32.0	4.3e-21
WP_003645971.1|87977_89153_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003640708.1|89184_89334_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003640707.1|89376_90903_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	27.6	7.6e-42
WP_003640706.1|90899_92114_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.5	1.9e-27
WP_003640705.1|92137_92380_+	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_087615046.1|92376_93654_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003640703.1|93817_95653_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	1.5e-23
>prophage 6
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	99600	116787	3223644	tRNA	Salmonella_phage(14.29%)	16	NA	NA
WP_003640696.1|99600_101868_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	S4TRQ0	Salmonella_phage	43.6	2.4e-07
WP_003640695.1|101877_102324_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_060683986.1|102396_103020_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_072540667.1|103127_103970_-	phosphotransferase	NA	NA	NA	NA	NA
WP_003640692.1|104238_105087_-	SH3 domain-containing protein	NA	C8CHK8	Thermus_virus	39.6	1.0e-11
WP_003640691.1|105477_106758_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640690.1|106799_108596_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SFI4	Hokovirus	30.2	3.0e-05
WP_003644477.1|108676_109207_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003640688.1|109409_110285_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	29.7	5.9e-23
WP_003640687.1|110658_111819_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_003640686.1|111931_112828_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.7	4.4e-21
WP_003640685.1|112885_113611_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003640684.1|113752_114571_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_003638914.1|114803_114992_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003640683.1|115033_115477_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	35.6	5.5e-17
WP_003644473.1|115809_116787_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	49.3	2.2e-50
>prophage 7
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	122994	126063	3223644		Helicobacter_phage(50.0%)	2	NA	NA
WP_011101607.1|122994_124875_+	DNA primase	NA	A0A1S5RH72	Helicobacter_phage	30.1	7.2e-50
WP_003640674.1|124956_126063_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.4	3.7e-38
>prophage 8
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	135969	136857	3223644		Cedratvirus(100.0%)	1	NA	NA
WP_003640656.1|135969_136857_+	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	30.7	9.0e-19
>prophage 9
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	159147	160437	3223644		Streptococcus_phage(100.0%)	1	NA	NA
WP_013355578.1|159147_160437_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.0	1.4e-105
>prophage 10
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	168444	172618	3223644		Hokovirus(50.0%)	3	NA	NA
WP_024521611.1|168444_170841_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	31.5	4.6e-118
WP_003644447.1|170995_171502_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015825612.1|171676_172618_+	daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.9	3.6e-26
>prophage 11
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	178377	185550	3223644		Vibrio_phage(50.0%)	3	NA	NA
WP_011101584.1|178377_180981_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	34.0	1.9e-125
WP_013355569.1|181629_181830_-	YjzD family protein	NA	NA	NA	NA	NA
WP_087615058.1|182199_185550_+	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	32.8	2.9e-150
>prophage 12
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	188684	198654	3223644	transposase	uncultured_Mediterranean_phage(40.0%)	11	NA	NA
WP_044429853.1|188684_189149_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.2	8.8e-18
WP_003640601.1|190208_190667_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_003640600.1|190722_191610_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_087615271.1|191617_192508_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.0	1.7e-38
WP_003644440.1|192546_192930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640597.1|192895_193663_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	3.3e-09
WP_003640596.1|193649_194249_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.5	1.6e-11
WP_003640595.1|194248_194965_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003644438.1|195264_195849_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003640593.1|196184_197228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640592.1|197214_198654_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.9	3.9e-56
>prophage 13
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	203134	203410	3223644		Bacillus_phage(100.0%)	1	NA	NA
WP_003640587.1|203134_203410_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	69.7	6.8e-26
>prophage 14
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	206866	216609	3223644	tRNA	unidentified_phage(20.0%)	10	NA	NA
WP_003640582.1|206866_208090_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	50.0	1.3e-44
WP_003640581.1|208146_208599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644431.1|208784_210695_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.4	6.6e-51
WP_003640579.1|210707_211658_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	61.5	3.8e-116
WP_003640578.1|211667_212159_+	dihydrofolate reductase	NA	A0A1L7N103	Ralstonia_phage	37.9	9.4e-18
WP_087615060.1|212265_213117_+	DegV family protein	NA	NA	NA	NA	NA
WP_003644430.1|213266_214211_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003640575.1|214223_214868_+	YpmS family protein	NA	NA	NA	NA	NA
WP_003640574.1|214879_215101_+	YozE family protein	NA	NA	NA	NA	NA
WP_087615061.1|215130_216609_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.3	2.3e-19
>prophage 15
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	221850	240753	3223644	protease,tRNA	Bacillus_virus(25.0%)	14	NA	NA
WP_003640568.1|221850_222780_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	35.0	9.1e-06
WP_003640567.1|222969_224118_+	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	33.2	1.6e-47
WP_087615064.1|224685_225540_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_087615065.1|225532_226300_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	33.8	7.5e-22
WP_003640564.1|226378_227245_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003645027.1|227333_229481_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.3	4.1e-102
WP_013355556.1|229759_231085_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003640561.1|231164_232109_+	tyrosine recombinase XerC	NA	S5M872	Bacillus_phage	26.5	4.2e-14
WP_003638820.1|232092_232635_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_003640560.1|232652_234071_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	27.9	2.1e-30
WP_087615066.1|234097_234976_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003644419.1|235171_235798_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_087615067.1|236282_238289_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.7	1.0e-123
WP_003640556.1|238302_240753_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.9	1.4e-93
>prophage 16
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	251137	252487	3223644		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_087615069.1|251137_252487_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.3	4.0e-26
>prophage 17
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	277209	278109	3223644		Staphylococcus_phage(100.0%)	1	NA	NA
WP_087615074.1|277209_278109_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.1	9.7e-37
>prophage 18
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	282055	282655	3223644		Lactococcus_phage(100.0%)	1	NA	NA
WP_011101549.1|282055_282655_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	39.8	1.1e-33
>prophage 19
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	287191	288115	3223644		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_011101547.1|287191_288115_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.1	1.2e-10
>prophage 20
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	295018	302386	3223644		Anomala_cuprea_entomopoxvirus(33.33%)	7	NA	NA
WP_003640500.1|295018_295696_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.7	2.1e-07
WP_044430731.1|295695_296448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076633876.1|296595_297654_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_080333754.1|297735_299079_-	glycosyl hydrolase family 25	NA	A0A1S5RCQ2	Lactobacillus_phage	33.0	3.8e-37
WP_003644380.1|299226_299715_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015640382.1|299812_300892_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_044430725.1|301045_302386_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	33.0	3.5e-06
>prophage 21
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	306089	310928	3223644		Bacillus_phage(33.33%)	4	NA	NA
WP_003640485.1|306089_306659_-	DUF1273 domain-containing protein	NA	U5J9F7	Bacillus_phage	25.9	8.6e-07
WP_003644374.1|306773_307397_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	38.7	3.2e-23
WP_003640483.1|307408_309712_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003640482.1|309974_310928_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	2.7e-21
>prophage 22
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	315901	324316	3223644	tRNA	Bacillus_phage(50.0%)	7	NA	NA
WP_015640375.1|315901_316969_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.9	1.6e-30
WP_011101531.1|317342_317549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644365.1|317604_318330_-	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	38.6	9.6e-11
WP_003640473.1|318407_319706_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.1	3.0e-55
WP_003640472.1|319723_320929_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003644363.1|320945_321446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003645087.1|321511_324316_-	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	24.1	5.2e-36
>prophage 23
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	339720	343089	3223644		Klosneuvirus(50.0%)	4	NA	NA
WP_087615076.1|339720_341070_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.8	1.0e-18
WP_003644351.1|341508_341781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640454.1|341920_342220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640453.1|342312_343089_-	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	35.0	1.4e-23
>prophage 24
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	355445	357471	3223644		Apis_mellifera_filamentous_virus(50.0%)	2	NA	NA
WP_003640437.1|355445_356051_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	32.1	7.0e-15
WP_003640436.1|356298_357471_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	37.8	2.5e-40
>prophage 25
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	388094	395705	3223644		Acinetobacter_phage(50.0%)	7	NA	NA
WP_003640395.1|388094_388877_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	35.4	2.4e-31
WP_024002821.1|388873_389893_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.4	1.4e-52
WP_054398148.1|389917_390493_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	39.1	2.6e-35
WP_085764466.1|390476_391913_-	anthranilate synthase component I family protein	NA	S4VT78	Pandoravirus	29.4	2.6e-23
WP_087615084.1|392385_393981_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015380289.1|393973_394738_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	3.7e-21
WP_087615085.1|395234_395705_-	alcohol dehydrogenase	NA	M4SQJ2	Pseudoalteromonas_phage	46.3	4.2e-07
>prophage 26
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	413504	414200	3223644		Indivirus(100.0%)	1	NA	NA
WP_003640377.1|413504_414200_-	ribonuclease III	NA	A0A1V0SDK0	Indivirus	33.0	2.7e-18
>prophage 27
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	423356	437275	3223644	holin,tRNA	Noumeavirus(20.0%)	13	NA	NA
WP_072539424.1|423356_425381_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1Q1PNS5	Noumeavirus	30.5	2.9e-20
WP_003640367.1|425377_426124_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_003645153.1|426141_427485_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_003645154.1|427481_428435_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.4	1.7e-10
WP_053267669.1|428458_430876_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_053267689.1|430898_432125_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.1	1.3e-39
WP_003640362.1|432288_432501_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003640361.1|432497_433118_-	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	33.6	1.4e-10
WP_003645156.1|433310_433646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640359.1|433851_434505_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003640358.1|434504_435440_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003644316.1|435452_436082_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003644315.1|436078_437275_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	46.2	3.0e-17
>prophage 28
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	441925	444122	3223644		Gordonia_phage(50.0%)	2	NA	NA
WP_087615090.1|441925_443269_-	exodeoxyribonuclease VII large subunit	NA	A0A160DEV2	Gordonia_phage	30.8	6.7e-26
WP_003645162.1|443261_444122_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.1	1.1e-32
>prophage 29
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	456624	457359	3223644		Enterococcus_phage(100.0%)	1	NA	NA
WP_003640330.1|456624_457359_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	44.3	4.5e-16
>prophage 30
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	470009	470639	3223644		Catovirus(100.0%)	1	NA	NA
WP_003640313.1|470009_470639_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.6	1.7e-35
>prophage 31
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	474435	475482	3223644	tRNA	Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003644299.1|474435_475482_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.9	4.0e-26
>prophage 32
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	481349	491483	3223644		Bacillus_virus(40.0%)	6	NA	NA
WP_087615093.1|481349_484535_+	SMC family ATPase	NA	G3MAB6	Bacillus_virus	20.9	2.8e-06
WP_003640302.1|484669_485638_-	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_003645182.1|486008_487652_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.7	9.4e-22
WP_003638551.1|487651_488338_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.4	3.9e-30
WP_063722406.1|488528_489878_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.8	7.6e-86
WP_003640298.1|490046_491483_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	29.3	2.6e-28
>prophage 33
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	506106	519731	3223644	tRNA	Bacillus_phage(28.57%)	13	NA	NA
WP_011101454.1|506106_507369_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	38.6	3.0e-68
WP_047673353.1|507540_507852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640279.1|508094_508451_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003638526.1|508487_508682_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003644288.1|508703_509225_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.0	1.9e-16
WP_033608604.1|509446_511411_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	33.6	1.5e-103
WP_003644286.1|511743_512679_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	30.3	2.8e-26
WP_003644285.1|512682_514086_-	helicase DnaB	NA	NA	NA	NA	NA
WP_003640274.1|514107_514623_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003645195.1|514664_515258_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_015380239.1|515267_516092_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	33.0	8.9e-29
WP_021356459.1|516103_518752_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.1	6.8e-46
WP_021356458.1|519014_519731_-	Bax inhibitor-1/YccA family protein	NA	A2VCJ8	Vaccinia_virus	25.7	7.5e-08
>prophage 34
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	523879	525439	3223644		Escherichia_phage(100.0%)	1	NA	NA
WP_011101444.1|523879_525439_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	45.1	7.8e-18
>prophage 35
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	544961	545732	3223644		Hokovirus(100.0%)	1	NA	NA
WP_087615100.1|544961_545732_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	30.5	2.7e-11
>prophage 36
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	548792	552126	3223644		environmental_halophage(50.0%)	3	NA	NA
WP_045351849.1|548792_550031_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.6	9.4e-107
WP_003645199.1|550014_551316_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003640263.1|551328_552126_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.5	1.8e-10
>prophage 37
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	556438	559429	3223644		Mycobacterium_phage(100.0%)	1	NA	NA
WP_087615102.1|556438_559429_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.7	2.4e-87
>prophage 38
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	563570	564308	3223644		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_087615104.1|563570_564308_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.6	7.2e-22
>prophage 39
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	573391	581047	3223644		Staphylococcus_phage(80.0%)	9	NA	NA
WP_087615106.1|573391_574708_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.0	1.5e-09
WP_003640242.1|574861_575488_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003640241.1|575623_576265_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003640240.1|576353_576917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640239.1|577093_577654_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003640238.1|577684_578164_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	4.1e-34
WP_003645212.1|578160_579375_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.7	1.7e-84
WP_076642475.1|579376_579979_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.9	3.1e-23
WP_076642473.1|579979_581047_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	32.8	2.7e-38
>prophage 40
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	586760	587756	3223644		Shigella_phage(100.0%)	1	NA	NA
WP_003645220.1|586760_587756_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
>prophage 41
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	592061	595664	3223644		Streptococcus_phage(50.0%)	2	NA	NA
WP_087615108.1|592061_593351_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	50.2	1.9e-102
WP_087615109.1|593390_595664_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	23.8	6.9e-39
>prophage 42
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	598859	607877	3223644		Lactobacillus_phage(100.0%)	9	NA	NA
WP_087615111.1|598859_599099_-	hypothetical protein	NA	A0A2P0ZL95	Lactobacillus_phage	98.6	5.3e-35
WP_052098033.1|599073_599541_-	hypothetical protein	NA	A0A2P0ZL91	Lactobacillus_phage	99.4	6.1e-83
WP_003643094.1|599885_600326_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	99.3	8.0e-77
WP_003643095.1|600396_600957_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_063720948.1|601044_603483_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.8	0.0e+00
WP_003643097.1|603485_604100_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_027822909.1|604443_605391_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	99.7	1.0e-177
WP_033608586.1|605576_606548_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.5	5.9e-181
WP_033608585.1|606638_607877_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	99.0	2.4e-219
>prophage 43
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	620674	622330	3223644	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_087615113.1|620674_622330_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.6e-93
>prophage 44
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	632750	637385	3223644	tRNA	Planktothrix_phage(50.0%)	3	NA	NA
WP_087615120.1|632750_634745_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.4	4.1e-35
WP_003643127.1|635014_635491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101383.1|635696_637385_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	1.2e-75
>prophage 45
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	645731	647533	3223644		Tupanvirus(50.0%)	2	NA	NA
WP_003645243.1|645731_646355_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.6	4.8e-27
WP_044430280.1|646357_647533_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	31.7	3.8e-49
>prophage 46
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	657825	660096	3223644		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_077727040.1|657825_660096_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.5	3.0e-119
>prophage 47
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	673263	674121	3223644		Cedratvirus(100.0%)	1	NA	NA
WP_003643164.1|673263_674121_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	33.0	1.3e-17
>prophage 48
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	679381	680897	3223644		Lactobacillus_virus(50.0%)	2	NA	NA
WP_003643169.1|679381_680029_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	47.5	2.4e-45
WP_024971601.1|680210_680897_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	25.6	1.1e-11
>prophage 49
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	684048	685149	3223644		Planktothrix_phage(100.0%)	1	NA	NA
WP_033098977.1|684048_685149_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	2.2e-22
>prophage 50
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	691468	695637	3223644	tRNA	Staphylococcus_phage(100.0%)	3	NA	NA
WP_063720938.1|691468_693895_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.1	0.0e+00
WP_087615125.1|694390_695041_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_076634530.1|695040_695637_+	SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	45.5	9.3e-36
>prophage 51
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	713495	714683	3223644		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003644222.1|713495_714683_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.2	3.2e-144
>prophage 52
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	734798	740074	3223644		Streptococcus_phage(50.0%)	4	NA	NA
WP_087615130.1|734798_736904_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	48.0	3.4e-157
WP_003643297.1|737059_737296_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_063733260.1|737487_738675_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016511307.1|738835_740074_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.9	3.4e-16
>prophage 53
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	746837	752898	3223644	protease,integrase	Agrobacterium_phage(25.0%)	5	746157:746169	750289:750301
746157:746169	attL	ATTAATTGGTTGT	NA	NA	NA	NA
WP_003644206.1|746837_749057_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.4	7.3e-126
WP_003646539.1|749171_749723_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6D2	Bacillus_phage	42.8	1.4e-30
WP_003643287.1|749916_750306_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
750289:750301	attR	ATTAATTGGTTGT	NA	NA	NA	NA
WP_003643241.1|750846_751812_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	36.4	5.7e-11
WP_003643240.1|751818_752898_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.4e-18
>prophage 54
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	763155	767420	3223644		Streptococcus_phage(33.33%)	3	NA	NA
WP_003643227.1|763155_764733_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.1	7.7e-29
WP_044430218.1|765030_766353_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	5.6e-25
WP_003643225.1|766523_767420_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	35.7	1.4e-48
>prophage 55
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	770481	770880	3223644		Hokovirus(100.0%)	1	NA	NA
WP_003643222.1|770481_770880_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	39.9	9.3e-16
>prophage 56
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	776966	777698	3223644		Clostridium_phage(100.0%)	1	NA	NA
WP_003644195.1|776966_777698_+	gamma-D-glutamate-meso-diaminopimelate muropeptidase	NA	A0A0A8WF62	Clostridium_phage	43.7	1.0e-15
>prophage 57
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	793252	794386	3223644		Streptococcus_phage(100.0%)	1	NA	NA
WP_003644178.1|793252_794386_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	77.6	2.4e-170
>prophage 58
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	814488	815412	3223644	integrase	Brevibacillus_phage(100.0%)	1	808221:808237	816671:816687
808221:808237	attL	CTTGATATACCAAGAAA	NA	NA	NA	NA
WP_046947841.1|814488_815412_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	27.2	2.6e-13
WP_046947841.1|814488_815412_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	27.2	2.6e-13
816671:816687	attR	CTTGATATACCAAGAAA	NA	NA	NA	NA
>prophage 59
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	833131	838386	3223644	integrase	Catovirus(33.33%)	6	827981:827995	837436:837450
827981:827995	attL	GATCACCAAGATTGG	NA	NA	NA	NA
WP_046947827.1|833131_834079_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	34.9	1.8e-41
WP_027822000.1|834096_834870_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011101299.1|834856_835585_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_052751298.1|835596_836367_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_074029034.1|836721_837324_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	42.5	1.3e-32
WP_046947829.1|837381_838386_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	41.5	2.0e-67
837436:837450	attR	CCAATCTTGGTGATC	NA	NA	NA	NA
>prophage 60
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	845052	846054	3223644		Catovirus(100.0%)	1	NA	NA
WP_052098027.1|845052_846054_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	30.4	1.3e-10
>prophage 61
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	849593	854198	3223644		Streptococcus_phage(33.33%)	4	NA	NA
WP_046947837.1|849593_850709_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	79.3	8.8e-173
WP_003643315.1|850858_851575_-	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	32.7	5.6e-19
WP_003643314.1|851764_852694_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003646267.1|853079_854198_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	31.2	2.7e-20
>prophage 62
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	858193	859870	3223644	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_087615139.1|858193_859870_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.7e-93
>prophage 63
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	864046	868429	3223644		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	5	NA	NA
WP_045352532.1|864046_865381_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.5	1.0e-37
WP_003644135.1|865393_866401_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003638174.1|866587_866788_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	3.1e-20
WP_003641352.1|867131_867497_+	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_003641351.1|867652_868429_-	lysozyme	NA	A0A141HSE6	Bacillus_phage	31.1	2.6e-06
>prophage 64
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	871890	878258	3223644		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_027821303.1|871890_874230_-	cation-translocating P-type ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	24.9	3.2e-39
WP_011101270.1|874496_875072_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003644130.1|875528_876902_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.0	4.2e-124
WP_003641344.1|877235_878258_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.5	2.6e-17
>prophage 65
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	882782	890679	3223644		Ralstonia_phage(33.33%)	6	NA	NA
WP_087615141.1|882782_884822_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	33.3	1.4e-94
WP_003644128.1|884838_887106_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.7	4.8e-133
WP_003641337.1|887546_888716_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003644127.1|888828_889377_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_003641335.1|889399_889987_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003641334.1|890037_890679_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	42.0	6.7e-24
>prophage 66
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	895722	899216	3223644		Bacillus_phage(50.0%)	2	NA	NA
WP_003641327.1|895722_897483_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.3	2.2e-24
WP_027821306.1|897482_899216_-	thiol reductant ABC exporter subunit CydD	NA	A0A076FI99	Aureococcus_anophage	21.4	5.7e-09
>prophage 67
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	913363	914752	3223644		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003641314.1|913363_914752_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	34.6	3.8e-56
>prophage 68
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	920286	921285	3223644	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_053338773.1|920286_921285_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.4e-52
>prophage 69
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	932554	933292	3223644		Pithovirus(100.0%)	1	NA	NA
WP_003645514.1|932554_933292_-	metal ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.1	4.4e-11
>prophage 70
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	952308	954017	3223644		Bacillus_phage(100.0%)	2	NA	NA
WP_015379998.1|952308_953196_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.6	4.3e-13
WP_044430041.1|953171_954017_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	2.9e-14
>prophage 71
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	976131	995898	3223644	protease,tRNA	uncultured_Mediterranean_phage(33.33%)	11	NA	NA
WP_003641250.1|976131_978228_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	9.4e-67
WP_003638057.1|978369_978840_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003641249.1|978856_979270_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_011101245.1|979532_980213_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_003641247.1|980867_984509_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.3	1.3e-63
WP_024002643.1|984526_988132_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	25.1	1.5e-51
WP_003644087.1|988387_988990_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024002644.1|989168_991673_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.3	2.2e-123
WP_003644086.1|991691_992159_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003644085.1|993702_994980_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.5	9.4e-94
WP_003641239.1|995262_995898_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	47.5	8.9e-53
>prophage 72
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1006896	1007097	3223644		Lactococcus_phage(100.0%)	1	NA	NA
WP_003641227.1|1006896_1007097_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	78.8	3.0e-23
>prophage 73
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1016803	1018705	3223644		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_011101239.1|1016803_1018705_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	32.7	3.0e-35
>prophage 74
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1027432	1028437	3223644		Cedratvirus(100.0%)	1	NA	NA
WP_061871814.1|1027432_1028437_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	32.3	1.2e-32
>prophage 75
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1031989	1033204	3223644		Oenococcus_phage(100.0%)	1	NA	NA
WP_061871768.1|1031989_1033204_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	33.6	2.5e-48
>prophage 76
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1041830	1043639	3223644		Moumouvirus(100.0%)	1	NA	NA
WP_015379962.1|1041830_1043639_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.1	1.0e-77
>prophage 77
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1047757	1055381	3223644	tRNA	Lactobacillus_phage(60.0%)	7	NA	NA
WP_003641196.1|1047757_1048765_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.0	1.4e-63
WP_003645743.1|1048803_1050099_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	4.2e-57
WP_011101225.1|1050269_1050899_+	FMN-dependent NADH-azoreductase 2	NA	NA	NA	NA	NA
WP_003641193.1|1051007_1051481_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087615154.1|1051756_1053646_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	26.2	5.2e-16
WP_087615155.1|1053832_1054759_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	3.6e-18
WP_011101223.1|1054829_1055381_-	helix-turn-helix domain-containing protein	NA	X2CXD8	Lactobacillus_phage	48.4	3.7e-07
>prophage 78
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1062896	1066790	3223644	integrase	Staphylococcus_phage(66.67%)	3	1062309:1062331	1065133:1065155
1062309:1062331	attL	CTTGGGAGCAGCGTAAGCTCGGA	NA	NA	NA	NA
WP_046947616.1|1062896_1063814_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	44.7	2.9e-73
WP_087615158.1|1063965_1065207_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	26.8	8.2e-18
1065133:1065155	attR	TCCGAGCTTACGCTGCTCCCAAG	NA	NA	NA	NA
WP_087615159.1|1065203_1066790_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	62.9	4.2e-176
>prophage 79
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1069899	1072434	3223644		Acinetobacter_phage(100.0%)	1	NA	NA
WP_022637932.1|1069899_1072434_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.3	1.2e-68
>prophage 80
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1078320	1080168	3223644		Salmonella_virus(100.0%)	1	NA	NA
WP_087615163.1|1078320_1080168_-	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.1	7.6e-20
>prophage 81
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1090207	1093051	3223644		Lactobacillus_phage(50.0%)	3	NA	NA
WP_003641165.1|1090207_1090576_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.7	5.9e-17
WP_003641164.1|1090809_1091178_+	membrane protein	NA	NA	NA	NA	NA
WP_003644035.1|1091494_1093051_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	5.6e-16
>prophage 82
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1104311	1107651	3223644		Klosneuvirus(50.0%)	4	NA	NA
WP_003644029.1|1104311_1104749_-	NUDIX domain-containing protein	NA	A0A1V0SJK7	Klosneuvirus	40.6	3.6e-05
WP_003641141.1|1104837_1106133_+	GTPase HflX	NA	NA	NA	NA	NA
WP_087615165.1|1106244_1106805_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011101192.1|1106889_1107651_+	sulfite exporter TauE/SafE family protein	NA	Q6EVM7	Oenoccocus_phage	39.6	1.7e-42
>prophage 83
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1118866	1121617	3223644		Planktothrix_phage(50.0%)	3	NA	NA
WP_003641125.1|1118866_1119607_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	1.5e-35
WP_003641122.1|1120139_1120391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641121.1|1120624_1121617_-	D-2-hydroxyacid dehydrogenase	NA	M1HI29	Paramecium_bursaria_Chlorella_virus	34.7	2.2e-42
>prophage 84
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1126186	1129273	3223644		Bacillus_phage(100.0%)	5	NA	NA
WP_003641115.1|1126186_1126768_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	27.9	1.7e-10
WP_003641114.1|1126918_1127068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644009.1|1127144_1127564_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_013355275.1|1127617_1128436_-	pyridoxine kinase	NA	NA	NA	NA	NA
WP_003641111.1|1128799_1129273_-	alcohol dehydrogenase	NA	A0A218KDM1	Bacillus_phage	51.7	2.4e-10
>prophage 85
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1134882	1136865	3223644		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003644006.1|1134882_1136865_-	acetyltransferase	NA	W6MVL2	Pseudomonas_phage	29.1	3.3e-29
>prophage 86
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1145199	1148614	3223644		Moraxella_phage(50.0%)	4	NA	NA
WP_003644001.1|1145199_1146507_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.5	3.7e-45
WP_003641099.1|1146786_1146948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087615276.1|1147162_1147636_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641097.1|1147804_1148614_+	LicD family protein	NA	A0A1V0SD50	Indivirus	32.4	7.2e-07
>prophage 87
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1171351	1173169	3223644		Chlorella_virus(100.0%)	1	NA	NA
WP_003641075.1|1171351_1173169_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	36.5	1.4e-90
>prophage 88
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1182954	1189907	3223644	tRNA	Cafeteria_roenbergensis_virus(25.0%)	9	NA	NA
WP_003643984.1|1182954_1183719_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	45.8	3.0e-55
WP_011101164.1|1183781_1184318_+	exonuclease	NA	A0A2I6PEZ7	Staphylococcus_phage	32.5	8.9e-22
WP_003641062.1|1184541_1185057_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003643982.1|1185062_1185524_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003641060.1|1185633_1186611_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_015825217.1|1186634_1187327_-	uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	41.1	2.6e-42
WP_003641058.1|1187442_1188312_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003641057.1|1188335_1188899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641056.1|1189172_1189907_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	2.0e-32
>prophage 89
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1199995	1204837	3223644	transposase	Staphylococcus_virus(33.33%)	3	NA	NA
WP_087615176.1|1199995_1201714_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.8e-93
WP_003641053.1|1201926_1202397_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	61.0	8.6e-45
WP_003641052.1|1202422_1204837_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.6	7.2e-87
>prophage 90
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1208572	1209901	3223644		Streptococcus_phage(100.0%)	1	NA	NA
WP_003643976.1|1208572_1209901_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	71.1	7.3e-174
>prophage 91
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1216738	1223578	3223644		Streptococcus_phage(40.0%)	6	NA	NA
WP_003641041.1|1216738_1217329_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.0	3.0e-55
WP_013355257.1|1217487_1218462_+	2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.0	8.9e-20
WP_087615178.1|1218673_1220326_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003641038.1|1220750_1221683_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	36.8	6.7e-49
WP_003641037.1|1221695_1222697_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	55.3	6.4e-98
WP_003641036.1|1222693_1223578_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.5	4.2e-08
>prophage 92
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1228024	1235016	3223644		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_003643969.1|1228024_1230880_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.4	2.4e-299
WP_003641029.1|1230914_1232918_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_087615179.1|1233066_1233714_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_087615180.1|1233819_1235016_-	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	19.1	1.0e-04
>prophage 93
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1238534	1246305	3223644		Streptococcus_phage(33.33%)	7	NA	NA
WP_087615181.1|1238534_1240262_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	56.7	6.5e-191
WP_003646084.1|1240480_1240933_+	DUF3290 domain-containing protein	NA	NA	NA	NA	NA
WP_003641021.1|1240933_1241566_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003641020.1|1241671_1242610_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.6	2.0e-85
WP_053338720.1|1242802_1244215_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015379883.1|1244606_1245287_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003641010.1|1245384_1246305_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.8	2.5e-72
>prophage 94
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1250827	1252404	3223644		Bacillus_virus(50.0%)	2	NA	NA
WP_003641003.1|1250827_1251583_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	1.4e-15
WP_003641002.1|1251594_1252404_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	2.8e-11
>prophage 95
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1255452	1257577	3223644		Bacillus_phage(100.0%)	2	NA	NA
WP_003643953.1|1255452_1256856_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	2.1e-25
WP_003640997.1|1256848_1257577_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.9	2.5e-35
>prophage 96
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1264238	1267398	3223644		Streptococcus_phage(66.67%)	3	NA	NA
WP_015379875.1|1264238_1265591_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	40.6	6.5e-69
WP_003640991.1|1265657_1266305_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.4	4.5e-36
WP_003643949.1|1266495_1267398_-	phosphate ABC transporter substrate-binding protein	NA	E3SM63	Prochlorococcus_phage	28.7	9.2e-11
>prophage 97
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1271120	1278849	3223644	protease,tRNA	uncultured_virus(50.0%)	6	NA	NA
WP_003640986.1|1271120_1272746_-	chaperonin GroEL	NA	A0A240F766	uncultured_virus	54.3	2.4e-155
WP_003640985.1|1272801_1273086_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	40.2	3.5e-09
WP_003640984.1|1273278_1273923_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003640983.1|1274087_1274765_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003640982.1|1274933_1276916_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.9	1.2e-50
WP_003640980.1|1277802_1278849_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.7	3.5e-62
>prophage 98
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1281958	1282729	3223644		Bacillus_phage(100.0%)	1	NA	NA
WP_003640975.1|1281958_1282729_+	phosphonate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.8	4.9e-13
>prophage 99
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1286450	1301182	3223644		Streptococcus_phage(40.0%)	17	NA	NA
WP_003643943.1|1286450_1287446_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	5.9e-51
WP_003640969.1|1287584_1288370_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_087615183.1|1288373_1289270_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	1.7e-81
WP_003640967.1|1289368_1289716_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003640966.1|1289740_1290760_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640965.1|1290776_1291106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101140.1|1291102_1291768_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640957.1|1292165_1292417_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|1292431_1293031_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|1293046_1293355_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_065080432.1|1293376_1295086_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	4.0e-55
WP_003640954.1|1295612_1296119_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003640953.1|1296121_1296730_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003640952.1|1296952_1297183_+	redoxin NrdH	NA	X2KRY7	Enterococcus_phage	40.0	2.8e-09
WP_060684302.1|1297321_1299487_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.3	4.9e-268
WP_003640950.1|1299514_1300525_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	60.5	3.1e-108
WP_003640949.1|1300606_1301182_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	41.7	6.4e-26
>prophage 100
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1313533	1314946	3223644	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_011101074.1|1313533_1314946_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.0	2.3e-45
>prophage 101
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1320498	1323569	3223644		Bacillus_phage(50.0%)	4	NA	NA
WP_011101073.1|1320498_1321035_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	46.4	1.1e-35
WP_003640927.1|1321173_1321470_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003640926.1|1321478_1322162_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_087615184.1|1322237_1323569_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.6	1.1e-68
>prophage 102
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1350368	1355784	3223644		Bacillus_virus(66.67%)	3	NA	NA
WP_003643866.1|1350368_1353023_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.9	8.8e-70
WP_003640900.1|1353478_1354306_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.0	6.5e-72
WP_003640899.1|1354305_1355784_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.1	2.5e-106
>prophage 103
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1358787	1360761	3223644		Streptococcus_phage(50.0%)	2	NA	NA
WP_087615186.1|1358787_1359579_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.1	1.2e-30
WP_087615187.1|1359939_1360761_+	nicotinamide mononucleotide transporter	NA	A0A2K9VCL6	Lactobacillus_phage	42.2	4.4e-52
>prophage 104
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1365259	1369107	3223644	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_024002268.1|1365259_1366732_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.5	4.1e-69
WP_087615188.1|1367439_1369107_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.4e-92
>prophage 105
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1375049	1382882	3223644	tRNA	Tupanvirus(25.0%)	6	NA	NA
WP_003642090.1|1375049_1376549_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	1.6e-89
WP_063722853.1|1376652_1377660_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003642088.1|1377659_1378547_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_070084971.1|1378695_1380894_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	G8DDJ2	Micromonas_pusilla_virus	47.8	5.9e-104
WP_003642086.1|1380973_1381516_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.0	1.5e-08
WP_063722856.1|1381535_1382882_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	23.8	2.0e-09
>prophage 106
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1394492	1397292	3223644		Pneumococcus_phage(50.0%)	3	NA	NA
WP_003642074.1|1394492_1394999_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	32.1	2.9e-06
WP_087615190.1|1395107_1396130_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_080466456.1|1396122_1397292_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	1.7e-17
>prophage 107
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1404812	1411988	3223644		Acanthocystis_turfacea_Chlorella_virus(25.0%)	5	NA	NA
WP_060684291.1|1404812_1406795_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	35.8	2.1e-68
WP_027821484.1|1407086_1407479_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	36.0	5.7e-10
WP_003642062.1|1407887_1409015_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.6	2.5e-29
WP_003642061.1|1409014_1409377_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003642058.1|1410401_1411988_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.0e-73
>prophage 108
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1428637	1552207	3223644	protease,tRNA,bacteriocin	uncultured_Mediterranean_phage(16.67%)	117	NA	NA
WP_053566451.1|1428637_1429909_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	3.4e-96
WP_003642042.1|1430376_1431990_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|1432162_1432771_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|1432815_1433256_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_074161854.1|1433618_1434551_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_087615191.1|1434565_1435918_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_015379810.1|1435937_1436747_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_053267165.1|1436916_1437903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642034.1|1437985_1439008_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|1439296_1440277_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_063204071.1|1440642_1441467_-	serine hydrolase	NA	NA	NA	NA	NA
WP_063204070.1|1441702_1443085_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_003642030.1|1443153_1443990_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003642024.1|1444346_1445150_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|1445136_1445835_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_087615192.1|1446103_1447048_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003643828.1|1447357_1448224_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|1448356_1448608_-	Veg protein	NA	NA	NA	NA	NA
WP_087615193.1|1448712_1449603_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011101014.1|1449599_1450163_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003643825.1|1450149_1450926_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_063722869.1|1451177_1451666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087615194.1|1451686_1452319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087615195.1|1452302_1455983_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_087615196.1|1456185_1457076_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_087615197.1|1457109_1458294_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_087615198.1|1458525_1460577_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	3.5e-90
WP_011101012.1|1460898_1461288_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003642012.1|1461884_1462727_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003646490.1|1462726_1463431_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642010.1|1463452_1464412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764312.1|1464404_1465679_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|1465724_1466642_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_060684284.1|1466810_1467605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101008.1|1467609_1468842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764311.1|1469197_1470211_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642004.1|1470323_1471070_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080333740.1|1471219_1472116_-	ROK family protein	NA	NA	NA	NA	NA
WP_003642002.1|1472236_1473673_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_045352050.1|1473690_1475043_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|1475265_1475688_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|1475677_1475866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641998.1|1475872_1477234_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641997.1|1477306_1478017_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087615199.1|1478422_1479439_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_065080246.1|1479878_1480655_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_065080247.1|1480913_1483223_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_065080248.1|1483317_1483521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087615200.1|1483658_1484345_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_053566440.1|1484438_1485119_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_063721086.1|1485205_1485874_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_062688864.1|1485940_1486630_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_087615201.1|1486719_1488096_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_063721087.1|1488111_1490262_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_003641985.1|1490528_1490699_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_021356667.1|1490723_1490882_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_021356666.1|1490980_1491754_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_063204018.1|1492047_1492791_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_021356665.1|1492909_1493653_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_021356664.1|1493653_1494982_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003641979.1|1495172_1495319_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641978.1|1495654_1495843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641977.1|1496196_1496943_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_061871501.1|1496973_1498173_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003641975.1|1498290_1498458_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641974.1|1498585_1498786_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_087615202.1|1499647_1499815_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641972.1|1499845_1500019_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003641971.1|1500015_1500684_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003643803.1|1500708_1500861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641969.1|1501095_1501299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011100995.1|1501683_1502868_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_011100994.1|1502912_1504289_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_087615203.1|1504814_1505630_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003641965.1|1505789_1506662_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011100993.1|1506732_1507524_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003641963.1|1507527_1508682_+	MFS transporter	NA	NA	NA	NA	NA
WP_015379760.1|1508685_1509303_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_076655680.1|1509581_1510055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643792.1|1510336_1510756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053566430.1|1510884_1511118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050495849.1|1511375_1511576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033608294.1|1511957_1512230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087615204.1|1513913_1514306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087615205.1|1515308_1515563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060599145.1|1515765_1516038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087615207.1|1516568_1516844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267430.1|1518115_1518523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080373188.1|1518533_1518686_-	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_087615208.1|1518747_1519062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072534268.1|1520305_1520584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047672638.1|1521000_1521309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157664749.1|1522379_1522586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087615209.1|1522839_1523196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087615210.1|1523201_1525091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087615211.1|1525092_1528776_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003641945.1|1529362_1530085_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_003641944.1|1530099_1531929_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003643773.1|1531943_1533461_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_024971425.1|1533926_1535258_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641941.1|1535335_1536307_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_003641940.1|1536307_1537834_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003641939.1|1538071_1538518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024971424.1|1539407_1540319_-	oxidoreductase	NA	NA	NA	NA	NA
WP_025015650.1|1540455_1541376_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_003641936.1|1541541_1542114_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003641935.1|1542217_1542673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641934.1|1542691_1543162_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_087615212.1|1543271_1544468_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|1544498_1545008_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003643763.1|1545120_1545489_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641930.1|1545753_1547259_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_011100974.1|1547408_1548077_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003643762.1|1548270_1548834_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003641927.1|1549064_1549334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011100973.1|1549436_1550396_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_060684276.1|1550890_1552207_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.9	9.5e-33
>prophage 109
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1555396	1556488	3223644		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003641921.1|1555396_1556488_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	7.2e-18
>prophage 110
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1576098	1578041	3223644		Mycoplasma_phage(100.0%)	2	NA	NA
WP_021356473.1|1576098_1577196_+	spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.1	5.9e-36
WP_087615215.1|1577207_1578041_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	22.5	3.8e-11
>prophage 111
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1589466	1590183	3223644		Bacillus_phage(100.0%)	1	NA	NA
WP_021356465.1|1589466_1590183_+	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	37.1	1.9e-19
>prophage 112
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1593572	1594376	3223644		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003641876.1|1593572_1594376_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K9V574	Lactobacillus_phage	50.4	4.6e-14
>prophage 113
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1597643	1598303	3223644		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003641873.1|1597643_1598303_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.4	6.5e-14
>prophage 114
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1616004	1618072	3223644		Bacillus_phage(100.0%)	2	NA	NA
WP_003641858.1|1616004_1616709_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.0	1.6e-31
WP_044428862.1|1616695_1618072_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.4	6.5e-24
>prophage 115
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1632537	1632942	3223644		Synechococcus_phage(100.0%)	1	NA	NA
WP_003646390.1|1632537_1632942_-	glycerol-3-phosphate cytidylyltransferase	NA	E3SJ88	Synechococcus_phage	42.1	1.1e-16
>prophage 116
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1641802	1645268	3223644		Lactobacillus_phage(50.0%)	3	NA	NA
WP_003641839.1|1641802_1642591_-	nicotinamide mononucleotide transporter	NA	A0A2H4PB74	Lactobacillus_phage	75.4	4.3e-97
WP_003641837.1|1642952_1643744_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_087615221.1|1644356_1645268_+	cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	40.9	5.5e-56
>prophage 117
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1654480	1661330	3223644	transposase	Lactococcus_phage(25.0%)	9	NA	NA
WP_044429853.1|1654480_1654945_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.2	8.8e-18
WP_027821548.1|1655165_1655861_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011100931.1|1656129_1656678_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	29.3	2.1e-10
WP_003641832.1|1656978_1658325_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_003641831.1|1658559_1659024_+	nucleoside-diphosphate kinase	NA	L7Y4C4	Megavirus	41.9	3.8e-21
WP_003641830.1|1659265_1659667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641829.1|1659731_1660286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641828.1|1660576_1660903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641827.1|1660997_1661330_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	36.8	2.9e-15
>prophage 118
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1674720	1674924	3223644		Clostridioides_phage(100.0%)	1	NA	NA
WP_013355132.1|1674720_1674924_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	38.1	3.7e-05
>prophage 119
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1678005	1683449	3223644		Clostridium_phage(33.33%)	6	NA	NA
WP_062688779.1|1678005_1678521_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	33.7	3.0e-06
WP_062688776.1|1678605_1679226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646372.1|1679736_1680567_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.2	4.0e-53
WP_003646371.1|1680617_1681103_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_087615228.1|1681443_1682013_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087615229.1|1682042_1683449_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.0	8.7e-16
>prophage 120
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1686808	1688329	3223644		Streptococcus_phage(100.0%)	1	NA	NA
WP_087615230.1|1686808_1688329_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	30.7	2.8e-44
>prophage 121
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1695366	1698073	3223644		Streptococcus_phage(100.0%)	3	NA	NA
WP_003641796.1|1695366_1696440_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	50.3	6.4e-96
WP_087615231.1|1696455_1697640_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	41.1	6.2e-84
WP_087615232.1|1697629_1698073_+	GNAT family N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	37.1	2.2e-18
>prophage 122
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1728641	1729748	3223644		Planktothrix_phage(100.0%)	1	NA	NA
WP_003641775.1|1728641_1729748_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	8.6e-27
>prophage 123
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1748980	1751615	3223644		Staphylococcus_phage(33.33%)	3	NA	NA
WP_087615237.1|1748980_1749898_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	2.6e-21
WP_003643674.1|1750160_1750955_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	2.6e-09
WP_003641754.1|1751123_1751615_-	hypothetical protein	NA	A8ATW6	Listeria_phage	36.1	1.9e-18
>prophage 124
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1755960	1757661	3223644		Planktothrix_phage(100.0%)	1	NA	NA
WP_087615240.1|1755960_1757661_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	2.3e-18
>prophage 125
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1766143	1766992	3223644		Klosneuvirus(100.0%)	1	NA	NA
WP_087615244.1|1766143_1766992_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	29.8	1.7e-27
>prophage 126
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1770908	1776749	3223644		Wolbachia_phage(33.33%)	6	NA	NA
WP_045351422.1|1770908_1771331_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	33.3	2.4e-06
WP_047672490.1|1771476_1771950_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013355108.1|1772062_1772665_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641730.1|1772730_1772925_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_011100895.1|1772967_1773726_-	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	46.8	1.5e-35
WP_045351420.1|1774010_1776749_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.4	3.1e-62
>prophage 127
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1780155	1780626	3223644		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003641724.1|1780155_1780626_+	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	33.8	6.4e-16
>prophage 128
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1789270	1792024	3223644		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_003643656.1|1789270_1789987_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	33.6	4.1e-22
WP_087615247.1|1789991_1790483_-	DUF111 family protein	NA	NA	NA	NA	NA
WP_063723156.1|1790461_1791253_-	LarC family nickel insertion protein	NA	NA	NA	NA	NA
WP_003641712.1|1791283_1792024_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	47.2	4.7e-21
>prophage 129
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1796022	1796748	3223644		Staphylococcus_phage(100.0%)	1	NA	NA
WP_016526846.1|1796022_1796748_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	1.1e-11
>prophage 130
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1807017	1808022	3223644		Megavirus(100.0%)	1	NA	NA
WP_003641694.1|1807017_1808022_+	NADP-dependent oxidoreductase	NA	K7Z7U2	Megavirus	31.1	7.6e-06
>prophage 131
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1811037	1813056	3223644		Streptococcus_phage(100.0%)	1	NA	NA
WP_013355092.1|1811037_1813056_-	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	D0R0F5	Streptococcus_phage	30.7	1.4e-70
>prophage 132
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1820455	1821472	3223644		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_087615253.1|1820455_1821472_+	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	36.0	2.6e-30
>prophage 133
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1827000	1827426	3223644		Staphylococcus_phage(100.0%)	1	NA	NA
WP_013355086.1|1827000_1827426_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	52.4	2.4e-30
>prophage 134
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1831134	1833504	3223644		Lactobacillus_phage(100.0%)	1	NA	NA
WP_021356237.1|1831134_1833504_+	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	24.3	3.3e-52
>prophage 135
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1838833	1840504	3223644	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_087615255.1|1838833_1840504_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.7e-93
>prophage 136
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1850890	1859295	3223644		Bacillus_phage(40.0%)	8	NA	NA
WP_087615264.1|1850890_1852153_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.3e-15
WP_003641659.1|1852263_1853079_-	MBL fold metallo-hydrolase	NA	A0A0D3MKU5	Leuconostoc_phage	28.0	2.8e-11
WP_003646175.1|1853437_1854292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024002248.1|1854303_1855629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641656.1|1855609_1857484_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.8	5.5e-34
WP_003637294.1|1857497_1858205_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.1	2.9e-44
WP_003641655.1|1858778_1859003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643615.1|1859094_1859295_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.6	2.8e-21
>prophage 137
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1866825	1869222	3223644		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_087615266.1|1866825_1869222_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.9	1.6e-09
>prophage 138
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1877283	1894428	3223644		Streptococcus_phage(37.5%)	14	NA	NA
WP_012778280.1|1877283_1878522_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.9	6.3e-111
WP_003643611.1|1878540_1879338_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.2	1.0e-45
WP_044428542.1|1879359_1880583_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	33.6	1.8e-54
WP_003641638.1|1880804_1882229_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	53.1	9.7e-124
WP_003641637.1|1882244_1882697_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003643610.1|1882709_1884722_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003641635.1|1884902_1885139_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003641634.1|1885177_1885780_-	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	72.1	3.7e-40
WP_003637271.1|1885816_1886116_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003641633.1|1886737_1889299_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	37.4	2.8e-113
WP_003641632.1|1889462_1891409_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.7	5.5e-146
WP_003641631.1|1891405_1892530_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003641630.1|1892530_1892764_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_003641629.1|1893288_1894428_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	29.9	4.3e-13
>prophage 139
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1911804	1913556	3223644		Phaeocystis_globosa_virus(50.0%)	2	NA	NA
WP_003641614.1|1911804_1913121_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.5	5.9e-59
WP_024002236.1|1913133_1913556_+	helix-turn-helix domain-containing protein	NA	Q9G039	Staphylococcus_virus	53.1	1.2e-10
>prophage 140
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1925558	1926362	3223644		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003646226.1|1925558_1926362_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.1	1.0e-08
>prophage 141
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1933197	1936738	3223644		Klosneuvirus(50.0%)	2	NA	NA
WP_022638377.1|1933197_1934988_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	21.3	2.7e-06
WP_087614892.1|1934989_1936738_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	1.0e-45
>prophage 142
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1950295	1951432	3223644		Planktothrix_phage(100.0%)	1	NA	NA
WP_003641580.1|1950295_1951432_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.9	7.7e-23
>prophage 143
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	1996873	1998988	3223644	protease	Cronobacter_phage(100.0%)	1	NA	NA
WP_003642931.1|1996873_1998988_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	38.7	3.1e-118
>prophage 144
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2003021	2004476	3223644		Tupanvirus(100.0%)	1	NA	NA
WP_015826151.1|2003021_2004476_-	catalase	NA	A0A2K9L572	Tupanvirus	46.7	5.1e-104
>prophage 145
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2010798	2012199	3223644		Aichi_virus(100.0%)	1	NA	NA
WP_011102219.1|2010798_2012199_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	30.2	5.9e-33
>prophage 146
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2029203	2029857	3223644		Synechococcus_phage(100.0%)	1	NA	NA
WP_016511066.1|2029203_2029857_+	fructose-6-phosphate aldolase	NA	R9TM64	Synechococcus_phage	49.8	8.6e-51
>prophage 147
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2032979	2033954	3223644		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_011102211.1|2032979_2033954_+	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	33.5	7.5e-27
>prophage 148
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2046544	2047993	3223644		Pandoravirus(100.0%)	1	NA	NA
WP_013356042.1|2046544_2047993_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	26.5	4.5e-36
>prophage 149
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2068933	2072966	3223644		Streptococcus_phage(50.0%)	3	NA	NA
WP_003643072.1|2068933_2069692_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	31.4	2.6e-22
WP_033609035.1|2069725_2070682_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_033609033.1|2070674_2072966_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	51.7	6.7e-42
>prophage 150
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2082725	2087122	3223644		Herpes_simplex_virus(50.0%)	3	NA	NA
WP_013356034.1|2082725_2084606_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	35.4	3.8e-99
WP_003643061.1|2084889_2086053_+	galactokinase	NA	NA	NA	NA	NA
WP_003643060.1|2086117_2087122_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.3	2.7e-51
>prophage 151
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2105866	2108465	3223644		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_003643556.1|2105866_2107603_+	AarF/ABC1/UbiB kinase family protein	NA	G8DDN0	Micromonas_pusilla_virus	27.7	6.6e-42
WP_003643044.1|2107814_2108465_-	aquaporin	NA	A0A1V0SCL5	Indivirus	41.6	1.9e-05
>prophage 152
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2121289	2134059	3223644		Cafeteria_roenbergensis_virus(16.67%)	13	NA	NA
WP_003643029.1|2121289_2123206_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.6	2.8e-73
WP_003643545.1|2123514_2124180_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643544.1|2124377_2124602_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_076642653.1|2124614_2125169_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_003645582.1|2125297_2125501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643024.1|2125600_2125870_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_003643543.1|2125893_2126214_-	thioredoxin family protein	NA	A0A2K9L3H4	Tupanvirus	39.1	5.2e-09
WP_003643022.1|2126598_2127351_+	aquaporin family protein	NA	M1HQW3	Paramecium_bursaria_Chlorella_virus	31.0	9.9e-27
WP_087614908.1|2127504_2129409_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	3.7e-94
WP_087614909.1|2130359_2131331_+	SGNH/GDSL hydrolase family protein	NA	A0A2H4PRU1	Lactococcus_phage	31.7	1.3e-34
WP_011102163.1|2131428_2132124_-	YdcF family protein	NA	NA	NA	NA	NA
WP_011102162.1|2132124_2132838_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_011102161.1|2133105_2134059_-	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	29.1	1.9e-19
>prophage 153
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2153832	2154351	3223644		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_003643523.1|2153832_2154351_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	58.0	4.1e-32
>prophage 154
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2157659	2158520	3223644		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003643521.1|2157659_2158520_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	1.9e-58
>prophage 155
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2161709	2164322	3223644		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_063845569.1|2161709_2164322_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	30.1	1.2e-74
>prophage 156
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2175218	2178341	3223644		Streptococcus_phage(50.0%)	2	NA	NA
WP_087614913.1|2175218_2177258_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	27.1	5.6e-56
WP_003643511.1|2177354_2178341_+	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	33.2	2.8e-29
>prophage 157
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2189980	2190481	3223644		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003642953.1|2189980_2190481_-	hypothetical protein	NA	A0A291I9Q0	Lactobacillus_phage	58.0	2.3e-43
>prophage 158
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2201765	2206047	3223644		Streptococcus_phage(50.0%)	2	NA	NA
WP_087614915.1|2201765_2203610_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.8	1.7e-64
WP_003642847.1|2204379_2206047_+	glycine/betaine ABC transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	1.5e-06
>prophage 159
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2209441	2215075	3223644		Staphylococcus_phage(50.0%)	4	NA	NA
WP_003642839.1|2209441_2210362_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	28.4	4.6e-10
WP_003643490.1|2211422_2211734_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003642837.1|2211958_2212780_-	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_087614916.1|2212816_2215075_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.1e-164
>prophage 160
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2227983	2228553	3223644		Vibrio_phage(100.0%)	1	NA	NA
WP_003642515.1|2227983_2228553_+	GTP cyclohydrolase I FolE	NA	A0A088F7Y4	Vibrio_phage	42.9	2.4e-33
>prophage 161
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2232827	2235932	3223644	transposase	Staphylococcus_virus(50.0%)	3	NA	NA
WP_087614917.1|2232827_2234513_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	8.9e-92
WP_024002226.1|2234982_2235216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033617302.1|2235293_2235932_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	50.8	5.7e-07
>prophage 162
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2239537	2245552	3223644		uncultured_virus(50.0%)	4	NA	NA
WP_024002224.1|2239537_2240656_-	vitamin B12 independent methionine synthase	NA	A0A218MNE0	uncultured_virus	43.7	4.1e-69
WP_003643477.1|2241117_2242164_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003642499.1|2242492_2243437_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_003643475.1|2243509_2245552_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.7	8.0e-63
>prophage 163
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2251698	2258951	3223644	bacteriocin	Staphylococcus_virus(20.0%)	6	NA	NA
WP_003642492.1|2251698_2252676_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.2	1.4e-137
WP_003643473.1|2252718_2254008_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.0	3.5e-72
WP_003642490.1|2254324_2255623_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_003642489.1|2255844_2256174_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003642488.1|2256368_2257703_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	7.9e-27
WP_003642487.1|2257838_2258951_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.0	1.1e-34
>prophage 164
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2273423	2273975	3223644		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003642469.1|2273423_2273975_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	41.5	1.2e-34
>prophage 165
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2281578	2283823	3223644		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_087614920.1|2281578_2283024_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	37.4	4.9e-83
WP_003642453.1|2283172_2283823_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.5	2.2e-22
>prophage 166
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2292989	2298965	3223644		Lactobacillus_phage(33.33%)	6	NA	NA
WP_044432256.1|2292989_2293565_+	zinc ribbon domain-containing protein	NA	D6PSS6	Lactobacillus_phage	31.1	2.8e-21
WP_003642442.1|2293732_2294548_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003642441.1|2295018_2295780_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	3.5e-27
WP_003642440.1|2295791_2296499_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003642439.1|2296567_2297371_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003642438.1|2297738_2298965_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	28.6	2.0e-21
>prophage 167
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2304517	2315974	3223644		Bacillus_phage(28.57%)	12	NA	NA
WP_003642432.1|2304517_2305369_+	nucleoid occlusion protein	NA	A0A1C9EHY8	Gordonia_phage	30.1	1.0e-11
WP_003642431.1|2305371_2306139_+	ParA family protein	NA	Q8JL10	Natrialba_phage	32.3	3.7e-29
WP_003642430.1|2306128_2307019_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	33.3	2.5e-16
WP_003639829.1|2307043_2307235_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_003642429.1|2307265_2308366_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_003642428.1|2308387_2309113_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_003642427.1|2309398_2310550_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	39.6	8.0e-52
WP_011102074.1|2310818_2311748_+	foldase	NA	NA	NA	NA	NA
WP_003642425.1|2311923_2312613_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_003642424.1|2312703_2313393_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.8	4.8e-36
WP_003642423.1|2313409_2314570_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	6.2e-28
WP_003642422.1|2314639_2315974_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.2	9.7e-09
>prophage 168
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2320580	2321506	3223644		Brochothrix_phage(100.0%)	2	NA	NA
WP_003642413.1|2320580_2321135_-	DUF4352 domain-containing protein	NA	D7RWL3	Brochothrix_phage	26.8	1.5e-11
WP_003643441.1|2321143_2321506_-	DUF4064 domain-containing protein	NA	D7RWL4	Brochothrix_phage	45.1	4.5e-09
>prophage 169
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2336362	2337217	3223644		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003643430.1|2336362_2337217_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.4	1.5e-55
>prophage 170
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2342257	2342971	3223644		Pithovirus(100.0%)	1	NA	NA
WP_003643426.1|2342257_2342971_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.9	1.2e-16
>prophage 171
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2348272	2352438	3223644	transposase	Lactococcus_phage(100.0%)	5	NA	NA
WP_021356561.1|2348272_2349544_-	DUF805 domain-containing protein	NA	Q9AZW5	Lactococcus_phage	41.7	4.7e-21
WP_044432148.1|2349962_2350331_-	YxeA family protein	NA	NA	NA	NA	NA
WP_045352900.1|2350453_2350822_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643418.1|2350910_2351297_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_044429853.1|2351973_2352438_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.2	8.8e-18
>prophage 172
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2357045	2357513	3223644		Streptomyces_phage(100.0%)	1	NA	NA
WP_003587210.1|2357045_2357513_-	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	29.2	1.6e-06
>prophage 173
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2361741	2363223	3223644		Lactobacillus_phage(100.0%)	1	NA	NA
WP_087614930.1|2361741_2363223_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	7.2e-29
>prophage 174
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2367714	2369502	3223644		Tupanvirus(100.0%)	1	NA	NA
WP_060684170.1|2367714_2369502_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	29.7	1.1e-18
>prophage 175
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2383772	2389224	3223644		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_003642355.1|2383772_2384519_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.2	8.1e-05
WP_011102044.1|2384812_2385706_+	SDR family oxidoreductase	NA	M1HZA6	Acanthocystis_turfacea_Chlorella_virus	24.3	1.4e-06
WP_003643401.1|2385686_2386199_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013355935.1|2386442_2387438_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003642351.1|2387434_2388433_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.8	5.9e-19
WP_033608966.1|2388429_2389224_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.0	1.5e-17
>prophage 176
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2407445	2409347	3223644		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_063490527.1|2407445_2409347_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	29.6	8.1e-33
>prophage 177
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2412698	2413352	3223644		Synechococcus_phage(100.0%)	1	NA	NA
WP_061871790.1|2412698_2413352_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	29.0	1.7e-14
>prophage 178
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2434853	2441357	3223644		uncultured_virus(33.33%)	5	NA	NA
WP_063721955.1|2434853_2436779_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.9	5.0e-83
WP_003642307.1|2437141_2438263_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	27.8	3.2e-13
WP_003642306.1|2438466_2438682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644879.1|2439493_2440666_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_011102021.1|2440961_2441357_-	transglycosylase	NA	A0A249XZV3	Enterococcus_phage	60.0	2.1e-15
>prophage 179
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2444921	2445812	3223644		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003642298.1|2444921_2445812_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.4	1.6e-55
>prophage 180
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2448961	2452460	3223644		Bacillus_phage(100.0%)	2	NA	NA
WP_011102016.1|2448961_2450686_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.8	6.2e-32
WP_003642294.1|2450678_2452460_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	4.3e-44
>prophage 181
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2461268	2464421	3223644		Streptococcus_phage(50.0%)	3	NA	NA
WP_087614943.1|2461268_2462789_+	Y-family DNA polymerase	NA	D0R0A3	Streptococcus_phage	27.6	3.8e-25
WP_003642280.1|2462788_2463214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087614944.1|2463284_2464421_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.2	5.7e-18
>prophage 182
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2468166	2469883	3223644		Lactobacillus_phage(100.0%)	2	NA	NA
WP_003643362.1|2468166_2468829_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K9V574	Lactobacillus_phage	49.3	4.5e-15
WP_003643361.1|2469268_2469883_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K9V574	Lactobacillus_phage	61.5	3.3e-12
>prophage 183
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2482972	2484973	3223644		Planktothrix_phage(100.0%)	1	NA	NA
WP_063723011.1|2482972_2484973_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.2	1.7e-33
>prophage 184
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2496840	2498963	3223644		Brazilian_cedratvirus(33.33%)	3	NA	NA
WP_003642244.1|2496840_2497620_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	24.0	3.2e-12
WP_003646064.1|2497620_2498325_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	9.0e-14
WP_003642242.1|2498327_2498963_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	40.9	3.2e-34
>prophage 185
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2505789	2506563	3223644		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_087614952.1|2505789_2506563_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.8	4.3e-09
>prophage 186
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2510812	2512570	3223644		Bacillus_phage(100.0%)	1	NA	NA
WP_021356617.1|2510812_2512570_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	41.6	6.0e-107
>prophage 187
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2536562	2542812	3223644		Enterococcus_phage(50.0%)	6	NA	NA
WP_003644790.1|2536562_2536973_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	43.8	1.5e-13
WP_003644789.1|2537115_2537589_-	lipoprotein	NA	NA	NA	NA	NA
WP_003644788.1|2538037_2540260_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.0	3.6e-250
WP_003644787.1|2540192_2540774_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.7	3.0e-55
WP_003642202.1|2540985_2541666_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003642201.1|2541681_2542812_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.0	5.7e-18
>prophage 188
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2549671	2551015	3223644		Shearwaterpox_virus(100.0%)	1	NA	NA
WP_011101973.1|2549671_2551015_+	alkaline phosphatase family protein	NA	A0A1V0QG10	Shearwaterpox_virus	21.3	1.4e-07
>prophage 189
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2555140	2557648	3223644		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_087614963.1|2555140_2557648_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.3	7.4e-135
>prophage 190
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2560819	2564791	3223644	protease,transposase	Klosneuvirus(50.0%)	3	NA	NA
WP_003644778.1|2560819_2562442_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	26.9	8.4e-47
WP_027821785.1|2562535_2563741_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_044429853.1|2564326_2564791_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.2	8.8e-18
>prophage 191
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2575889	2579428	3223644		Bacillus_phage(100.0%)	2	NA	NA
WP_022638330.1|2575889_2577641_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.6	7.6e-54
WP_054395872.1|2577640_2579428_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.0	2.5e-44
>prophage 192
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2598952	2599654	3223644		Planktothrix_phage(100.0%)	1	NA	NA
WP_003644830.1|2598952_2599654_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.5e-32
>prophage 193
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2603609	2605286	3223644	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_087614972.1|2603609_2605286_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.4e-92
>prophage 194
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2611494	2613971	3223644		Enterococcus_phage(50.0%)	2	NA	NA
WP_024521825.1|2611494_2612559_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A288TY55	Enterococcus_phage	70.8	1.8e-18
WP_024521824.1|2613026_2613971_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1S5RCR7	Lactobacillus_phage	56.4	2.8e-10
>prophage 195
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2633073	2633754	3223644		Planktothrix_phage(100.0%)	1	NA	NA
WP_003642105.1|2633073_2633754_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.5e-31
>prophage 196
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2642268	2646013	3223644	tRNA	Lactobacillus_virus(50.0%)	3	NA	NA
WP_044431744.1|2642268_2643567_+	glycosyl hydrolase	NA	Q5ULM6	Lactobacillus_virus	42.1	1.0e-34
WP_003644748.1|2643666_2644332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642093.1|2644756_2646013_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	43.1	3.5e-85
>prophage 197
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2653608	2655360	3223644		Staphylococcus_phage(100.0%)	2	NA	NA
WP_003644747.1|2653608_2654475_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	1.5e-50
WP_076642626.1|2654493_2655360_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.6	1.3e-49
>prophage 198
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2675100	2675775	3223644		Lactococcus_phage(100.0%)	1	NA	NA
WP_003645837.1|2675100_2675775_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	27.0	4.2e-08
>prophage 199
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2683722	2687907	3223644		Staphylococcus_phage(50.0%)	4	NA	NA
WP_087614976.1|2683722_2684466_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.2e-27
WP_016511800.1|2684443_2685694_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003642548.1|2685698_2686370_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013355846.1|2686473_2687907_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	43.8	1.6e-94
>prophage 200
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2693601	2694953	3223644		Listeria_phage(50.0%)	3	NA	NA
WP_003642553.1|2693601_2693823_+	DUF2829 domain-containing protein	NA	A8AT88	Listeria_phage	35.2	6.7e-08
WP_003642554.1|2693822_2694569_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_003642555.1|2694584_2694953_+	HIT family protein	NA	D7NW73	Streptomyces_phage	40.6	6.8e-13
>prophage 201
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2706483	2713569	3223644	transposase	Lactococcus_phage(33.33%)	10	NA	NA
WP_044429853.1|2706483_2706948_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.2	8.8e-18
WP_063203948.1|2707106_2707523_-	GtrA family protein	NA	NA	NA	NA	NA
WP_011101903.1|2707600_2707852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644733.1|2708041_2708512_+	universal stress protein	NA	NA	NA	NA	NA
WP_011101902.1|2708627_2709437_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003642573.1|2709426_2710305_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	7.1e-16
WP_003642574.1|2710301_2710673_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642575.1|2710700_2710976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003645858.1|2710998_2712780_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003642577.1|2712810_2713569_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	4.6e-32
>prophage 202
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2719031	2731577	3223644		Lactobacillus_phage(22.22%)	12	NA	NA
WP_003642583.1|2719031_2719640_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	54.5	7.9e-59
WP_063203947.1|2719654_2720962_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	59.8	3.6e-56
WP_003642585.1|2721529_2722015_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_046811071.1|2721998_2723129_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642587.1|2723131_2723863_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003642588.1|2723864_2724119_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011101895.1|2724118_2724799_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_087614978.1|2724791_2727011_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	5.9e-144
WP_003642591.1|2726995_2728450_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_027821845.1|2728446_2729472_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.3	9.3e-60
WP_003645867.1|2729464_2730043_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_087614979.1|2730044_2731577_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	53.8	1.1e-45
>prophage 203
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2737865	2740858	3223644		Moraxella_phage(50.0%)	2	NA	NA
WP_003645873.1|2737865_2739149_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.7	8.1e-45
WP_003642603.1|2739517_2740858_-	purine permease	NA	Q9KX94	Enterobacteria_phage	28.6	1.4e-34
>prophage 204
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2744347	2747670	3223644		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_011101888.1|2744347_2745283_+	aspartate carbamoyltransferase	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	32.7	6.5e-28
WP_003644720.1|2745286_2746579_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011101887.1|2746575_2747670_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	8.1e-54
>prophage 205
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2758260	2762010	3223644		Bacillus_phage(100.0%)	1	NA	NA
WP_087614980.1|2758260_2762010_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	22.6	2.2e-13
>prophage 206
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2769581	2774841	3223644		Cyanophage(50.0%)	5	NA	NA
WP_003644713.1|2769581_2771066_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.5	1.4e-77
WP_003642623.1|2771183_2771531_-	SdpI family protein	NA	NA	NA	NA	NA
WP_044431646.1|2771938_2772883_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011101878.1|2772968_2773346_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003645896.1|2773677_2774841_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	33.7	1.1e-56
>prophage 207
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2782130	2782787	3223644		Pandoravirus(100.0%)	1	NA	NA
WP_003642635.1|2782130_2782787_+	HD domain-containing protein	NA	S4W232	Pandoravirus	31.2	1.3e-11
>prophage 208
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2800809	2803167	3223644		Enterococcus_phage(100.0%)	1	NA	NA
WP_015825798.1|2800809_2803167_+	cell wall hydrolase	NA	A0A249Y0X5	Enterococcus_phage	51.9	2.2e-40
>prophage 209
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2821219	2823308	3223644		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003642672.1|2821219_2821930_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	2.7e-10
WP_003642673.1|2821919_2822693_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003642674.1|2822753_2823308_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	40.5	4.1e-30
>prophage 210
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2833136	2834021	3223644		Lactobacillus_virus(100.0%)	1	NA	NA
WP_027821865.1|2833136_2834021_-	ribonuclease	NA	C1KFJ1	Lactobacillus_virus	36.9	2.4e-32
>prophage 211
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2841848	2846177	3223644		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003642695.1|2841848_2843642_-	glycerophosphoryl diester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	26.4	4.2e-07
WP_003646579.1|2844023_2846177_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	49.1	2.7e-170
>prophage 212
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2856586	2857411	3223644		Tetraselmis_virus(100.0%)	1	NA	NA
WP_011101829.1|2856586_2857411_+	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	25.8	1.1e-05
>prophage 213
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2866509	2871536	3223644		Klosneuvirus(33.33%)	7	NA	NA
WP_003642716.1|2866509_2867229_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	A0A1V0SIZ6	Klosneuvirus	25.1	3.5e-05
WP_003646590.1|2867222_2867981_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_003644681.1|2867977_2868304_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_024521746.1|2868444_2868765_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_047673788.1|2868776_2869847_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	24.0	1.4e-18
WP_065080495.1|2870032_2870587_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003642722.1|2870762_2871536_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	43.5	2.7e-43
>prophage 214
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2875222	2876005	3223644		Indivirus(100.0%)	1	NA	NA
WP_003642726.1|2875222_2876005_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	27.2	4.1e-07
>prophage 215
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2880196	2881483	3223644		Pandoravirus(100.0%)	1	NA	NA
WP_063203957.1|2880196_2881483_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	24.0	2.7e-08
>prophage 216
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2890333	2891887	3223644		Streptococcus_phage(100.0%)	1	NA	NA
WP_003646605.1|2890333_2891887_+	ABC-F family ATP-binding cassette domain-containing protein	NA	Q6DMX7	Streptococcus_phage	27.0	1.2e-39
>prophage 217
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2904569	2908295	3223644		Bacillus_phage(50.0%)	3	NA	NA
WP_003646617.1|2904569_2905298_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	2.1e-34
WP_003642756.1|2905294_2906818_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003642757.1|2907113_2908295_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	30.1	1.0e-46
>prophage 218
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2911981	2917306	3223644		Planktothrix_phage(50.0%)	3	NA	NA
WP_003642761.1|2911981_2913976_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.3	7.2e-32
WP_003642762.1|2913993_2915571_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_087614988.1|2915542_2917306_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.9	3.6e-96
>prophage 219
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2928329	2931949	3223644		Bacillus_phage(100.0%)	2	NA	NA
WP_003644665.1|2928329_2930060_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	2.6e-46
WP_003641422.1|2930059_2931949_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	9.4e-58
>prophage 220
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2935280	2936300	3223644		Mycobacterium_phage(100.0%)	1	NA	NA
WP_087614991.1|2935280_2936300_+	serine hydrolase	NA	A0A249XPW4	Mycobacterium_phage	24.6	2.4e-07
>prophage 221
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2939934	2948217	3223644		Enterococcus_phage(25.0%)	8	NA	NA
WP_003644660.1|2939934_2940513_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	49.7	7.3e-46
WP_003641433.1|2940526_2941609_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_003641434.1|2941601_2942468_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003641435.1|2942758_2943778_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	41.5	9.3e-52
WP_003641436.1|2943836_2945075_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	50.6	1.4e-94
WP_003639227.1|2945154_2945784_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003645418.1|2946101_2946275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015825748.1|2946936_2948217_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	37.1	9.2e-65
>prophage 222
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2959029	2962592	3223644		Staphylococcus_phage(50.0%)	5	NA	NA
WP_003644657.1|2959029_2959302_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	47.7	9.8e-17
WP_003641449.1|2959285_2959513_+	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_003644656.1|2959660_2960866_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003644655.1|2960896_2961193_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_003641452.1|2961560_2962592_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	3.2e-28
>prophage 223
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2974502	2975783	3223644		Bacillus_phage(100.0%)	1	NA	NA
WP_003641463.1|2974502_2975783_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.8	9.7e-99
>prophage 224
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	2994467	2997137	3223644	tRNA	Catovirus(100.0%)	1	NA	NA
WP_044431249.1|2994467_2997137_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.2	1.4e-163
>prophage 225
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3004758	3005400	3223644		Planktothrix_phage(100.0%)	1	NA	NA
WP_003641493.1|3004758_3005400_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	4.5e-28
>prophage 226
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3008897	3010163	3223644		Streptococcus_phage(100.0%)	1	NA	NA
WP_024002506.1|3008897_3010163_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	32.5	1.9e-54
>prophage 227
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3014669	3023455	3223644		Bacillus_phage(33.33%)	5	NA	NA
WP_047673645.1|3014669_3015812_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	65.6	8.6e-123
WP_087614995.1|3016042_3017602_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_003641506.1|3017726_3018533_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_003641507.1|3018560_3021251_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.1	6.9e-38
WP_065080581.1|3021418_3023455_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.6	1.1e-56
>prophage 228
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3029605	3047189	3223644	tRNA	Bacillus_phage(14.29%)	17	NA	NA
WP_003641514.1|3029605_3030616_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	29.6	9.6e-09
WP_003641515.1|3030633_3031668_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003641516.1|3031977_3033120_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.9	3.0e-83
WP_003645451.1|3033197_3033581_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003641518.1|3033710_3034844_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_003641519.1|3034936_3035893_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_003645450.1|3035895_3037239_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	1.5e-46
WP_021356040.1|3037566_3040209_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	32.0	1.5e-61
WP_003641523.1|3040595_3040865_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_003641524.1|3040861_3041296_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003641525.1|3041308_3041605_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_003645448.1|3041736_3041988_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_069137368.1|3042047_3044411_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	53.1	5.0e-24
WP_003641528.1|3044566_3044878_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	45.8	4.2e-16
WP_003641529.1|3045045_3045729_-	YslB family protein	NA	NA	NA	NA	NA
WP_003645446.1|3045766_3046588_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003641531.1|3046580_3047189_+	XTP/dITP diphosphatase	NA	X5LRP0	Ugandan_cassava_brown_streak_virus	28.6	6.8e-10
>prophage 229
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3067057	3067666	3223644		Escherichia_phage(100.0%)	1	NA	NA
WP_003641558.1|3067057_3067666_+	metallophosphatase	NA	H6W7Z4	Escherichia_phage	28.8	9.8e-09
>prophage 230
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3072117	3072702	3223644		Indivirus(100.0%)	1	NA	NA
WP_003641564.1|3072117_3072702_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	44.2	8.5e-26
>prophage 231
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3099769	3102157	3223644		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003645941.1|3099769_3102157_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.9	2.4e-82
>prophage 232
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3118242	3121041	3223644	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_033608787.1|3118242_3121041_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.8	3.6e-90
>prophage 233
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3134570	3144981	3223644		Virus_Rctr197k(20.0%)	9	NA	NA
WP_011101675.1|3134570_3137120_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.1	1.3e-49
WP_003645927.1|3137274_3138240_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	33.0	2.5e-38
WP_003640832.1|3138599_3140090_+	peptidoglycan endopeptidase	NA	D2KRB9	Lactobacillus_phage	42.6	3.3e-13
WP_087615001.1|3140263_3140467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355677.1|3140688_3141648_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.7	2.9e-15
WP_003640828.1|3141710_3143387_-	ribonuclease J	NA	NA	NA	NA	NA
WP_003640827.1|3143383_3143602_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_003640826.1|3143884_3144391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645922.1|3144420_3144981_-	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	36.5	1.0e-12
>prophage 234
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3148738	3150151	3223644		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003640822.1|3148738_3150151_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	2.8e-46
>prophage 235
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3166706	3171897	3223644		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_003644584.1|3166706_3167198_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.9	1.9e-23
WP_003640808.1|3167190_3168237_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_013355671.1|3168339_3169065_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_003645663.1|3169119_3169605_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	55.3	1.2e-33
WP_087615003.1|3169605_3171897_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	29.5	2.8e-24
>prophage 236
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3179101	3187719	3223644	protease	Hokovirus(25.0%)	9	NA	NA
WP_003640798.1|3179101_3180289_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	29.7	2.5e-32
WP_003640797.1|3180492_3181815_+	trigger factor	NA	NA	NA	NA	NA
WP_003640796.1|3182109_3183375_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.9	1.6e-141
WP_003640795.1|3183533_3184127_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003640794.1|3184128_3184425_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	51.6	2.9e-22
WP_003644577.1|3184671_3185079_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003640792.1|3185134_3185305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640791.1|3185510_3186986_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003640790.1|3186978_3187719_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	2.2e-31
>prophage 237
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3192397	3193339	3223644		Catovirus(100.0%)	1	NA	NA
WP_065080381.1|3192397_3193339_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI6	Catovirus	35.2	1.6e-37
>prophage 238
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3204353	3205109	3223644		Escherichia_phage(100.0%)	1	NA	NA
WP_003644567.1|3204353_3205109_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.8	1.6e-21
>prophage 239
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3209636	3212510	3223644		Bacillus_phage(50.0%)	2	NA	NA
WP_011101649.1|3209636_3211973_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.4	2.3e-74
WP_003640768.1|3211991_3212510_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.1	9.5e-29
>prophage 240
NZ_CP028220	Lactobacillus plantarum strain SRCM100440 chromosome, complete genome	3223644	3219166	3223402	3223644	integrase	Lactobacillus_phage(66.67%)	5	3218375:3218387	3221144:3221156
3218375:3218387	attL	TGATATCAATATT	NA	NA	NA	NA
WP_087615009.1|3219166_3220330_-|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	37.4	1.0e-62
WP_003641356.1|3220498_3220813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087615012.1|3221918_3222137_-	hypothetical protein	NA	NA	NA	NA	NA
3221144:3221156	attR	TGATATCAATATT	NA	NA	NA	NA
WP_087615013.1|3222139_3222874_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	54.5	7.4e-43
WP_157664744.1|3222904_3223402_-	toxin	NA	A0A0A7RTX7	Clostridium_phage	31.9	7.8e-12
