The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	0	108527	4098278	holin,protease,tRNA,portal,terminase,plate,head,coat,capsid,tail,integrase	Bacillus_phage(74.0%)	119	5267:5286	84733:84752
WP_014476869.1|448_682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245758.1|961_1669_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_003231775.1|1738_2191_+	OsmC family protein	NA	NA	NA	NA	NA
WP_046381046.1|2204_2558_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
WP_015483253.1|2571_2889_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
WP_029317825.1|3024_3300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231769.1|3388_3802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038429003.1|3901_4846_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003221097.1|4885_5107_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
5267:5286	attL	ATATTATGTATAAAATGAAT	NA	NA	NA	NA
WP_014479841.1|5302_5575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245262.1|5656_5887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231758.1|6129_6522_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|6481_8584_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|8601_9591_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|9640_10261_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_046381048.1|10324_11092_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.6e-51
WP_003231746.1|11715_12684_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_015483254.1|12816_14079_+	GTPase HflX	NA	NA	NA	NA	NA
WP_046160429.1|14096_15362_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003238341.1|15471_15879_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_003231737.1|15937_17272_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_160216207.1|17384_18539_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	39.2	4.8e-65
WP_103671446.1|18589_19645_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_103671447.1|19637_19970_-	helix-turn-helix transcriptional regulator	NA	R9VW28	Paenibacillus_phage	46.3	1.1e-09
WP_160216208.1|20074_20287_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_160216209.1|20400_21165_+	Rha family transcriptional regulator	NA	A8ATN0	Listeria_phage	49.3	1.2e-51
WP_160216210.1|21179_21491_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105778750.1|21551_21743_+	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	53.1	7.1e-06
WP_160216211.1|21739_22015_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	46.0	1.2e-19
WP_160216212.1|22208_22763_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	95.7	3.4e-93
WP_160216213.1|22766_23705_+	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	92.3	2.4e-163
WP_019260095.1|23694_23892_+	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	87.5	1.1e-17
WP_160216214.1|23914_24355_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	95.2	1.0e-76
WP_160216215.1|24415_26833_+	DNA primase	NA	D6R422	Bacillus_phage	87.5	0.0e+00
WP_160216216.1|27096_27534_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	86.2	2.9e-71
WP_160216217.1|27530_28070_+	nuclease	NA	Q9ZXC2	Bacillus_phage	96.1	1.1e-93
WP_019260090.1|28103_28619_+	hypothetical protein	NA	D6R425	Bacillus_phage	97.7	1.2e-95
WP_060399192.1|28872_29286_+	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	97.7	5.6e-64
WP_160216218.1|29351_30071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160216219.1|30531_31047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160216220.1|31226_31802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160216221.1|31856_33017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160216222.1|33070_33436_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.2	1.2e-30
WP_019846969.1|33664_34180_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.4	2.2e-33
WP_160216223.1|34176_35886_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.8	8.4e-207
WP_160216224.1|36074_37355_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.8	6.2e-154
WP_160216225.1|37317_37944_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	76.3	1.5e-81
WP_160216226.1|37982_39278_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	48.0	1.1e-92
WP_019260073.1|39301_39763_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	58.9	1.4e-10
WP_160216227.1|39780_40083_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	47.6	1.6e-12
WP_160216228.1|40072_40387_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	3.8e-12
WP_032725460.1|40386_40785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160216229.1|40781_41174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160216230.1|41188_41800_+|tail	phage tail protein	tail	J7KKC8	Streptococcus_phage	35.9	1.6e-11
WP_160216231.1|41865_42243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160216232.1|42440_46928_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.8	1.5e-66
WP_160216233.1|46921_47761_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	60.1	1.1e-98
WP_160216234.1|47775_49479_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	56.3	1.6e-178
WP_160216235.1|49530_52098_+	peptidase G2	NA	D6R401	Bacillus_phage	66.1	0.0e+00
WP_160216295.1|52113_53616_+|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	64.9	1.0e-67
WP_032725469.1|53599_53953_+	hypothetical protein	NA	O64053	Bacillus_phage	40.9	1.2e-11
WP_144481587.1|53953_54097_+	XkdX family protein	NA	NA	NA	NA	NA
WP_160216236.1|54115_54955_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	33.5	2.5e-31
WP_160216237.1|54995_55418_+|holin	holin family protein	holin	D6R405	Bacillus_phage	85.0	6.7e-57
WP_160216238.1|55461_56436_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	67.8	1.5e-62
WP_160216239.1|56489_56954_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_160216240.1|56967_58734_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	51.2	5.0e-130
WP_160216241.1|59082_60198_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	71.6	1.6e-145
WP_046160430.1|61610_61904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042975843.1|62150_62495_+	hypothetical protein	NA	O64021	Bacillus_phage	81.6	2.7e-32
WP_080262658.1|63061_63496_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_046160431.1|64878_65415_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046381049.1|65498_66395_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_160216242.1|66472_66853_+	UPF0715 family protein	NA	NA	NA	NA	NA
WP_014479898.1|67394_67625_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	75.0	2.1e-20
WP_046381050.1|67621_68263_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_014479901.1|69126_69291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479902.1|69430_69901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046381051.1|70697_72089_+	MFS transporter	NA	NA	NA	NA	NA
WP_014479906.1|72119_73721_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_046381052.1|73858_75013_-	ROK family protein	NA	NA	NA	NA	NA
WP_014479908.1|75250_76588_+	xylose isomerase	NA	NA	NA	NA	NA
WP_014479909.1|76738_78238_+	xylulokinase	NA	NA	NA	NA	NA
WP_014479910.1|78722_79358_-	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	68.5	7.7e-73
WP_033881939.1|79770_81186_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_031600564.1|81287_82472_-	alanine racemase	NA	NA	NA	NA	NA
WP_014479913.1|82882_83308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479915.1|84226_84661_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	92.3	5.8e-72
WP_033881937.1|85261_85525_-|coat	spore coat protein CotU	coat	NA	NA	NA	NA
84733:84752	attR	ATATTATGTATAAAATGAAT	NA	NA	NA	NA
WP_003231643.1|85931_86096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479918.1|86370_87210_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.2	5.6e-164
WP_121509411.1|87332_87620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479919.1|87662_88382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479920.1|88541_88898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479921.1|89143_89344_-|coat	spore coat protein CotC	coat	NA	NA	NA	NA
WP_003231634.1|89518_89707_-	twin-arginine translocase TatAC	NA	NA	NA	NA	NA
WP_009967329.1|89960_90359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231627.1|90424_90859_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_003231626.1|91165_91354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231618.1|94014_94821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003244960.1|94825_95443_+	DUF4166 domain-containing protein	NA	NA	NA	NA	NA
WP_003231612.1|95439_97080_+	YndJ family transporter	NA	NA	NA	NA	NA
WP_003231610.1|97116_97482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245793.1|97707_98466_+	gamma-polyglutamate hydrolase PghL	NA	O64134	Bacillus_phage	50.2	6.6e-55
WP_003231606.1|98492_99032_-	YndM family protein	NA	NA	NA	NA	NA
WP_046381053.1|99149_99569_+	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	66.1	2.6e-40
WP_003238209.1|100118_100736_-	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	2.5e-15
WP_003231598.1|100885_101203_+	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_014479938.1|101221_101875_+	recombinase family protein	NA	NA	NA	NA	NA
WP_003231595.1|101938_102172_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_014476936.1|102340_104344_+	transketolase	NA	NA	NA	NA	NA
WP_003231591.1|104496_104943_+	sporulation inhibitor of replication protein SirA	NA	NA	NA	NA	NA
WP_003221221.1|105028_105247_+	YneF family protein	NA	NA	NA	NA	NA
WP_010886518.1|105320_105494_-	aspartyl-phosphate phosphatase YnzD	NA	NA	NA	NA	NA
WP_003231585.1|105713_106421_+	cytochrome c-type biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_003245707.1|106509_106872_+	response regulator	NA	NA	NA	NA	NA
WP_010886519.1|106950_107442_+	CcdC family protein	NA	NA	NA	NA	NA
WP_003231580.1|107472_107901_-	DUF2621 domain-containing protein	NA	NA	NA	NA	NA
WP_072592538.1|108134_108527_-|coat	outer spore coat protein CotM	coat	NA	NA	NA	NA
>prophage 2
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	115957	120349	4098278		Bacillus_virus(50.0%)	2	NA	NA
WP_014479944.1|115957_117925_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.2	6.7e-123
WP_046381054.1|117928_120349_+	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.5	2.2e-99
>prophage 3
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	129206	130100	4098278		Bacillus_phage(100.0%)	1	NA	NA
WP_014479952.1|129206_130100_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.9	2.3e-83
>prophage 4
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	137029	138679	4098278		Staphylococcus_phage(100.0%)	1	NA	NA
WP_046381065.1|137029_138679_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.6	9.5e-30
>prophage 5
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	142654	180403	4098278		Tupanvirus(100.0%)	5	NA	NA
WP_082098079.1|142654_146494_-	non-ribosomal plipastatin synthetase PpsE	NA	A0A2K9KZV5	Tupanvirus	26.2	1.8e-84
WP_052728186.1|146501_157301_-	non-ribosomal plipastatin synthetase PpsD	NA	A0A2K9KZV5	Tupanvirus	27.5	7.0e-166
WP_160216243.1|157326_164994_-	non-ribosomal plipastatin synthetase PpsC	NA	A0A2K9L3I8	Tupanvirus	26.4	1.2e-159
WP_046381071.1|165010_172693_-	non-ribosomal plipastatin synthetase PpsB	NA	A0A2K9KZV5	Tupanvirus	27.1	2.8e-153
WP_046381072.1|172717_180403_-	non-ribosomal plipastatin synthetase PpsA	NA	A0A2K9KZV5	Tupanvirus	25.6	5.1e-86
>prophage 6
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	185845	189927	4098278	integrase	Bacillus_phage(50.0%)	4	166163:166176	186719:186732
166163:166176	attL	ATCCTTTACATCAA	NA	NA	NA	NA
WP_003231473.1|185845_186391_-|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	51.4	3.6e-42
WP_003231472.1|186709_186940_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
186719:186732	attR	ATCCTTTACATCAA	NA	NA	NA	NA
WP_160216244.1|187124_188888_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_046381077.1|189069_189927_-	LysR family transcriptional regulator YofA	NA	Q6JIH3	Burkholderia_virus	35.8	1.2e-07
>prophage 7
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	198261	201798	4098278		Streptococcus_phage(50.0%)	4	NA	NA
WP_042975927.1|198261_199377_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.7	5.3e-69
WP_010886524.1|199373_200267_-	Pyrroline-5-carboxylate reductase 1	NA	A0A1X9I6T5	Streptococcus_phage	32.7	1.0e-30
WP_046381082.1|200411_200783_-	replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.5	4.1e-18
WP_046381083.1|201081_201798_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	78.0	9.7e-48
>prophage 8
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	205556	206495	4098278		Staphylococcus_phage(100.0%)	1	NA	NA
WP_046381088.1|205556_206495_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.9	9.5e-27
>prophage 9
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	218284	222232	4098278		Enterobacteria_phage(50.0%)	4	NA	NA
WP_080121380.1|218284_219304_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.4	9.3e-28
WP_003241887.1|219971_220094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231427.1|220137_220431_+	YozQ family protein	NA	NA	NA	NA	NA
WP_003231425.1|220546_222232_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.0	2.8e-13
>prophage 10
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	227156	227840	4098278		Bacillus_phage(100.0%)	1	NA	NA
WP_004399422.1|227156_227840_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	83.8	9.9e-66
>prophage 11
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	238402	251560	4098278		Bacillus_phage(40.0%)	9	NA	NA
WP_046381096.1|238402_239323_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	43.2	3.0e-57
WP_046381099.1|240898_241162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046381100.1|241520_244112_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	34.2	3.1e-43
WP_015251938.1|244786_245428_-	endo-1,4-beta-xylanase XynA	NA	NA	NA	NA	NA
WP_046381101.1|246728_247064_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	89.2	3.5e-48
WP_046381102.1|247106_247463_-	hypothetical protein	NA	O64028	Bacillus_phage	98.3	1.2e-59
WP_046381103.1|247736_248891_-	universal stress protein	NA	NA	NA	NA	NA
WP_046381104.1|248942_249539_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_046381105.1|249535_251560_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.4	2.5e-32
>prophage 12
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	255679	262551	4098278		Bacillus_phage(75.0%)	4	NA	NA
WP_046381108.1|255679_257482_-	type II toxin-antitoxin system toxin ribonuclease YobL	NA	A0A1P8CWI7	Bacillus_phage	86.2	9.5e-217
WP_046381500.1|257582_258140_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	94.1	5.9e-101
WP_128484050.1|258267_259704_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	22.1	1.4e-08
WP_046381110.1|260130_262551_+	peptidase G2	NA	D6R401	Bacillus_phage	49.9	1.9e-220
>prophage 13
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	266991	269902	4098278		Streptococcus_phage(100.0%)	4	NA	NA
WP_046381113.1|266991_267930_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	27.1	3.7e-07
WP_046381114.1|268135_268681_+	kinase	NA	NA	NA	NA	NA
WP_003231284.1|268707_269031_-	Zn(II)-responsive metalloregulatory transcriptional repressor CzrA	NA	NA	NA	NA	NA
WP_003231283.1|269224_269902_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	35.0	7.6e-18
>prophage 14
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	276833	279720	4098278		Bacillus_phage(50.0%)	2	NA	NA
WP_003231267.1|276833_277697_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	71.7	1.4e-32
WP_004399229.1|277944_279720_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	37.3	1.1e-81
>prophage 15
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	287991	288837	4098278		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_019712210.1|287991_288837_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.1	2.9e-35
>prophage 16
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	297699	302191	4098278		Halovirus(33.33%)	4	NA	NA
WP_010886530.1|297699_298614_-	MoxR family ATPase	NA	R4TG24	Halovirus	27.6	5.1e-09
WP_019712213.1|298677_299268_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_003231224.1|299360_300605_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.2	1.0e-15
WP_003231222.1|300973_302191_-	glycosyl transferase family 1	NA	G4WEM5	Phthorimaea_operculella_granulovirus	30.7	8.6e-12
>prophage 17
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	335549	336575	4098278		Catovirus(100.0%)	1	NA	NA
WP_046381121.1|335549_336575_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.0	5.9e-38
>prophage 18
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	346127	348042	4098278		Bacillus_virus(66.67%)	3	NA	NA
WP_015251863.1|346127_346634_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	49.1	4.2e-37
WP_044052509.1|346630_347425_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	66.7	8.7e-106
WP_003230797.1|347508_348042_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.5	1.2e-50
>prophage 19
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	353445	354063	4098278		Pandoravirus(100.0%)	1	NA	NA
WP_046381127.1|353445_354063_-	Mn(2+)-dependent (deoxy)ribonucleoside pyrophosphohydrolase	NA	S4W232	Pandoravirus	27.2	5.3e-10
>prophage 20
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	357430	361411	4098278		Lactococcus_phage(50.0%)	9	NA	NA
WP_003230776.1|357430_357631_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.9	4.2e-17
WP_003230774.1|357682_357865_-	transcriptional regulator DegR	NA	NA	NA	NA	NA
WP_015251856.1|358020_358290_+	DUF2564 family protein	NA	NA	NA	NA	NA
WP_004399003.1|358317_358500_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_021481511.1|358492_359173_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_038429197.1|359255_359945_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_003230765.1|359944_360343_+	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_003218255.1|360384_360513_+	small, acid-soluble spore protein L	NA	NA	NA	NA	NA
WP_003230763.1|360520_361411_-	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	28.7	3.2e-24
>prophage 21
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	377013	378939	4098278		Streptomyces_phage(100.0%)	1	NA	NA
WP_046381135.1|377013_378939_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	22.2	1.4e-11
>prophage 22
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	384108	386358	4098278		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_046381138.1|384108_386358_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	28.6	6.7e-10
>prophage 23
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	390329	390950	4098278		Bacillus_phage(100.0%)	1	NA	NA
WP_004399067.1|390329_390950_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	5.5e-23
>prophage 24
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	394948	406589	4098278	tRNA	Bacillus_phage(40.0%)	11	NA	NA
WP_029726781.1|394948_395647_-	DNA replication protein DnaD	NA	A0A0N7AE27	Bacillus_phage	42.7	3.3e-24
WP_004398777.1|395739_397032_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.1	1.7e-58
WP_004398489.1|397175_398357_-	aspartate transaminase AspB	NA	NA	NA	NA	NA
WP_046381142.1|398379_398865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015251828.1|398873_399044_-	YpmA family protein	NA	NA	NA	NA	NA
WP_046381143.1|399186_401982_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.6	3.8e-55
WP_003225586.1|402107_402491_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_046381144.1|402492_403353_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_003230652.1|403354_404188_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	39.1	3.2e-50
WP_003230650.1|404433_405411_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_046381145.1|405395_406589_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	44.8	2.6e-37
>prophage 25
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	410145	411018	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_046381147.1|410145_411018_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.8	1.3e-73
>prophage 26
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	415251	415791	4098278		Bacillus_virus(100.0%)	1	NA	NA
WP_015251820.1|415251_415791_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	48.6	2.7e-42
>prophage 27
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	419929	425415	4098278		Acinetobacter_phage(66.67%)	6	NA	NA
WP_004399129.1|419929_421012_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	28.5	6.0e-25
WP_003230608.1|421022_421826_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_014480121.1|421818_423021_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_015251816.1|423001_423649_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_015251815.1|423653_424406_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	43.6	5.2e-44
WP_015251814.1|424398_425415_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	6.4e-61
>prophage 28
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	428617	435339	4098278		Pandoravirus(25.0%)	9	NA	NA
WP_004398727.1|428617_429790_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.9	4.2e-40
WP_003230589.1|429864_430635_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_010886554.1|430871_431321_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.3	2.4e-28
WP_010886555.1|431436_432483_-	Heptaprenyl diphosphate synthase component 2	NA	NA	NA	NA	NA
WP_003230580.1|432424_433126_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_004398550.1|433132_433888_-	Heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003230576.1|434051_434279_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_003225516.1|434300_434873_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.7	4.9e-50
WP_003153447.1|435060_435339_-	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	75.3	1.1e-28
>prophage 29
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	448669	449587	4098278		Bacillus_phage(100.0%)	1	NA	NA
WP_004398523.1|448669_449587_-	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	40.3	1.6e-18
>prophage 30
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	456430	467414	4098278		Bacillus_phage(60.0%)	10	NA	NA
WP_003230528.1|456430_457921_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.0	9.4e-61
WP_004398594.1|457913_458972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003225461.1|459237_459486_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	56.8	1.6e-18
WP_004399159.1|459525_460098_-	riboflavin transporter FmnP	NA	NA	NA	NA	NA
WP_004398713.1|460594_462172_+	D-3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	35.1	1.3e-36
WP_046381154.1|462216_462984_-	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_046381155.1|463095_464202_-	anti-sigma-X factor RsiX	NA	NA	NA	NA	NA
WP_003230521.1|464137_464722_-	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_046381156.1|464925_466695_-	sensor histidine kinase ResE	NA	W8CYF6	Bacillus_phage	38.9	1.6e-38
WP_003246107.1|466691_467414_-	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	42.2	2.7e-45
>prophage 31
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	472893	480854	4098278		Staphylococcus_phage(57.14%)	10	NA	NA
WP_014480157.1|472893_474042_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.5	6.0e-23
WP_014477219.1|474164_474704_-	YpuI family protein	NA	NA	NA	NA	NA
WP_003223904.1|474758_475352_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
WP_046381501.1|475341_476097_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	7.2e-09
WP_046381158.1|476377_476902_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|476915_477290_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|477402_477867_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_003230496.1|477899_479096_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	5.3e-115
WP_004398505.1|479110_479758_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	5.0e-43
WP_046381159.1|479768_480854_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	1.7e-56
>prophage 32
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	488324	488756	4098278		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003223931.1|488324_488756_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	42.9	1.2e-16
>prophage 33
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	496395	502448	4098278		Bacillus_phage(25.0%)	7	NA	NA
WP_003230458.1|496395_497163_-	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	60.7	1.0e-71
WP_003230452.1|497174_497615_-	anti-sigma F factor	NA	NA	NA	NA	NA
WP_004398633.1|497611_497965_-	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_004398637.1|498060_499230_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.0	1.1e-35
WP_003230447.1|499384_500200_-	purine nucleoside phosphorylase I, inosine and guanosine-specific	NA	Q5YBA4	Grouper_iridovirus	48.2	1.3e-69
WP_015251776.1|500212_501397_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_004398985.1|501557_502448_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	34.0	1.7e-41
>prophage 34
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	515159	526950	4098278		Erysipelothrix_phage(14.29%)	13	NA	NA
WP_004398771.1|515159_516191_-	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	41.2	6.3e-32
WP_003245961.1|516183_516528_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004398668.1|516537_517008_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004398477.1|517193_517532_-	YolD-like family protein	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	27.9	2.8e-05
WP_010886562.1|517528_518767_-	DNA polymerase IV 2	NA	O64031	Bacillus_phage	42.8	2.3e-76
WP_004398642.1|518932_519139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726749.1|519682_520936_+	MFS transporter	NA	NA	NA	NA	NA
WP_015251763.1|521120_521507_-	hypothetical protein	NA	V5UQY3	Oenococcus_phage	55.6	3.3e-34
WP_003245966.1|521511_522471_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.3	5.5e-30
WP_160216245.1|522542_523889_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_015483409.1|523964_524744_-	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	27.1	7.4e-09
WP_029726748.1|524749_525709_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_029317946.1|526113_526950_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.8	5.3e-29
>prophage 35
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	532117	535119	4098278		Cyanophage(50.0%)	2	NA	NA
WP_014114310.1|532117_533587_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.2	3.6e-81
WP_003230365.1|533709_535119_-	NADP-dependent phosphogluconate dehydrogenase	NA	V5UT40	Synechococcus_phage	33.7	1.5e-36
>prophage 36
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	543535	544258	4098278		Planktothrix_phage(100.0%)	1	NA	NA
WP_003230342.1|543535_544258_-	arginine ABC transporter ATP-binding protein ArtR	NA	G9BWD6	Planktothrix_phage	40.9	1.5e-32
>prophage 37
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	567127	571785	4098278		Staphylococcus_phage(33.33%)	6	NA	NA
WP_003230288.1|567127_567859_-	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	28.8	4.1e-17
WP_010886565.1|567937_568558_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	42.5	2.9e-24
WP_003230284.1|568572_568866_-	lipoprotein	NA	NA	NA	NA	NA
WP_003230276.1|569173_569326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398691.1|569398_570517_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003226427.1|570981_571785_-	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	35.0	7.1e-07
>prophage 38
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	579881	582217	4098278		Gordonia_phage(50.0%)	2	NA	NA
WP_029726730.1|579881_581228_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	32.9	1.5e-28
WP_003230259.1|581365_582217_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	43.0	5.9e-44
>prophage 39
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	595401	604410	4098278		Prochlorococcus_phage(50.0%)	8	NA	NA
WP_029726728.1|595401_596277_-	patatin-like phospholipase family protein	NA	A0A1V0SFX9	Hokovirus	28.7	2.9e-17
WP_003236923.1|596402_596831_-	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_014664579.1|596930_597767_-	octanoyltransferase LipM	NA	NA	NA	NA	NA
WP_004398485.1|597957_598338_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_029726727.1|598372_599839_-	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	42.2	1.4e-85
WP_029317920.1|599831_601178_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.4	3.4e-62
WP_015714248.1|601207_602296_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_029726726.1|602736_604410_+	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	31.2	5.8e-59
>prophage 40
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	621534	623451	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_046381182.1|621534_623451_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	37.7	1.6e-100
>prophage 41
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	630172	631775	4098278		Indivirus(50.0%)	2	NA	NA
WP_014480273.1|630172_630955_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.5	2.2e-16
WP_009967747.1|630965_631775_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	1.2e-14
>prophage 42
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	638397	639006	4098278		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_004398583.1|638397_639006_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	61.1	3.2e-68
>prophage 43
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	645212	655263	4098278	tRNA	Bodo_saltans_virus(20.0%)	9	NA	NA
WP_046381187.1|645212_646106_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.0	1.7e-25
WP_046381188.1|646115_647432_-	DEAD-box ATP-dependent RNA helicase CshB	NA	A0A1V0SIR5	Klosneuvirus	34.5	5.0e-50
WP_046381189.1|647600_648335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014477361.1|648457_649402_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_046381190.1|649424_650546_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	48.0	7.1e-21
WP_080481046.1|650538_651228_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_003230068.1|651445_651808_-	cytochrome c-550	NA	NA	NA	NA	NA
WP_003226225.1|652137_653253_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.1	5.8e-39
WP_046381192.1|653451_655263_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.0	1.1e-52
>prophage 44
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	666419	667379	4098278		Rhizobium_phage(100.0%)	1	NA	NA
WP_014477373.1|666419_667379_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	54.0	1.8e-52
>prophage 45
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	671833	672280	4098278		Xanthomonas_phage(100.0%)	1	NA	NA
WP_003230022.1|671833_672280_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	36.1	3.1e-12
>prophage 46
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	676707	684671	4098278		Catovirus(33.33%)	6	NA	NA
WP_003230010.1|676707_677835_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	28.8	4.5e-23
WP_004398786.1|678034_679870_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.5	6.2e-139
WP_003230005.1|679893_680457_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003246126.1|680528_681560_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_015714284.1|681640_682780_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_003229999.1|682832_684671_-	elongation factor 4	NA	A0A1B0RXH7	Streptococcus_phage	24.6	2.6e-20
>prophage 47
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	689466	692370	4098278		Clostridium_botulinum_C_phage(50.0%)	2	NA	NA
WP_069704087.1|689466_691797_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	34.7	1.2e-35
WP_003229978.1|691800_692370_-	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	52.5	2.8e-34
>prophage 48
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	695688	696258	4098278		Bacillus_virus(100.0%)	1	NA	NA
WP_004398676.1|695688_696258_-	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	31.5	1.1e-22
>prophage 49
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	700826	705645	4098278		Bacillus_phage(75.0%)	6	NA	NA
WP_046381197.1|700826_701579_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	63.7	7.5e-67
WP_046381198.1|701765_702392_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_015714298.1|702410_703304_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	35.4	1.1e-56
WP_046381199.1|703555_704278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967785.1|704310_704721_-	sporulation-specific Dnase NucB	NA	F8WPS9	Bacillus_phage	60.6	7.8e-42
WP_003226102.1|704919_705645_+	RNA polymerase sporulation sigma factor SigK	NA	A0A0A0RV91	Bacillus_phage	27.5	1.8e-12
>prophage 50
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	715736	716297	4098278		Bacillus_phage(100.0%)	1	NA	NA
WP_046381206.1|715736_716297_-	cupin domain-containing protein	NA	Q2Q459	Bacillus_phage	55.8	1.3e-55
>prophage 51
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	723590	724628	4098278		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_019712545.1|723590_724628_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	25.9	1.9e-15
>prophage 52
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	735044	735899	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_046381214.1|735044_735899_-	aminoglycoside 6-adenylyltransferase AadK	NA	E4ZFP8	Streptococcus_phage	58.6	9.7e-95
>prophage 53
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	747374	748208	4098278		Streptomyces_phage(100.0%)	1	NA	NA
WP_003229851.1|747374_748208_-	chitosanase	NA	A0A223LHY0	Streptomyces_phage	33.2	3.8e-19
>prophage 54
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	752842	759467	4098278	protease,coat	Synechococcus_phage(33.33%)	8	NA	NA
WP_003229843.1|752842_753979_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.1	2.2e-14
WP_003229842.1|753997_754195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003246006.1|754210_754510_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_004398725.1|754772_755195_-	aldehyde stress transcriptional regulator AdhR	NA	NA	NA	NA	NA
WP_003229839.1|755377_755572_+	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_019712532.1|755702_756752_+	formaldehyde dehydrogenase AdhA	NA	A0A2K9L339	Tupanvirus	41.5	9.5e-68
WP_003229836.1|756882_757392_+|protease	cysteine protease YraA	protease	NA	NA	NA	NA
WP_004398804.1|757433_759467_-	levanase	NA	S6ATV4	Bacillus_phage	38.0	1.7e-84
>prophage 55
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	770708	772613	4098278		Pseudomonas_phage(100.0%)	1	NA	NA
WP_038429383.1|770708_772613_+	peptidoglycan O-acetyltransferase OatA	NA	B5WZU0	Pseudomonas_phage	34.6	3.0e-43
>prophage 56
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	779158	792252	4098278		Tupanvirus(40.0%)	9	NA	NA
WP_046381224.1|779158_780766_-	phenylalanine aminomutase (D-beta-phenylalanine forming)	NA	A0A1V0S940	Catovirus	31.7	2.2e-68
WP_015714411.1|780794_781682_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015714412.1|781695_783459_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.4	4.7e-59
WP_015714413.1|783478_784291_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015714414.1|784290_785100_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015714415.1|785077_786082_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.7	8.9e-15
WP_015714416.1|786211_787192_-	SDR family oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	51.9	6.5e-87
WP_015714417.1|787193_788594_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_003246174.1|789087_792252_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.6	7.3e-79
>prophage 57
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	800197	802262	4098278		Pandoravirus(50.0%)	2	NA	NA
WP_015251583.1|800197_801337_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	31.0	1.7e-22
WP_046381226.1|801338_802262_-	O-acetylserine dependent cystathionine beta-synthase	NA	A0A1W6JHY1	Lactococcus_phage	42.8	2.9e-60
>prophage 58
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	807414	818283	4098278	tRNA	Catovirus(20.0%)	11	NA	NA
WP_003225916.1|807414_808050_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	3.2e-34
WP_003229802.1|808056_809325_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.8	9.5e-38
WP_033882966.1|809343_810273_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_015714429.1|810278_810932_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	31.7	3.2e-05
WP_029318172.1|811083_812166_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_003246199.1|812296_812578_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_160216247.1|812595_813012_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003225903.1|813019_813286_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_046381229.1|813370_816007_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.5	1.1e-67
WP_009967889.1|816337_817399_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003246180.1|817554_818283_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	2.5e-35
>prophage 59
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	821482	823879	4098278		Virus_Rctr197k(100.0%)	1	NA	NA
WP_046381232.1|821482_823879_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	28.9	1.9e-55
>prophage 60
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	827532	844317	4098278	tRNA	Bacillus_phage(25.0%)	13	NA	NA
WP_046381234.1|827532_828822_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.9	1.4e-113
WP_003229763.1|828844_829609_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	31.8	7.0e-20
WP_015251570.1|829944_831723_-|tRNA	aspartate--tRNA ligase	tRNA	K7Y9W2	Megavirus	33.6	5.4e-07
WP_014480430.1|831736_833011_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004399157.1|833392_833563_-	YrzK family protein	NA	NA	NA	NA	NA
WP_046381235.1|833696_835253_+	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	28.7	9.3e-11
WP_004398689.1|835279_835720_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003229747.1|835732_837937_-	GTP diphosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.4	1.9e-09
WP_003229745.1|838104_838617_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.9	1.5e-29
WP_046381236.1|838622_840983_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.8	2.1e-91
WP_069704050.1|841049_841373_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003229739.1|841448_841946_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_046381237.1|842103_844317_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.7	1.1e-30
>prophage 61
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	847627	901396	4098278	protease,tRNA,coat	uncultured_Mediterranean_phage(22.22%)	57	NA	NA
WP_004398708.1|847627_847894_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.3	1.5e-06
WP_003229725.1|847930_849076_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_003229723.1|849102_850131_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003222669.1|850160_850361_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_046381239.1|850353_851358_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_046381240.1|851368_851974_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003229715.1|852112_852625_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_046381241.1|852672_853980_-	MFS transporter	NA	NA	NA	NA	NA
WP_046381242.1|854050_855076_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_003246159.1|855313_855961_+	serine/threonine protein kinase	NA	A0A2R3ZQF2	Marseillevirus	26.3	5.4e-05
WP_003229707.1|856006_856129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157829193.1|856287_856656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017696343.1|856662_856803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017696342.1|856966_858421_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_046381503.1|858461_859184_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015714450.1|859286_859883_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_021480233.1|860030_861194_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_046381243.1|861310_862417_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_046381244.1|862403_863273_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_046381245.1|863226_864822_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_046381246.1|864924_866112_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
WP_004398582.1|866071_866614_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_014477545.1|866637_867495_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|867511_867955_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003246161.1|868015_869302_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_004399131.1|869335_869914_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|869991_870114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|870234_870519_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|870531_870870_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|870872_871181_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_004398649.1|871327_872194_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_046381248.1|872186_872981_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_014664846.1|873129_873936_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|873937_874618_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|874670_875189_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_009967915.1|875185_876058_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|876088_877102_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_014480455.1|877193_877889_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_024572904.1|877925_878495_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_046381249.1|878647_879646_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_069704049.1|879779_880526_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_046381250.1|880665_881958_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_046381251.1|882017_884660_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.5	1.4e-160
WP_003222590.1|885107_885299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046381252.1|885317_886343_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_046381253.1|886375_888103_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_003229633.1|888233_889526_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003229631.1|889555_890530_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_029727111.1|890526_891315_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_080481013.1|891304_892249_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|892281_893112_-	protein HemX	NA	NA	NA	NA	NA
WP_004399038.1|893119_894487_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003229624.1|894715_895213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229621.1|895234_895822_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003229618.1|895818_898143_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	3.4e-182
WP_004398923.1|898323_899982_-|protease	Lon protease 2	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|900133_901396_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 62
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	907490	912325	4098278		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_009967929.1|907490_909047_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
WP_003222549.1|909033_910062_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_004399096.1|910085_910604_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_004398643.1|910600_912325_-	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.4	8.3e-61
>prophage 63
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	915897	916494	4098278		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_010886588.1|915897_916494_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	33.5	5.5e-12
>prophage 64
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	920079	920304	4098278		Caldibacillus_phage(100.0%)	1	NA	NA
WP_003184172.1|920079_920304_-	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	78.7	1.2e-15
>prophage 65
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	928376	928691	4098278		Indivirus(100.0%)	1	NA	NA
WP_003222500.1|928376_928691_-	thioredoxin	NA	A0A1V0SD63	Indivirus	43.0	3.5e-10
>prophage 66
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	933996	940377	4098278		Staphylococcus_phage(33.33%)	4	NA	NA
WP_004399166.1|933996_935679_-	long-chain-fatty-acid--CoA ligase LcfA	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	2.7e-32
WP_003237674.1|935867_936272_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_003229541.1|936286_938644_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	43.4	2.2e-16
WP_003229538.1|938664_940377_-	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	24.8	1.4e-12
>prophage 67
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	944944	945979	4098278	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_046381256.1|944944_945979_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	33.2	4.5e-30
>prophage 68
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	968335	968857	4098278		Agrobacterium_phage(100.0%)	1	NA	NA
WP_010886591.1|968335_968857_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.5	7.1e-16
>prophage 69
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	971991	982299	4098278	tRNA	Enterobacteria_phage(25.0%)	9	NA	NA
WP_003229477.1|971991_973773_-	two-component system sensor histidine kinase LytS	NA	Q9EYF3	Enterobacteria_phage	31.0	7.0e-71
WP_004398978.1|973939_974722_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003229473.1|974762_976694_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.3	8.3e-110
WP_003229471.1|977091_977937_-	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_003229468.1|978015_978657_-	TVP38/TMEM64 family membrane protein YtxB	NA	NA	NA	NA	NA
WP_003229466.1|978690_979626_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	34.1	3.7e-39
WP_003229464.1|979653_981072_-	replication initiation membrane attachment protein DnaB	NA	NA	NA	NA	NA
WP_003223586.1|981186_981645_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_003223584.1|981918_982299_-	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.8	1.6e-17
>prophage 70
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	985543	996493	4098278		Bacillus_phage(50.0%)	9	NA	NA
WP_003229455.1|985543_986386_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	54.8	4.2e-82
WP_004398928.1|986427_987021_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003229449.1|987036_987669_-	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_003246122.1|987834_988665_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	31.6	5.1e-24
WP_004398870.1|988687_991330_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	26.7	2.9e-41
WP_004398493.1|991573_993313_-	sensory box histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	40.6	1.4e-44
WP_003229442.1|993305_994028_-	two-component system response regulator PhoP	NA	W8CYM9	Bacillus_phage	43.6	3.5e-45
WP_003229437.1|994239_995178_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003229433.1|995221_996493_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	1.1e-12
>prophage 71
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1000294	1002052	4098278		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004398560.1|1000294_1002052_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	50.6	1.0e-13
>prophage 72
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1006775	1010123	4098278		Streptomyces_phage(100.0%)	1	NA	NA
WP_003229412.1|1006775_1010123_-	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	36.1	2.5e-178
>prophage 73
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1016491	1020632	4098278		Indivirus(50.0%)	5	NA	NA
WP_003229393.1|1016491_1017184_-	RNA-binding riboflavin kinase RibR	NA	A0A1V0SD03	Indivirus	30.9	1.5e-05
WP_004398733.1|1017230_1018559_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004399148.1|1018555_1018837_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_004398798.1|1018851_1019856_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004398701.1|1019852_1020632_-	sulfur-containing amino-acid ABC transporter ATP-binding protein TcyN	NA	G9BWD6	Planktothrix_phage	38.6	6.9e-31
>prophage 74
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1035546	1041161	4098278		Burkholderia_phage(33.33%)	5	NA	NA
WP_046381263.1|1035546_1036554_-	signal peptide peptidase SppA	NA	Q6UYI0	Burkholderia_phage	32.1	1.9e-17
WP_004399091.1|1036739_1037543_+	NAD kinase	NA	NA	NA	NA	NA
WP_003229333.1|1037574_1039164_-	amidohydrolase	NA	NA	NA	NA	NA
WP_160216249.1|1039183_1040773_-	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.0	1.9e-72
WP_003223491.1|1040951_1041161_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	76.9	4.7e-19
>prophage 75
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1049202	1055438	4098278	tRNA	Bacillus_phage(33.33%)	5	NA	NA
WP_003229309.1|1049202_1050942_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.8	3.8e-21
WP_003229307.1|1051024_1051207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229304.1|1051236_1051839_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_003229300.1|1052109_1053378_-|tRNA	Tyrosine--tRNA ligase 1	tRNA	K4F5T3	Cronobacter_phage	43.7	7.7e-80
WP_004399030.1|1053719_1055438_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	73.2	1.1e-209
>prophage 76
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1060951	1062028	4098278		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_069964250.1|1060951_1062028_-	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	28.5	1.6e-14
>prophage 77
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1065232	1069681	4098278		Mycobacterium_phage(50.0%)	3	NA	NA
WP_046381265.1|1065232_1068091_-	DNA translocase SftA	NA	S5VNE3	Mycobacterium_phage	49.6	9.1e-89
WP_003229269.1|1068250_1068856_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_009967991.1|1068871_1069681_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	54.5	9.6e-36
>prophage 78
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1081957	1087617	4098278		Streptococcus_phage(33.33%)	5	NA	NA
WP_003229237.1|1081957_1082893_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	52.9	5.5e-83
WP_004399126.1|1082926_1084318_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_003229234.1|1084414_1085713_+	hypoxanthine/guanine permease PbuO	NA	A0A0R6PHV4	Moraxella_phage	32.8	4.6e-48
WP_046381267.1|1085752_1086910_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046381268.1|1086906_1087617_-	ABC transporter ATP-binding protein	NA	M1I1A6	Acanthocystis_turfacea_Chlorella_virus	25.9	7.5e-08
>prophage 79
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1090874	1093864	4098278		Staphylococcus_phage(50.0%)	2	NA	NA
WP_082098094.1|1090874_1092137_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.9	8.8e-28
WP_003229220.1|1092325_1093864_+	glycine betaine transporter OpuD	NA	A0A2I7QNT1	Vibrio_phage	26.7	1.2e-21
>prophage 80
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1107690	1110196	4098278		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_029318274.1|1107690_1108860_-	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	29.8	2.1e-39
WP_029318275.1|1108849_1110196_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.5e-12
>prophage 81
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1118135	1127595	4098278	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
WP_046381282.1|1118135_1120550_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.7	0.0e+00
WP_003246114.1|1120976_1121312_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_033884846.1|1121716_1122502_+	blue-light photoreceptor	NA	NA	NA	NA	NA
WP_046381283.1|1122738_1123932_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	52.0	4.5e-106
WP_046381284.1|1124120_1124867_+	membrane protein	NA	NA	NA	NA	NA
WP_069704044.1|1124903_1126844_-	bacitracin ABC transporter permease BceB	NA	NA	NA	NA	NA
WP_003229137.1|1126833_1127595_-	bacitracin ABC transporter ATP-binding protein BceA	NA	G9BWD6	Planktothrix_phage	35.8	6.1e-32
>prophage 82
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1130785	1153831	4098278	holin	Staphylococcus_phage(58.33%)	28	NA	NA
WP_003229129.1|1130785_1131481_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	1.0e-38
WP_004398887.1|1131495_1132473_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046381287.1|1132502_1133489_-	ABC transporter permease YtrC	NA	NA	NA	NA	NA
WP_003229123.1|1133482_1134361_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	6.8e-19
WP_003229121.1|1134353_1134746_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003229119.1|1134779_1134917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229117.1|1135071_1135344_-	YtzC family protein	NA	NA	NA	NA	NA
WP_009968016.1|1135505_1136474_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	75.2	4.2e-54
WP_004398483.1|1136470_1137055_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	52.1	1.3e-45
WP_033882168.1|1137044_1138148_-	tetraprenyl-beta-curcumene synthase	NA	NA	NA	NA	NA
WP_046381288.1|1138168_1138948_-	phospholipase YtpA	NA	A0A220T682	Eptesipox_virus	25.7	3.6e-11
WP_046381289.1|1138996_1139512_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_046381290.1|1139757_1141149_-	amino acid permease	NA	NA	NA	NA	NA
WP_004398625.1|1141284_1143183_-	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	29.4	4.3e-34
WP_003229102.1|1143332_1144535_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	74.6	4.3e-165
WP_003229100.1|1145037_1146621_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.2	6.2e-196
WP_004398611.1|1146659_1146902_-	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_003246204.1|1146953_1147727_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	41.9	5.8e-38
WP_003245977.1|1147877_1148882_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003229092.1|1148894_1149677_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	7.4e-33
WP_003229090.1|1149651_1150464_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003229087.1|1150490_1150967_-	nucleoside triphosphatase YtkD	NA	NA	NA	NA	NA
WP_003229085.1|1151175_1151580_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003229083.1|1151745_1152183_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	1.3e-47
WP_010886599.1|1152275_1152452_+	YtzI protein	NA	NA	NA	NA	NA
WP_014480629.1|1152445_1152883_-	FixH family protein	NA	NA	NA	NA	NA
WP_003219361.1|1153002_1153476_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003229076.1|1153603_1153831_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	2.8e-25
>prophage 83
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1159773	1164317	4098278		Indivirus(50.0%)	4	NA	NA
WP_004398644.1|1159773_1160526_-	manganese ABC transporter ATP-binding protein MntB	NA	A0A1V0SE00	Indivirus	27.1	6.0e-16
WP_003229060.1|1160544_1161465_-	manganese ABC transporter substrate-binding protein/adhesin MntA	NA	NA	NA	NA	NA
WP_003229057.1|1161744_1162860_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_003229056.1|1162856_1164317_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.9	5.0e-75
>prophage 84
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1170241	1173465	4098278		Bacillus_phage(66.67%)	3	NA	NA
WP_003229044.1|1170241_1171060_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	8.2e-51
WP_004398478.1|1171231_1172518_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.8	3.0e-71
WP_029318306.1|1172514_1173465_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.9	8.4e-31
>prophage 85
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1179241	1181638	4098278		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_004399110.1|1179241_1181638_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.5e-12
>prophage 86
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1195979	1197509	4098278		Orpheovirus(100.0%)	1	NA	NA
WP_003228960.1|1195979_1197509_-	flotillin lipid rafts scaffold protein FloT	NA	A0A2I2L4B2	Orpheovirus	27.9	2.7e-07
>prophage 87
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1206347	1207196	4098278		Brevibacillus_phage(100.0%)	1	NA	NA
WP_003228938.1|1206347_1207196_-	exo-glucosaminidase LytG	NA	A0A0K2CP65	Brevibacillus_phage	41.1	1.0e-24
>prophage 88
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1219611	1227977	4098278		uncultured_Caudovirales_phage(100.0%)	4	NA	NA
WP_003228913.1|1219611_1221600_-	methyl-accepting chemotaxis protein TlpB	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.0	1.2e-15
WP_015714603.1|1221713_1223699_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	3.4e-26
WP_003228909.1|1223824_1225813_-	methyl-accepting chemotaxis protein TlpA	NA	A0A2H4J162	uncultured_Caudovirales_phage	60.7	2.5e-16
WP_032677065.1|1225988_1227977_-	methyl-accepting chemotaxis protein McpB	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.4	4.4e-13
>prophage 89
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1234399	1235386	4098278		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003228881.1|1234399_1235386_+	potassium channel protein KbfO	NA	A0A1B0Y2S3	Lactobacillus_phage	34.8	4.8e-05
>prophage 90
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1243125	1243947	4098278		Mycobacterium_phage(100.0%)	1	NA	NA
WP_014480683.1|1243125_1243947_+	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	27.5	3.3e-07
>prophage 91
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1256628	1261661	4098278		Brazilian_cedratvirus(50.0%)	4	NA	NA
WP_046381296.1|1256628_1258161_+	guanosine ABC transporter ATP-binding protein NupO	NA	A0A2R8FG22	Brazilian_cedratvirus	25.4	1.8e-06
WP_029318495.1|1258153_1259200_+	guanosine ABC transporter permease NupP	NA	NA	NA	NA	NA
WP_046381297.1|1259200_1260160_+	guanosine ABC transporter permease NupQ	NA	NA	NA	NA	NA
WP_160216250.1|1260314_1261661_+	sodium/malate symporter MaeN	NA	A0A140XAH4	Dickeya_phage	48.4	8.8e-18
>prophage 92
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1274986	1276459	4098278		Bacillus_virus(100.0%)	1	NA	NA
WP_003228788.1|1274986_1276459_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.8	6.5e-107
>prophage 93
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1285488	1289976	4098278		Mycobacterium_phage(100.0%)	1	NA	NA
WP_046381303.1|1285488_1289976_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.6	1.0e-33
>prophage 94
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1296091	1303228	4098278		Tupanvirus(100.0%)	1	NA	NA
WP_046381304.1|1296091_1303228_-	nonribosomal peptide synthetase DhbF	NA	A0A2K9KZV5	Tupanvirus	26.9	1.4e-98
>prophage 95
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1311988	1326296	4098278	protease	Mycoplasma_phage(14.29%)	18	NA	NA
WP_015251314.1|1311988_1313491_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.3	9.8e-58
WP_003244337.1|1313648_1314125_+	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_009969090.1|1314154_1314811_-	stationary phase survival protein SpsC	NA	A0A217ER34	Bacillus_phage	31.8	7.4e-10
WP_003243877.1|1314914_1315235_-	membrane protein	NA	NA	NA	NA	NA
WP_003243733.1|1315288_1315432_-	YuiA family protein	NA	NA	NA	NA	NA
WP_010886605.1|1315604_1316825_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003220618.1|1317156_1318155_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	4.7e-32
WP_061891019.1|1318194_1318335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029725886.1|1318613_1319594_+	GMP reductase	NA	G3MBI2	Bacillus_virus	85.8	1.5e-163
WP_032726806.1|1319667_1320291_-|protease	protease synthase/sporulation negative transcriptional regulator PaiB	protease	NA	NA	NA	NA
WP_046381306.1|1320314_1320833_-	spermidine/spermine N(1)-acetyltransferase	NA	NA	NA	NA	NA
WP_003244166.1|1321173_1321536_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	45.3	1.4e-18
WP_003243745.1|1321614_1322469_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003228710.1|1322591_1323806_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	22.3	1.6e-13
WP_003222913.1|1323942_1324179_-	YuzB family protein	NA	NA	NA	NA	NA
WP_003242518.1|1324441_1325509_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003242597.1|1325534_1325861_-	YuzD family protein	NA	NA	NA	NA	NA
WP_003151955.1|1326059_1326296_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	44.3	2.9e-09
>prophage 96
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1333076	1333577	4098278		Bacillus_virus(100.0%)	1	NA	NA
WP_003243814.1|1333076_1333577_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.0	1.2e-41
>prophage 97
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1337029	1338010	4098278		Microcystis_phage(100.0%)	1	NA	NA
WP_003243462.1|1337029_1338010_+	L-Ala--D-Glu endopeptidase	NA	A0A075BS18	Microcystis_phage	37.3	3.0e-07
>prophage 98
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1346076	1348724	4098278		Enterobacteria_phage(100.0%)	2	NA	NA
WP_003243942.1|1346076_1347426_+	uric acid permease PucJ	NA	Q9KX94	Enterobacteria_phage	28.3	1.8e-26
WP_046381309.1|1347431_1348724_+	uric acid permease PucK	NA	Q9KX94	Enterobacteria_phage	29.0	1.4e-25
>prophage 99
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1360586	1361690	4098278		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003228630.1|1360586_1361690_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	28.6	3.8e-19
>prophage 100
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1366683	1367670	4098278		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_003243688.1|1366683_1367670_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	23.6	1.9e-09
>prophage 101
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1372584	1382503	4098278		Mycobacterium_phage(20.0%)	15	NA	NA
WP_003222809.1|1372584_1373028_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	38.7	1.9e-14
WP_003228604.1|1373017_1374238_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.8	3.4e-117
WP_003228602.1|1374237_1375551_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003151872.1|1375568_1376354_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	22.7	3.5e-06
WP_003228600.1|1376547_1376685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003228596.1|1376878_1377256_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003228595.1|1377340_1378165_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_003228593.1|1378178_1378847_-	methionine ABC transporter permease MetP	NA	NA	NA	NA	NA
WP_003242531.1|1378839_1379865_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	1.4e-31
WP_003228587.1|1380191_1380536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003228585.1|1380642_1380963_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_009968134.1|1380964_1381405_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_003228581.1|1381404_1381641_-	YusG family protein	NA	NA	NA	NA	NA
WP_003222781.1|1381696_1382080_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003222779.1|1382146_1382503_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	54.6	1.8e-23
>prophage 102
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1388313	1389222	4098278		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015714674.1|1388313_1389222_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	42.2	2.3e-62
>prophage 103
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1392592	1395513	4098278		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_033884687.1|1392592_1393333_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.3	2.3e-12
WP_015714676.1|1393466_1394354_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003228549.1|1394373_1394661_-	YusU family protein	NA	NA	NA	NA	NA
WP_010886609.1|1394685_1395513_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.7	5.4e-10
>prophage 104
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1399140	1401977	4098278	protease	Clostridium_phage(33.33%)	3	NA	NA
WP_003228537.1|1399140_1399602_+	metalloregulation DNA-binding stress protein MgrA	NA	A0A0A7RTZ1	Clostridium_phage	49.6	9.1e-31
WP_003228534.1|1399645_1401022_-|protease	serine protease Do-like protein HtrB	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.4	2.3e-21
WP_003228529.1|1401299_1401977_+	secretion stress-responsive two-component system response regulator CssR	NA	W8CYM9	Bacillus_phage	34.1	2.4e-27
>prophage 105
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1416720	1419110	4098278		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_080481007.1|1416720_1418049_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	25.8	4.8e-08
WP_046381317.1|1418048_1419110_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.9	5.0e-16
>prophage 106
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1422193	1424646	4098278		Bacillus_phage(100.0%)	2	NA	NA
WP_046381321.1|1422193_1423936_-	two-component system sensor histidine kinase YvrG	NA	W8CYF6	Bacillus_phage	24.2	1.3e-16
WP_003243545.1|1423932_1424646_-	two-component system response regulator YvrH	NA	W8CYM9	Bacillus_phage	36.5	7.9e-34
>prophage 107
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1428929	1431777	4098278		Planktothrix_phage(50.0%)	3	NA	NA
WP_041333113.1|1428929_1429619_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	5.5e-40
WP_046381323.1|1429602_1430796_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003243882.1|1430967_1431777_-	ABC transporter ATP-binding protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	26.9	1.1e-10
>prophage 108
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1437351	1443159	4098278		Bacillus_phage(33.33%)	6	NA	NA
WP_003228444.1|1437351_1437834_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	31.4	1.3e-08
WP_046381328.1|1437933_1439787_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	35.1	8.6e-88
WP_046381508.1|1439815_1440742_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_160216251.1|1440852_1441635_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_121509434.1|1441606_1442299_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048655206.1|1442328_1443159_-	glyoxal/methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	57.1	7.0e-82
>prophage 109
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1455362	1460042	4098278		Streptococcus_phage(50.0%)	2	NA	NA
WP_139127062.1|1455362_1457471_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.4	1.5e-112
WP_046381336.1|1457630_1460042_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.8	1.3e-120
>prophage 110
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1467763	1484060	4098278	holin	Thermus_phage(28.57%)	19	NA	NA
WP_003220025.1|1467763_1468234_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
WP_003228386.1|1468378_1470718_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.9	2.4e-87
WP_003242610.1|1470736_1471477_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003220028.1|1471608_1471839_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003228381.1|1471987_1472758_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009968172.1|1472797_1473031_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003220034.1|1473182_1473590_+	transcriptional repressor RghR	NA	S6C481	Thermus_phage	64.8	1.9e-16
WP_003228377.1|1473619_1474039_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
WP_003242888.1|1474130_1474457_+	catDE operon transcriptional regulator CatR	NA	NA	NA	NA	NA
WP_046381339.1|1474584_1476285_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	9.4e-25
WP_003228374.1|1476325_1477006_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_069704014.1|1477022_1477943_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046381341.1|1477954_1478608_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_046381342.1|1478624_1479770_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.3	6.0e-15
WP_014478002.1|1480053_1480587_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015714713.1|1480618_1481293_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_015384655.1|1481310_1482222_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228349.1|1482241_1482895_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_003243370.1|1482917_1484060_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
>prophage 111
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1489622	1490915	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_003228333.1|1489622_1490915_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	71.5	6.4e-175
>prophage 112
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1504723	1505758	4098278		Microbacterium_phage(100.0%)	1	NA	NA
WP_069704016.1|1504723_1505758_-	glycosylase	NA	A0A2P1CFB9	Microbacterium_phage	24.9	9.8e-09
>prophage 113
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1511420	1512326	4098278		Staphylococcus_phage(100.0%)	1	NA	NA
WP_080481003.1|1511420_1512326_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	2.1e-23
>prophage 114
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1521734	1522727	4098278		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003244199.1|1521734_1522727_-	galactan degradation operon transcriptional regulator GanR	NA	C6ZCU4	Enterobacteria_phage	22.3	8.0e-08
>prophage 115
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1528140	1529307	4098278		Tupanvirus(100.0%)	1	NA	NA
WP_029725953.1|1528140_1529307_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	32.4	7.4e-29
>prophage 116
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1537495	1552137	4098278		Catovirus(20.0%)	14	NA	NA
WP_003228255.1|1537495_1538332_-	glycosyltransferase EpsE	NA	A0A1V0SAH6	Catovirus	39.6	1.7e-14
WP_061891011.1|1538328_1539474_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015251176.1|1539485_1541282_-	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	30.6	2.6e-25
WP_003228249.1|1541540_1542224_-	protein tyrosine kinase EpsB	NA	NA	NA	NA	NA
WP_003228247.1|1542229_1542934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048654996.1|1543179_1543638_+	transcriptional regulator SlrR	NA	NA	NA	NA	NA
WP_048654997.1|1543712_1545182_+	para-nitrobenzyl esterase	NA	A0A0M4JT58	Mollivirus	33.8	1.1e-37
WP_048654998.1|1545184_1545376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015384708.1|1545403_1545889_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_046160878.1|1545911_1546367_-	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
WP_015251173.1|1546498_1547182_-	broad specificity amino-acid racemase RacX	NA	NA	NA	NA	NA
WP_015251172.1|1547197_1548553_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	23.7	2.3e-13
WP_001022105.1|1549091_1550513_+	levansucrase	NA	NA	NA	NA	NA
WP_048654999.1|1550586_1552137_+	2,6-beta-fructan 6-levanbiohydrolase	NA	F8WPR5	Bacillus_phage	42.9	3.4e-98
>prophage 117
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1559307	1560638	4098278		Agrobacterium_phage(50.0%)	2	NA	NA
WP_003228214.1|1559307_1559901_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.8	2.6e-54
WP_048655002.1|1559963_1560638_-	beta-phosphoglucomutase	NA	A7ITQ4	Paramecium_bursaria_Chlorella_virus	26.2	9.2e-08
>prophage 118
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1572024	1574656	4098278		Catovirus(33.33%)	3	NA	NA
WP_003228180.1|1572024_1572600_-	LOG family protein YvdD	NA	A0A1V0S9E9	Catovirus	27.1	3.8e-10
WP_019712402.1|1572716_1573037_+	hypothetical protein	NA	G3MBI9	Bacillus_virus	42.3	3.9e-17
WP_003244488.1|1573063_1574656_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.2	1.5e-45
>prophage 119
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1578580	1579360	4098278		Planktothrix_phage(100.0%)	1	NA	NA
WP_003228167.1|1578580_1579360_-	lantibiotic ABC transporter ATP-binding protein PsdA	NA	G9BWD6	Planktothrix_phage	34.4	3.2e-28
>prophage 120
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1582657	1592586	4098278		Streptococcus_phage(33.33%)	8	NA	NA
WP_003243775.1|1582657_1583608_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.4	5.6e-51
WP_003244450.1|1583630_1584584_-	gluconeogenesis morphogenetic factor	NA	A1IMD5	Streptococcus_phage	41.1	4.0e-65
WP_003243903.1|1584585_1585473_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.0	8.7e-06
WP_010886622.1|1585497_1585974_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003228139.1|1586292_1587243_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	54.2	2.0e-88
WP_014481004.1|1587447_1588857_-	peptidoglycan DL-endopeptidase CwlO	NA	A0A0A0RVE6	Bacillus_phage	52.6	1.6e-25
WP_015251148.1|1589236_1590691_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_061891008.1|1590816_1592586_-	multidrug resistance ABC transporter ATP-binding protein/permease BmrA	NA	W8CYL7	Bacillus_phage	59.3	1.1e-164
>prophage 121
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1617933	1618680	4098278	tRNA	Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003242712.1|1617933_1618680_-|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	A0A167R1P4	Powai_lake_megavirus	20.8	1.3e-05
>prophage 122
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1624176	1627050	4098278		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003228057.1|1624176_1627050_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.5	0.0e+00
>prophage 123
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1636467	1639619	4098278	protease	Moraxella_phage(50.0%)	3	NA	NA
WP_003228041.1|1636467_1637910_-|protease	carboxy-terminal processing protease CtpB	protease	A0A0R6PIZ1	Moraxella_phage	27.8	6.3e-22
WP_009968247.1|1638049_1638940_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003228039.1|1638932_1639619_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.0	1.7e-25
>prophage 124
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1650157	1650382	4098278		Vibrio_phage(100.0%)	1	NA	NA
WP_003219727.1|1650157_1650382_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	50.0	2.6e-07
>prophage 125
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1656278	1661518	4098278		Streptococcus_phage(66.67%)	5	NA	NA
WP_003243962.1|1656278_1657670_-	ATP-dependent helicase ComFA	NA	A0A1X9I5S6	Streptococcus_phage	37.6	1.1e-66
WP_003244125.1|1657775_1658621_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.6	7.5e-15
WP_003219701.1|1658718_1659408_-	two-component system response regulator DegU	NA	NA	NA	NA	NA
WP_003227983.1|1659490_1660648_-	two-component sensor histidine kinase DegS	NA	NA	NA	NA	NA
WP_003227979.1|1660864_1661518_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.1	5.8e-39
>prophage 126
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1665208	1669636	4098278		Catovirus(50.0%)	4	NA	NA
WP_003242619.1|1665208_1665967_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.4	9.4e-17
WP_003243110.1|1665990_1666671_-	teichuronic acid biosynthesis protein TuaF	NA	NA	NA	NA	NA
WP_010886625.1|1666699_1668166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080481010.1|1668250_1669636_-	UDP-glucose 6-dehydrogenase TuaD	NA	A0A127AXI2	Bacillus_phage	42.1	5.8e-89
>prophage 127
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1673256	1690137	4098278		Paenibacillus_phage(14.29%)	11	NA	NA
WP_003242758.1|1673256_1674747_-	N-acetylmuramoyl-L-alanine amidase LytC	NA	A0A0N9SGH1	Paenibacillus_phage	39.4	3.3e-21
WP_003243620.1|1674785_1676903_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	27.6	6.7e-12
WP_003242772.1|1676926_1677235_-	membrane-bound protein LytA	NA	NA	NA	NA	NA
WP_003227949.1|1677418_1678339_+	transcription antiterminator LytR	NA	NA	NA	NA	NA
WP_003243178.1|1678378_1679521_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	33.0	2.6e-26
WP_003227944.1|1679766_1680645_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.7	3.3e-82
WP_046381366.1|1681135_1681912_-	hypothetical protein	NA	D7RWE8	Brochothrix_phage	35.5	4.1e-36
WP_052728189.1|1681908_1684593_-	bifunctional glycosyltransferase family 2 protein/CDP-glycerol:glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_033884186.1|1684636_1685983_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.6	3.4e-09
WP_128484071.1|1687223_1687355_-	adenylyltransferase/cytidyltransferase family protein	NA	NA	NA	NA	NA
WP_046381367.1|1688553_1690137_-	teichoic acids export ABC transporter ATP-binding subunit TagH	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	4.7e-18
>prophage 128
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1695583	1702471	4098278		Hokovirus(33.33%)	5	NA	NA
WP_003227921.1|1695583_1695973_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	42.6	1.7e-17
WP_003227919.1|1696372_1697143_+	N-acetylglucosaminyldiphosphoundecaprenol N-acetyl-beta-D- mannosaminyltransferase	NA	NA	NA	NA	NA
WP_009968271.1|1697175_1698321_+	teichoic acid glycerol-phosphate primase	NA	NA	NA	NA	NA
WP_033884187.1|1698440_1699769_+	teichoic acid biosynthesis protein	NA	A0A1J0MII7	Staphylococcus_phage	29.3	6.2e-24
WP_046381370.1|1699828_1702471_-	beta-N-acetylglucosaminidase LytD	NA	Q4ZC50	Staphylococcus_virus	44.9	2.3e-38
>prophage 129
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1707536	1712502	4098278		Aichi_virus(50.0%)	4	NA	NA
WP_003243731.1|1707536_1708910_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	30.7	3.9e-37
WP_003243404.1|1709242_1710211_+	polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase TagT	NA	NA	NA	NA	NA
WP_003244395.1|1710366_1711227_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003242751.1|1711260_1712502_-	gamma-DL-glutamyl hydrolase	NA	S5MM68	Bacillus_phage	42.0	1.4e-17
>prophage 130
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1718685	1720167	4098278		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003244379.1|1718685_1720167_+	ribose ABC transporter ATP-binding protein RbsA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.0	6.5e-14
>prophage 131
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1726502	1728950	4098278		Lactobacillus_phage(50.0%)	2	NA	NA
WP_003227859.1|1726502_1727411_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.6	8.9e-14
WP_029318749.1|1727621_1728950_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	29.5	8.4e-45
>prophage 132
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1739506	1757536	4098278		Bacillus_phage(33.33%)	19	NA	NA
WP_046381377.1|1739506_1740220_-	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.4	3.8e-20
WP_014481129.1|1740340_1740694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021480772.1|1741827_1742037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041334792.1|1742050_1742569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046381378.1|1742576_1744388_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	35.5	2.7e-38
WP_046381379.1|1744406_1744667_-	YwqI/YxiC family protein	NA	NA	NA	NA	NA
WP_010332155.1|1744676_1745099_-	DUF5082 domain-containing protein	NA	NA	NA	NA	NA
WP_128484073.1|1745288_1745441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033885053.1|1745490_1746276_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_015251054.1|1746476_1747799_-	UDP-glucose 6-dehydrogenase UglF	NA	A0A127AXI2	Bacillus_phage	39.3	1.8e-87
WP_033885052.1|1747993_1748758_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_046381380.1|1748810_1749524_-	tyrosine-protein kinase PtkA	NA	A0A1X9I5D6	Streptococcus_phage	38.7	1.1e-27
WP_003227811.1|1749513_1750260_-	protein-tyrosine kinase activator TkmA	NA	NA	NA	NA	NA
WP_003242876.1|1750492_1750636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033885050.1|1750839_1752450_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_046381381.1|1752436_1755205_+	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	27.5	2.9e-39
WP_046381382.1|1755330_1756188_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003244075.1|1756193_1756970_-	transcriptional regulator GlcR	NA	NA	NA	NA	NA
WP_014478203.1|1757194_1757536_-	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	66.0	2.0e-35
>prophage 133
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1765403	1765685	4098278		Clostridium_phage(100.0%)	1	NA	NA
WP_003221804.1|1765403_1765685_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	50.7	9.4e-15
>prophage 134
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1776677	1777550	4098278		Clostridium_phage(100.0%)	1	NA	NA
WP_046381387.1|1776677_1777550_-	stage II sporulation protein spoIIQ	NA	I3PV24	Clostridium_phage	36.1	1.1e-05
>prophage 135
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1787998	1789132	4098278		Bacillus_phage(100.0%)	1	NA	NA
WP_003227715.1|1787998_1789132_-	response regulator aspartate phosphatase RapB	NA	A0A1P8CWN8	Bacillus_phage	45.5	1.7e-86
>prophage 136
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1793721	1794753	4098278		Pseudomonas_phage(100.0%)	1	NA	NA
WP_029318715.1|1793721_1794753_-	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	40.6	1.0e-42
>prophage 137
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1806187	1811007	4098278		Aeromonas_phage(50.0%)	6	NA	NA
WP_003227669.1|1806187_1807435_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.7	1.5e-99
WP_029318713.1|1807641_1808184_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_029318712.1|1808196_1808646_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_015384897.1|1808802_1809255_-	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_003227661.1|1809330_1809888_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_015251011.1|1809966_1811007_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	42.6	2.2e-61
>prophage 138
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1814082	1815153	4098278		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003227645.1|1814082_1815153_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	3.1e-05
>prophage 139
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1819402	1819990	4098278		Bacillus_virus(100.0%)	1	NA	NA
WP_017696004.1|1819402_1819990_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	45.9	3.1e-36
>prophage 140
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1824751	1829298	4098278		Synechococcus_phage(33.33%)	5	NA	NA
WP_003227626.1|1824751_1825390_-	fructose-6-phosphate aldolase	NA	A0A0E3FQP8	Synechococcus_phage	45.0	7.3e-47
WP_003243339.1|1825509_1826367_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003227621.1|1826547_1826922_-	sporulation initiation phosphotransferase Spo0F	NA	W8CYM9	Bacillus_phage	36.5	2.9e-11
WP_029318708.1|1827087_1827609_+	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_003227612.1|1827690_1829298_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	1.0e-153
>prophage 141
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1834860	1838479	4098278		Acanthamoeba_polyphaga_mimivirus(50.0%)	4	NA	NA
WP_046381394.1|1834860_1835823_+	UV DNA damage repair endonuclease UvsE	NA	A0A0G2Y997	Acanthamoeba_polyphaga_mimivirus	32.7	6.5e-31
WP_003227597.1|1835903_1836176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227595.1|1836217_1836742_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_044052434.1|1836751_1838479_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	7.0e-60
>prophage 142
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1841809	1843273	4098278		Escherichia_phage(100.0%)	1	NA	NA
WP_014481212.1|1841809_1843273_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	43.6	4.2e-21
>prophage 143
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1850648	1925967	4098278	bacteriocin,protease,tRNA,coat	Bacillus_phage(26.67%)	74	NA	NA
WP_003227570.1|1850648_1852319_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003243604.1|1852315_1852744_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|1853056_1853188_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|1853144_1853297_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_015714887.1|1853321_1854668_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|1854680_1854842_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_003227564.1|1854838_1855558_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	7.3e-19
WP_046381398.1|1855550_1856861_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_080481011.1|1856850_1858011_+	insulinase family protein	NA	NA	NA	NA	NA
WP_046381400.1|1858015_1859296_+	insulinase family protein	NA	NA	NA	NA	NA
WP_029726080.1|1859292_1859994_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_046381401.1|1859999_1861376_-	YncE family protein	NA	NA	NA	NA	NA
WP_069704038.1|1861415_1862771_-	YncE family protein	NA	NA	NA	NA	NA
WP_015250985.1|1863000_1864146_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.0	5.0e-78
WP_009968329.1|1864129_1864249_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_003227545.1|1864840_1865713_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|1865773_1866604_-	spermidine synthase	NA	NA	NA	NA	NA
WP_029726084.1|1866806_1868882_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_014478299.1|1868909_1869344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244446.1|1869482_1870001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243167.1|1870014_1870674_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|1870782_1870971_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003227535.1|1871013_1871433_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046381404.1|1871552_1873469_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.2	6.2e-142
WP_046381405.1|1874302_1875712_-	MFS transporter	NA	NA	NA	NA	NA
WP_017696247.1|1875711_1876182_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|1876293_1876794_-	YwgA family protein	NA	NA	NA	NA	NA
WP_024571616.1|1876829_1878131_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|1878292_1878517_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003243464.1|1878731_1879508_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_042975435.1|1879651_1880542_-	DMT family transporter	NA	NA	NA	NA	NA
WP_024571618.1|1880709_1881555_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_014481233.1|1881603_1882503_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003235941.1|1882648_1883620_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003242896.1|1883889_1884654_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_042975433.1|1884786_1885566_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_014481235.1|1885580_1886780_-	transaminase BacF	NA	NA	NA	NA	NA
WP_014481236.1|1886780_1887965_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_003242921.1|1887961_1889380_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_046381517.1|1889398_1890160_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	2.0e-22
WP_003244300.1|1890162_1890870_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|1890859_1891474_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_046381406.1|1891625_1892864_-	MFS transporter	NA	NA	NA	NA	NA
WP_046381407.1|1893073_1894486_-	amino acid permease	NA	NA	NA	NA	NA
WP_046160966.1|1894485_1896186_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014478322.1|1896259_1897807_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014665807.1|1898033_1899308_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003227472.1|1899483_1899948_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_014481242.1|1900271_1900727_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_046381408.1|1900719_1901571_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.3	1.3e-38
WP_003244201.1|1901584_1902532_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_014478328.1|1902531_1903272_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
WP_046381409.1|1903296_1904316_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_046381410.1|1904318_1905041_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_046381411.1|1905033_1906155_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014481248.1|1906154_1907024_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046381412.1|1907024_1908194_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	9.4e-16
WP_046381413.1|1908214_1909639_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_021480921.1|1909643_1910414_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	2.6e-06
WP_014481253.1|1910733_1911279_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|1911322_1911694_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_015384975.1|1911755_1913078_-	purine permease	NA	NA	NA	NA	NA
WP_046161096.1|1913097_1913415_-	YwdI family protein	NA	NA	NA	NA	NA
WP_046381414.1|1913582_1914953_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014478341.1|1914977_1915655_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	1.8e-48
WP_069703977.1|1915668_1916475_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014665830.1|1916665_1917481_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|1917570_1917819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069703976.1|1917912_1919352_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.7	4.1e-21
WP_069703975.1|1919348_1920734_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_069703974.1|1921035_1921806_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003227423.1|1921844_1922675_-	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003222155.1|1922714_1923017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046381416.1|1923546_1925967_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
>prophage 144
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1951486	1952674	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_046381422.1|1951486_1952674_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.0	7.7e-74
>prophage 145
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1957418	1962971	4098278	protease	Bacillus_phage(50.0%)	4	NA	NA
WP_046381425.1|1957418_1959356_+|protease	minor protease Epr	protease	A0A1B0T6A2	Bacillus_phage	34.9	1.1e-45
WP_046381426.1|1959782_1961162_+	SacY negative regulator SacX	NA	NA	NA	NA	NA
WP_046381427.1|1961215_1962058_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_015714932.1|1962110_1962971_-	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.2	2.9e-06
>prophage 146
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1972465	1975161	4098278		Tupanvirus(50.0%)	2	NA	NA
WP_041054155.1|1972465_1973977_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	29.3	1.7e-46
WP_046381433.1|1973973_1975161_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.9	2.3e-22
>prophage 147
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1985187	1989793	4098278		Tupanvirus(50.0%)	4	NA	NA
WP_046381437.1|1985187_1986831_+	catalase	NA	A0A2K9L572	Tupanvirus	45.2	6.2e-98
WP_046381438.1|1986933_1988136_+	MFS transporter	NA	NA	NA	NA	NA
WP_046381439.1|1988132_1988909_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_033882875.1|1988905_1989793_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	1.4e-27
>prophage 148
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	1993552	1996980	4098278		Bacillus_phage(50.0%)	2	NA	NA
WP_046381442.1|1993552_1995280_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.0	1.4e-23
WP_046381443.1|1995276_1996980_-	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	31.1	1.6e-16
>prophage 149
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2004350	2011180	4098278		Planktothrix_phage(33.33%)	6	NA	NA
WP_003242648.1|2004350_2005448_-	maltodextrin ABC transporter ATP-binding protein MsmX	NA	G9BWD6	Planktothrix_phage	31.2	2.4e-21
WP_019712848.1|2005568_2006462_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069703971.1|2006645_2008103_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003242615.1|2008144_2008981_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.6	1.0e-40
WP_121549361.1|2009549_2010089_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_003244356.1|2010160_2011180_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.4	8.5e-98
>prophage 150
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2016702	2019225	4098278		uncultured_virus(100.0%)	2	NA	NA
WP_003244296.1|2016702_2017836_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.5	1.2e-89
WP_003244221.1|2018088_2019225_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.1	2.4e-88
>prophage 151
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2026879	2028940	4098278		Tupanvirus(100.0%)	1	NA	NA
WP_046161020.1|2026879_2028940_-	catalase	NA	A0A2K9L0T1	Tupanvirus	52.7	7.6e-154
>prophage 152
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2034722	2036162	4098278		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_019712854.1|2034722_2036162_-	ATP-dependent RNA helicase DbpA	NA	A0A1B1IS59	uncultured_Mediterranean_phage	36.1	6.9e-61
>prophage 153
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2060787	2062314	4098278		Catovirus(100.0%)	1	NA	NA
WP_003243255.1|2060787_2062314_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.5	3.3e-93
>prophage 154
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2067743	2069045	4098278		Geobacillus_virus(100.0%)	1	NA	NA
WP_003243952.1|2067743_2069045_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	61.5	1.6e-133
>prophage 155
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2076763	2077513	4098278		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003243284.1|2076763_2077513_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	6.0e-16
>prophage 156
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2081277	2082264	4098278		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003243495.1|2081277_2082264_-	penicillin V amidase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	31.1	1.6e-29
>prophage 157
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2089126	2089900	4098278		Planktothrix_phage(100.0%)	1	NA	NA
WP_003243557.1|2089126_2089900_-	ABC transporter ATP-binding protein YxdL	NA	G9BWD6	Planktothrix_phage	37.3	1.5e-30
>prophage 158
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2108170	2110051	4098278		Catovirus(100.0%)	1	NA	NA
WP_003243561.1|2108170_2110051_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	33.5	6.2e-94
>prophage 159
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2117667	2119911	4098278		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_160216256.1|2117667_2119911_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	29.4	7.1e-28
>prophage 160
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2130814	2131963	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_046381464.1|2130814_2131963_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 161
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2135821	2139800	4098278		Synechococcus_phage(50.0%)	3	NA	NA
WP_019712613.1|2135821_2137228_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	30.9	6.0e-33
WP_003243686.1|2137693_2138257_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_003226996.1|2138270_2139800_+	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.0e-33
>prophage 162
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2146787	2148278	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_046381468.1|2146787_2148278_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	31.5	2.2e-33
>prophage 163
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2151934	2153161	4098278		Tupanvirus(100.0%)	1	NA	NA
WP_014481458.1|2151934_2153161_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.3	1.1e-11
>prophage 164
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2156390	2161636	4098278		Klosneuvirus(66.67%)	5	NA	NA
WP_014481464.1|2156390_2157488_+	response regulator aspartate phosphatase RapG	NA	D6R410	Bacillus_phage	39.3	6.0e-73
WP_003226961.1|2157488_2157605_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003226959.1|2157841_2158732_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	2.0e-26
WP_014481465.1|2158804_2160208_-	amino acid permease	NA	NA	NA	NA	NA
WP_033882007.1|2160430_2161636_-	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	2.0e-29
>prophage 165
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2164942	2182151	4098278	protease	Bacillus_phage(33.33%)	15	NA	NA
WP_015715052.1|2164942_2165227_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	2.8e-06
WP_003244510.1|2165453_2166839_+	arginine utilization regulatory protein RocR	NA	NA	NA	NA	NA
WP_046381472.1|2166820_2168287_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	37.2	4.3e-34
WP_038428106.1|2168283_2168967_-	response regulator transcription factor	NA	A0A1J0GWE0	Alteromonas_phage	31.0	6.1e-07
WP_046381473.1|2169178_2170078_+	peptidase	NA	NA	NA	NA	NA
WP_046381474.1|2170238_2170739_+	peptidase	NA	NA	NA	NA	NA
WP_046381475.1|2170882_2172085_-|protease	serine protease HtrC	protease	W5SAB9	Pithovirus	40.4	5.9e-13
WP_046381476.1|2172166_2172961_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.6	9.8e-41
WP_003244037.1|2172982_2173825_-	WalRK two-component regulatory system regulator WalI	NA	NA	NA	NA	NA
WP_042976993.1|2173811_2175179_-	WalRK two-component regulatory system regulator WalH	NA	NA	NA	NA	NA
WP_024572714.1|2175168_2177004_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.5	5.8e-36
WP_003244363.1|2177011_2177719_-	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	41.2	3.4e-45
WP_003226929.1|2178749_2180042_-	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	35.9	3.1e-68
WP_046381477.1|2180247_2180667_-	VOC family protein	NA	NA	NA	NA	NA
WP_003226923.1|2180786_2182151_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.8	3.6e-128
>prophage 166
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2203838	2204360	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_029318530.1|2203838_2204360_-	streptothricin N-acetyltransferase SatA	NA	A0A1B0RXL7	Streptococcus_phage	47.2	8.1e-44
>prophage 167
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2210144	2214240	4098278		Staphylococcus_phage(50.0%)	5	NA	NA
WP_160216258.1|2210144_2211656_+	recombinase family protein	NA	A0A0N9RZT8	Staphylococcus_phage	29.0	8.6e-38
WP_144486887.1|2211688_2212057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160216296.1|2212286_2212667_-	DUF4467 domain-containing protein	NA	NA	NA	NA	NA
WP_160216259.1|2212729_2213236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160216260.1|2213250_2214240_-	transglycosylase SLT domain-containing protein	NA	A0A1S5SEZ8	Streptococcus_phage	43.2	3.2e-65
>prophage 168
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2223675	2233921	4098278		Streptococcus_phage(33.33%)	14	NA	NA
WP_160216267.1|2223675_2224734_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	40.4	7.8e-62
WP_160216268.1|2224726_2226169_-	coupling conjugation protein ConQ	NA	A0A1S5SFB5	Streptococcus_phage	50.2	4.7e-118
WP_009966619.1|2226204_2226585_-	helicase processivity factor HelP	NA	NA	NA	NA	NA
WP_119122843.1|2226620_2226749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160216269.1|2226954_2227215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160216270.1|2227268_2227529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019716390.1|2227525_2227705_-	hypothetical protein	NA	Q8SBM7	Clostridium_phage	51.9	5.4e-08
WP_129093547.1|2228000_2228384_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	44.4	2.1e-20
WP_019716392.1|2228380_2228911_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_129093548.1|2229023_2230220_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	32.0	5.0e-49
WP_129093549.1|2230447_2231167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160216271.1|2231442_2231652_+	DUF255 domain-containing protein	NA	NA	NA	NA	NA
WP_041351256.1|2231827_2232553_+	MjaII restriction endonuclease	NA	NA	NA	NA	NA
WP_052478213.1|2232616_2233921_-	DNA (cytosine-5-)-methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	39.8	1.3e-77
>prophage 169
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2240778	2242402	4098278		Cafeteria_roenbergensis_virus(50.0%)	3	NA	NA
WP_029726087.1|2240778_2241537_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	46.3	4.8e-61
WP_003219224.1|2241600_2241840_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003219228.1|2241883_2242402_-	single-stranded DNA-binding protein	NA	M5ABV5	Bacillus_phage	69.8	2.3e-51
>prophage 170
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2247899	2251748	4098278	protease	Bacillus_virus(25.0%)	5	NA	NA
WP_003243890.1|2247899_2248517_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	32.7	2.0e-17
WP_003226832.1|2248555_2249404_-	stage 0 sporulation protein Spo0J	NA	I3NLC2	Bifidobacterium_phage	38.9	2.0e-20
WP_003219244.1|2249396_2250158_-	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	31.1	6.5e-26
WP_015250779.1|2250405_2250846_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_015250778.1|2250896_2251748_-	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	36.7	9.5e-18
>prophage 171
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2260544	2268065	4098278		Bacillus_virus(66.67%)	6	NA	NA
WP_003242509.1|2260544_2261681_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	33.6	6.3e-17
WP_003226810.1|2261811_2262027_+	ribosome maturation protein RlbA	NA	NA	NA	NA	NA
WP_003243515.1|2262042_2263155_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003219266.1|2263172_2263418_+	extracellular matrix regulator RemB	NA	NA	NA	NA	NA
WP_003226808.1|2263472_2265389_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	48.8	9.9e-156
WP_014475555.1|2265599_2268065_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	36.9	7.1e-114
>prophage 172
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2274520	2282375	4098278	tRNA	Klosneuvirus(20.0%)	7	NA	NA
WP_003226803.1|2274520_2275987_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.9	1.9e-98
WP_032676922.1|2276139_2277471_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.4	3.3e-25
WP_003247145.1|2277667_2278552_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_029726364.1|2278573_2279164_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_003247131.1|2279485_2280763_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.9	1.7e-95
WP_003226792.1|2281101_2281755_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.5	3.7e-22
WP_003247138.1|2281751_2282375_-	deoxynucleoside kinase	NA	A0A1G5SAJ8	Enterococcus_phage	24.3	9.1e-10
>prophage 173
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2285419	2287111	4098278		Bacteriophage(100.0%)	1	NA	NA
WP_015253021.1|2285419_2287111_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	34.6	6.7e-55
>prophage 174
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2295006	2308472	4098278	tRNA	Streptococcus_phage(42.86%)	15	NA	NA
WP_046380713.1|2295006_2296167_+	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	31.0	2.8e-36
WP_046380714.1|2296248_2297691_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_046380715.1|2297687_2298326_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	55.4	4.1e-58
WP_003242755.1|2298399_2298729_+	cyclic di-AMP receptor DarA	NA	NA	NA	NA	NA
WP_009966249.1|2298741_2299182_+	YaaR family protein	NA	NA	NA	NA	NA
WP_003226770.1|2299193_2300183_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.1	1.1e-33
WP_003226767.1|2300185_2301013_+	competence/sporulation regulator complex protein RicT	NA	NA	NA	NA	NA
WP_003218308.1|2301027_2301387_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_003244526.1|2301445_2302189_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_046380716.1|2302175_2302475_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_046380717.1|2302449_2303328_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	48.3	1.8e-67
WP_003226760.1|2303376_2303667_-	transition state genes transcriptional regulator AbrB	NA	A0A2I7SC16	Paenibacillus_phage	54.3	8.0e-17
WP_015382561.1|2304161_2306156_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	4.0e-99
WP_014475570.1|2306235_2307003_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_046380719.1|2307158_2308472_+	DUF348 domain-containing protein	NA	A0A217ER34	Bacillus_phage	70.9	1.1e-28
>prophage 175
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2314882	2317229	4098278		Tupanvirus(100.0%)	2	NA	NA
WP_046380722.1|2314882_2316253_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	34.8	3.8e-32
WP_003218353.1|2316275_2317229_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.9	5.1e-44
>prophage 176
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2322629	2323166	4098278		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003218365.1|2322629_2323166_+	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 177
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2335514	2343405	4098278	protease	Micromonas_pusilla_virus(25.0%)	7	NA	NA
WP_003243881.1|2335514_2337428_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.0	1.1e-114
WP_010886388.1|2337622_2338399_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_003226695.1|2338410_2339286_+	redox-regulated molecular chaperone HslO	NA	NA	NA	NA	NA
WP_160216273.1|2339332_2340226_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003226691.1|2340301_2341228_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	64.9	8.8e-110
WP_041334206.1|2341394_2342807_+	anthranilate synthase component I family protein	NA	S4VT78	Pandoravirus	31.5	4.9e-35
WP_014475585.1|2342820_2343405_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.1	2.4e-65
>prophage 178
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2347257	2348757	4098278	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003226674.1|2347257_2348757_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.4	6.2e-97
>prophage 179
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2362109	2364542	4098278	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_046380728.1|2362109_2364542_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	H6X3M6	Enterobacteria_phage	35.3	6.7e-133
>prophage 180
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2371988	2373389	4098278	tRNA	Catovirus(100.0%)	1	NA	NA
WP_004399682.1|2371988_2373389_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.4	1.0e-61
>prophage 181
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2376428	2376962	4098278		Bacillus_virus(100.0%)	1	NA	NA
WP_003225764.1|2376428_2376962_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.8	9.2e-11
>prophage 182
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2380457	2391301	4098278		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_009966326.1|2380457_2384039_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.7	1.2e-48
WP_004399688.1|2384100_2387700_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.1	2.8e-66
WP_003225778.1|2387878_2388127_+	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_003225781.1|2388240_2388657_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003225784.1|2388698_2389169_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003235056.1|2389222_2391301_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	7.4e-64
>prophage 183
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2408981	2410672	4098278		Planktothrix_phage(50.0%)	2	NA	NA
WP_046380731.1|2408981_2409827_+	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	1.2e-20
WP_003235106.1|2409802_2410672_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	4.0e-11
>prophage 184
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2415146	2415860	4098278		Bacillus_phage(100.0%)	1	NA	NA
WP_015252979.1|2415146_2415860_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	A0A0N6W8I1	Bacillus_phage	30.0	8.3e-15
>prophage 185
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2435422	2436859	4098278		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003234986.1|2435422_2436859_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.5	1.0e-141
>prophage 186
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2458617	2463204	4098278		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_046380736.1|2458617_2460420_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	39.9	8.3e-104
WP_128484027.1|2460466_2460607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046380737.1|2460855_2461767_-	DNA-3-methyladenine glycosidase II	NA	NA	NA	NA	NA
WP_046380738.1|2462039_2462678_+	bifunctional transcriptional activator/DNA repair enzyme AdaA	NA	NA	NA	NA	NA
WP_046380739.1|2462661_2463204_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.7	5.3e-22
>prophage 187
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2475237	2475957	4098278		Cedratvirus(100.0%)	1	NA	NA
WP_003234899.1|2475237_2475957_+	sporulation killing factor ABC transporter ATP-binding protein SkfE	NA	A0A285PWH2	Cedratvirus	28.6	7.5e-16
>prophage 188
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2479584	2482312	4098278		Bacillus_phage(50.0%)	4	NA	NA
WP_015252948.1|2479584_2480256_+	two-component system response regulator YbdK	NA	W8CYM9	Bacillus_phage	32.1	1.1e-24
WP_072557087.1|2480276_2481239_+	two-component system sensor histidine kinase YbdK	NA	NA	NA	NA	NA
WP_026009835.1|2481297_2481549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017694962.1|2481541_2482312_-	protein kinase	NA	A0A2I2L4H4	Orpheovirus	32.7	1.9e-09
>prophage 189
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2491334	2492216	4098278		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003246382.1|2491334_2492216_-	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	38.9	2.2e-41
>prophage 190
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2511018	2512914	4098278		Vibrio_phage(100.0%)	1	NA	NA
WP_046380749.1|2511018_2512914_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	42.3	4.0e-08
>prophage 191
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2534486	2539006	4098278		Bacillus_phage(75.0%)	7	NA	NA
WP_080481000.1|2534486_2535167_+	two-component system response regulator YcbL	NA	W8CYM9	Bacillus_phage	32.7	2.1e-31
WP_046380758.1|2535168_2536104_+	two-component system sensor histidine kinase YcbM	NA	W8CYF6	Bacillus_phage	25.9	5.2e-25
WP_046160014.1|2536195_2537119_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	5.1e-41
WP_080480999.1|2537137_2537824_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_121591398.1|2537784_2537919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003246313.1|2537878_2538265_-	YndM family protein	NA	NA	NA	NA	NA
WP_046160016.1|2538577_2539006_+	cell wall hydrolase	NA	A0A172JHR8	Bacillus_phage	34.6	4.6e-05
>prophage 192
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2542157	2546203	4098278		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_003234779.1|2542157_2542886_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	25.0	1.3e-15
WP_046380759.1|2542882_2543530_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_046380760.1|2543608_2544721_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_032728901.1|2544763_2546203_-	lincomycin efflux MFS transporter Lmr(B)	NA	A0A0M3UL24	Mycobacterium_phage	23.0	1.1e-13
>prophage 193
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2552537	2553278	4098278		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003234757.1|2552537_2553278_+	sodium ABC transporter ATP-binding protein NatA	NA	A0A2H4PQG7	Staphylococcus_phage	31.5	5.4e-25
>prophage 194
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2559916	2561664	4098278		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_046380766.1|2559916_2560420_-	peptidoglycan L-alanyl-D-glutamate endopeptidase CwlK	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	50.8	3.8e-30
WP_046380767.1|2560542_2561664_+	response regulator aspartate phosphatase RapJ	NA	A0A1P8CWN8	Bacillus_phage	32.5	1.3e-51
>prophage 195
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2565459	2570911	4098278		Caulobacter_phage(60.0%)	7	NA	NA
WP_003234730.1|2565459_2566155_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.1	1.6e-18
WP_003246340.1|2566112_2566955_+	zinc ABC transporter permease ZnuB	NA	NA	NA	NA	NA
WP_003246351.1|2566992_2567988_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003246350.1|2568271_2568871_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	31.0	5.3e-23
WP_003234723.1|2568892_2569474_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.7	6.7e-31
WP_003241242.1|2569508_2570087_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.8	1.3e-29
WP_003246458.1|2570137_2570911_+	TerC family protein	NA	S5MAL1	Bacillus_phage	64.3	5.0e-82
>prophage 196
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2577125	2578382	4098278		Bacillus_virus(100.0%)	1	NA	NA
WP_003246301.1|2577125_2578382_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	3.1e-33
>prophage 197
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2594420	2595239	4098278		Bacillus_virus(100.0%)	1	NA	NA
WP_003246440.1|2594420_2595239_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	61.1	1.6e-91
>prophage 198
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2599713	2601597	4098278		Pseudomonas_phage(50.0%)	2	NA	NA
WP_003246492.1|2599713_2600496_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.9	9.9e-46
WP_003246421.1|2600685_2601597_+	Proline dehydrogenase 2	NA	A0A2H4PQT6	Staphylococcus_phage	42.6	1.6e-66
>prophage 199
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2608985	2609996	4098278		Tupanvirus(100.0%)	1	NA	NA
WP_029727065.1|2608985_2609996_+	ferredoxin--NADP(+) reductase	NA	A0A2K9L4X0	Tupanvirus	27.4	1.3e-18
>prophage 200
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2614429	2616562	4098278		Escherichia_phage(100.0%)	1	NA	NA
WP_061891261.1|2614429_2616562_-	assimilatory nitrate reductase catalytic subunit	NA	A0A077SK27	Escherichia_phage	22.9	1.4e-17
>prophage 201
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2626386	2658482	4098278		Tupanvirus(50.0%)	10	NA	NA
WP_048654749.1|2626386_2627820_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	30.6	4.5e-52
WP_015715226.1|2627856_2628255_-	DNA-entry nuclease inhibitor	NA	NA	NA	NA	NA
WP_003234608.1|2628281_2628731_-	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	67.8	2.9e-42
WP_061891260.1|2628898_2630620_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.4	1.8e-15
WP_014478803.1|2630730_2631288_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_003234604.1|2631293_2631926_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_003246265.1|2632154_2632517_+	transcriptional activator HxlR	NA	NA	NA	NA	NA
WP_048654751.1|2633090_2643854_+	surfactin non-ribosomal peptide synthetase SrfAA	NA	A0A2K9KZV5	Tupanvirus	26.6	2.5e-155
WP_069703992.1|2643866_2654618_+	surfactin non-ribosomal peptide synthetase SrfAB	NA	A0A2K9KZV5	Tupanvirus	27.4	3.7e-167
WP_061891259.1|2654654_2658482_+	surfactin non-ribosomal peptide synthetase SrfAC	NA	A0A2K9KZV5	Tupanvirus	26.6	2.5e-89
>prophage 202
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2662253	2666073	4098278		Streptococcus_phage(50.0%)	4	NA	NA
WP_015252835.1|2662253_2663588_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	37.7	1.3e-66
WP_003234549.1|2663582_2664257_-	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
WP_014475783.1|2664361_2665009_-	YitT family protein	NA	NA	NA	NA	NA
WP_003234543.1|2665329_2666073_-	cystine ABC transporter ATP-binding protein TcyC	NA	G9BWD6	Planktothrix_phage	38.4	5.4e-33
>prophage 203
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2672357	2675870	4098278		Acinetobacter_phage(50.0%)	2	NA	NA
WP_048654757.1|2672357_2673836_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	38.8	7.3e-82
WP_048654758.1|2674115_2675870_+	hypothetical protein	NA	U5PSS0	Bacillus_phage	41.2	2.2e-125
>prophage 204
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2682704	2691141	4098278		Bacillus_phage(60.0%)	10	NA	NA
WP_003246532.1|2682704_2683388_+	two-component system response regulator YclJ	NA	W8CYM9	Bacillus_phage	40.4	3.6e-44
WP_080348068.1|2683374_2684796_+	two-component system sensor histidine kinase YclK	NA	W8CYF6	Bacillus_phage	35.0	6.0e-41
WP_014475800.1|2684958_2686107_+	response regulator aspartate phosphatase RapC	NA	A0A1P8CWN8	Bacillus_phage	44.6	2.2e-78
WP_003224994.1|2686090_2686213_+	phosphatase RapC inhibitor PhrC	NA	NA	NA	NA	NA
WP_015482794.1|2686312_2686402_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_032678937.1|2686483_2686597_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_029726569.1|2686749_2688114_-	aspartate kinase	NA	NA	NA	NA	NA
WP_014475804.1|2688498_2689449_+	petrobactin ABC transporter permease YclN	NA	A0A2H4IY97	uncultured_Caudovirales_phage	54.8	2.4e-94
WP_015252820.1|2689441_2690389_+	petrobactin ABC transporter permease YclO	NA	NA	NA	NA	NA
WP_015252819.1|2690382_2691141_+	petrobactin ABC transporter ATP-binding protein YclP	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.6	3.4e-19
>prophage 205
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2697696	2702255	4098278		Klosneuvirus(50.0%)	4	NA	NA
WP_019712392.1|2697696_2699007_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.2	4.4e-22
WP_015382777.1|2699075_2700464_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_026009827.1|2700586_2701450_+	glucose uptake protein GlcU	NA	NA	NA	NA	NA
WP_003246720.1|2701469_2702255_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.9	6.3e-24
>prophage 206
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2725550	2728693	4098278		Staphylococcus_phage(50.0%)	3	NA	NA
WP_014478863.1|2725550_2727062_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.5	9.9e-42
WP_072592622.1|2727081_2727627_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003246648.1|2727832_2728693_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.3	1.2e-57
>prophage 207
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2732684	2734868	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_029317313.1|2732684_2734868_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.0	2.7e-40
>prophage 208
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2744435	2746676	4098278		Acinetobacter_phage(50.0%)	2	NA	NA
WP_046380790.1|2744435_2744885_+	8-oxo-dGTP diphosphatase MutT	NA	I3WW32	Acinetobacter_phage	38.3	6.4e-05
WP_046380791.1|2744951_2746676_+	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	25.8	9.2e-36
>prophage 209
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2759030	2759957	4098278		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003246573.1|2759030_2759957_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.7	5.9e-37
>prophage 210
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2763878	2764199	4098278		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032722927.1|2763878_2764199_-	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	33.3	2.2e-07
>prophage 211
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2767282	2768767	4098278		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_003246685.1|2767282_2768767_+	ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.3	7.6e-63
>prophage 212
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2775013	2775364	4098278		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003156187.1|2775013_2775364_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	5.8e-14
>prophage 213
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2778932	2779721	4098278		Bacillus_phage(100.0%)	1	NA	NA
WP_003246715.1|2778932_2779721_+	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	35.2	2.2e-24
>prophage 214
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2784202	2793516	4098278		Bacillus_phage(75.0%)	10	NA	NA
WP_003246525.1|2784202_2784655_+	SprT family protein	NA	U5J9G1	Bacillus_phage	29.8	4.9e-05
WP_015252759.1|2785711_2786275_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014478933.1|2786473_2786992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046380793.1|2787002_2788724_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	56.8	3.3e-134
WP_029316771.1|2789204_2789438_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009966645.1|2790612_2790789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004399401.1|2790813_2791500_+	hypothetical protein	NA	O64048	Bacillus_phage	98.2	2.7e-124
WP_009966647.1|2791924_2792110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003234249.1|2792459_2793053_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003234247.1|2793315_2793516_+	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	75.8	9.6e-22
>prophage 215
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2798451	2799324	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_046160082.1|2798451_2799324_-	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	33.0	9.7e-34
>prophage 216
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2811178	2812051	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_029317361.1|2811178_2812051_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.0	8.2e-33
>prophage 217
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2816401	2817709	4098278		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015252728.1|2816401_2817709_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	66.8	8.3e-154
>prophage 218
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2825473	2826115	4098278		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_003244318.1|2825473_2826115_+	two-component system response regulator YdfI	NA	Q6XM27	Feldmannia_irregularis_virus	30.5	5.7e-07
>prophage 219
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2846276	2847905	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_046380802.1|2846276_2847905_-	ABC-F type ribosomal protection protein VmlR	NA	Q6DMX7	Streptococcus_phage	31.7	3.2e-54
>prophage 220
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2853717	2854347	4098278		Clostridioides_phage(100.0%)	1	NA	NA
WP_046380805.1|2853717_2854347_-	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	53.1	6.2e-06
>prophage 221
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2859620	2860808	4098278		Lambdina_fiscellaria_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_046380808.1|2859620_2860808_+	glycosyltransferase	NA	A0A0E3URP0	Lambdina_fiscellaria_nucleopolyhedrovirus	29.1	3.0e-09
>prophage 222
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2870158	2871556	4098278		Pandoravirus(100.0%)	1	NA	NA
WP_015252688.1|2870158_2871556_+	6-phospho-beta-glucosidase GmuD	NA	A0A0B5JD41	Pandoravirus	29.1	4.2e-47
>prophage 223
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2884792	2893598	4098278	protease,tRNA	uncultured_virus(40.0%)	10	NA	NA
WP_032722963.1|2884792_2885833_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.9	4.0e-66
WP_069322419.1|2886063_2887992_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.1e-56
WP_046380818.1|2888117_2888630_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003234073.1|2888626_2889274_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003234072.1|2889295_2889469_+	sec-independent protein translocase protein TatAY	NA	NA	NA	NA	NA
WP_015252680.1|2889475_2890240_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.8	1.5e-22
WP_003225680.1|2890471_2890663_-	YdiK family protein	NA	NA	NA	NA	NA
WP_003234069.1|2890659_2891394_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003155970.1|2891632_2891917_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
WP_003243151.1|2891963_2893598_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	2.8e-159
>prophage 224
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2896952	2899427	4098278		Moraxella_phage(50.0%)	2	NA	NA
WP_003234063.1|2896952_2898236_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	28.8	2.1e-24
WP_003242904.1|2898257_2899427_+	DNA cytosine methyltransferase	NA	A0A2I7QSC9	Vibrio_phage	32.4	4.6e-31
>prophage 225
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2923274	2924090	4098278		Mycobacterium_phage(100.0%)	1	NA	NA
WP_041333557.1|2923274_2924090_-	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	30.8	2.2e-11
>prophage 226
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2934465	2953952	4098278		Synechococcus_phage(30.0%)	19	NA	NA
WP_003233970.1|2934465_2936007_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.5	7.5e-21
WP_019712792.1|2936115_2936649_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_019712793.1|2936630_2938097_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_003233968.1|2938481_2939804_+	hypoxanthine/guanine permease PbuG	NA	A0A0R6PHV4	Moraxella_phage	30.0	2.2e-37
WP_046160140.1|2940014_2940818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003244066.1|2940976_2941144_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_015482896.1|2941357_2941912_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_003219403.1|2941911_2942109_+	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_003244134.1|2942431_2942920_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.9	8.7e-24
WP_014479059.1|2942912_2944055_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003233955.1|2944051_2945347_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
WP_046380819.1|2945420_2946146_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	4.1e-46
WP_003219409.1|2946138_2946393_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014663062.1|2946389_2947073_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_046160142.1|2947056_2949285_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	2.2e-159
WP_003233947.1|2949260_2950691_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_003233945.1|2950792_2951833_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	2.8e-64
WP_015252651.1|2951829_2952417_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
WP_046380820.1|2952413_2953952_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.6	3.9e-78
>prophage 227
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2963192	2970556	4098278		Bacillus_phage(33.33%)	5	NA	NA
WP_015383008.1|2963192_2965412_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.7	9.5e-134
WP_041333598.1|2965435_2967442_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.1	3.5e-127
WP_003242795.1|2967457_2968648_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_080480982.1|2968809_2969820_+	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
WP_080480983.1|2969857_2970556_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.9	2.7e-18
>prophage 228
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2976778	2986863	4098278		Leptospira_phage(25.0%)	4	NA	NA
WP_046380827.1|2976778_2979937_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	8.6e-64
WP_003233894.1|2980260_2981172_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.7	1.2e-21
WP_046380828.1|2981428_2982811_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.8	8.0e-115
WP_046380829.1|2983860_2986863_+	DEAD/DEAH box helicase family protein	NA	U6E9C9	Streptococcus_phage	26.5	3.5e-14
>prophage 229
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2990130	2995039	4098278		Bacillus_phage(100.0%)	4	NA	NA
WP_052728183.1|2990130_2991258_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	41.2	7.8e-76
WP_046380833.1|2991832_2992225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046380834.1|2992557_2993028_-	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_046380835.1|2993032_2995039_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	57.6	1.3e-145
>prophage 230
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	2998733	2999864	4098278		Bacillus_phage(100.0%)	1	NA	NA
WP_069703934.1|2998733_2999864_+	response regulator aspartate phosphatase RapH	NA	A0A1P8CWN8	Bacillus_phage	45.6	8.3e-86
>prophage 231
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3006511	3008245	4098278		Enterobacteria_phage(100.0%)	1	NA	NA
WP_046380844.1|3006511_3008245_+	two-component system sensor histidine kinase YesM	NA	Q9EYF3	Enterobacteria_phage	27.5	1.5e-22
>prophage 232
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3038088	3045615	4098278		Mycobacterium_phage(33.33%)	4	NA	NA
WP_128753544.1|3038088_3041274_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.5	3.0e-80
WP_003243930.1|3041720_3043640_+	Lipoteichoic acid synthase 1	NA	W6LM83	Streptococcus_phage	43.5	1.0e-128
WP_003244408.1|3043875_3044640_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003244102.1|3044646_3045615_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-30
>prophage 233
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3053973	3065116	4098278		uncultured_Caudovirales_phage(20.0%)	10	NA	NA
WP_003242537.1|3053973_3054828_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.0	2.1e-09
WP_069703943.1|3054962_3056852_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	31.9	6.1e-41
WP_069703944.1|3056975_3057422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069703945.1|3057546_3057969_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003233759.1|3058034_3059225_+	MFS transporter	NA	NA	NA	NA	NA
WP_033883242.1|3059765_3061322_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.5e-56
WP_015252580.1|3061494_3062625_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	30.9	3.7e-41
WP_015252579.1|3062692_3063139_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_069703946.1|3063191_3064211_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003233737.1|3064315_3065116_-	Fe(3+)-citrate ABC transporter ATP-binding protein YfmF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.4e-16
>prophage 234
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3080197	3080335	4098278		Bacillus_virus(100.0%)	1	NA	NA
WP_003233704.1|3080197_3080335_-	YflJ family protein	NA	G3MBD1	Bacillus_virus	58.1	8.6e-06
>prophage 235
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3083462	3085412	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_003233694.1|3083462_3085412_-	lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	43.2	2.2e-134
>prophage 236
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3111553	3112954	4098278		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_046380861.1|3111553_3112954_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	39.6	2.2e-88
>prophage 237
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3123416	3123746	4098278		uncultured_virus(100.0%)	1	NA	NA
WP_010886445.1|3123416_3123746_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	41.5	1.6e-13
>prophage 238
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3131476	3135006	4098278		Bacillus_phage(100.0%)	2	NA	NA
WP_160216280.1|3131476_3133198_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.3	4.9e-53
WP_042978122.1|3133191_3135006_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	1.0e-56
>prophage 239
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3143387	3144323	4098278		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_048655258.1|3143387_3144323_+	linearmycin resistance ATP-binding protein LnrL	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	36.2	1.4e-30
>prophage 240
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3151498	3152035	4098278		Paenibacillus_phage(100.0%)	1	NA	NA
WP_021481174.1|3151498_3152035_+	bacillithiol transferase BstA	NA	D0R7I3	Paenibacillus_phage	46.1	5.8e-21
>prophage 241
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3167299	3169381	4098278		Mycobacterium_phage(50.0%)	2	NA	NA
WP_029726839.1|3167299_3168160_+	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	27.4	5.0e-06
WP_003244113.1|3168391_3169381_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	42.4	1.5e-59
>prophage 242
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3176921	3178664	4098278		Bacillus_phage(100.0%)	1	NA	NA
WP_009966836.1|3176921_3178664_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	1.5e-46
>prophage 243
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3195266	3199723	4098278		Pandoravirus(33.33%)	4	NA	NA
WP_003233470.1|3195266_3196622_-	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	39.5	2.7e-43
WP_003245192.1|3196872_3197070_+	transcriptional regulator SenS	NA	NA	NA	NA	NA
WP_003245322.1|3197096_3198548_-	Vegetative catalase	NA	A0A2K9L0T1	Tupanvirus	41.3	1.2e-108
WP_010886450.1|3198955_3199723_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	4.2e-33
>prophage 244
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3210717	3213971	4098278		Thermus_phage(50.0%)	2	NA	NA
WP_003233433.1|3210717_3212613_+	serine/threonine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.5	1.4e-101
WP_003233432.1|3212792_3213971_+	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	45.3	6.5e-25
>prophage 245
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3219165	3224375	4098278		Staphylococcus_phage(50.0%)	6	NA	NA
WP_003233423.1|3219165_3219864_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.2e-21
WP_029317524.1|3219880_3220798_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	1.6e-39
WP_038427544.1|3220790_3221732_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003224086.1|3221823_3222027_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	61.5	1.2e-16
WP_003245726.1|3222462_3223293_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046380874.1|3223295_3224375_-	diguanylate cyclase DgcK	NA	A0A127AWB9	Bacillus_phage	37.0	5.8e-20
>prophage 246
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3234655	3237418	4098278		Bodo_saltans_virus(33.33%)	4	NA	NA
WP_003244785.1|3234655_3235564_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	25.3	1.1e-06
WP_003233401.1|3235674_3236070_+	YhcU family protein	NA	NA	NA	NA	NA
WP_003245462.1|3236206_3236629_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	35.0	4.6e-13
WP_003245030.1|3236755_3237418_+	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	26.6	5.9e-07
>prophage 247
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3241532	3242357	4098278		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003233386.1|3241532_3242357_+	glycerol uptake facilitator protein GlpF	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	34.6	1.1e-31
>prophage 248
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3245805	3247551	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_003244986.1|3245805_3247551_+	phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	49.3	3.5e-160
>prophage 249
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3250823	3252290	4098278		Clostridioides_phage(100.0%)	1	NA	NA
WP_015252477.1|3250823_3252290_-	peptidoglycan endopeptidase LytF	NA	A0A1V0DZX6	Clostridioides_phage	41.7	3.8e-14
>prophage 250
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3258030	3262142	4098278		Bacillus_virus(50.0%)	4	NA	NA
WP_069704133.1|3258030_3259044_+	peptidoglycan endopeptidase LytE	NA	M1HNA7	Bacillus_virus	43.8	3.4e-14
WP_003233357.1|3259114_3259990_-	transcriptional regulator CitR	NA	NA	NA	NA	NA
WP_041335618.1|3260098_3261199_+	citrate synthase/methylcitrate synthase	NA	NA	NA	NA	NA
WP_029726337.1|3261272_3262142_+	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.8	9.6e-58
>prophage 251
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3276348	3279880	4098278		Staphylococcus_phage(33.33%)	5	NA	NA
WP_014479308.1|3276348_3276744_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	8.9e-11
WP_014479309.1|3276730_3277462_-	hypothetical protein	NA	A0A0S2MYI4	Enterococcus_phage	29.5	5.9e-16
WP_009966908.1|3277695_3277803_+	YhdX family protein	NA	NA	NA	NA	NA
WP_046380885.1|3277951_3279067_+	small-conductance mechanosensitive channel protein MscY	NA	NA	NA	NA	NA
WP_046380886.1|3279136_3279880_+	sirtuin NAD-dependent deacetylase	NA	A0A068EPD4	Bacillus_phage	31.2	3.1e-20
>prophage 252
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3284360	3289277	4098278		Bacillus_phage(66.67%)	5	NA	NA
WP_046380892.1|3284360_3286118_+	multidrug ABC transporter ATP-binding protein BmrC	NA	W8CYL7	Bacillus_phage	30.3	3.1e-55
WP_046380893.1|3286114_3288136_+	multidrug resistance ABC transporter ATP-binding protein/permease BmrD	NA	A0A076FI99	Aureococcus_anophage	25.8	1.4e-30
WP_046380894.1|3288185_3288806_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003245136.1|3288844_3288970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003233287.1|3289073_3289277_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	76.6	4.5e-19
>prophage 253
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3293789	3294143	4098278		Streptococcus_phage(100.0%)	1	NA	NA
WP_003224239.1|3293789_3294143_+	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	27.9	4.5e-06
>prophage 254
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3301634	3302531	4098278		Staphylococcus_phage(100.0%)	1	NA	NA
WP_041338159.1|3301634_3302531_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.7e-25
>prophage 255
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3314331	3317226	4098278		Streptococcus_phage(50.0%)	3	NA	NA
WP_024571663.1|3314331_3315411_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.7	1.4e-82
WP_003233231.1|3315557_3315995_-	HIT family protein	NA	NA	NA	NA	NA
WP_003233230.1|3316482_3317226_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	9.2e-25
>prophage 256
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3340010	3344599	4098278		Staphylococcus_phage(50.0%)	4	NA	NA
WP_029726300.1|3340010_3341552_+	long-chain-fatty-acid--CoA ligase LcfB	NA	A0A2H4PQM9	Staphylococcus_phage	28.2	5.7e-45
WP_003245187.1|3341590_3341986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046380902.1|3342134_3343415_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_029726299.1|3343453_3344599_-	subtilisin AprE	NA	A0A217EQY2	Bacillus_phage	46.7	3.7e-49
>prophage 257
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3349518	3357673	4098278		Trichoplusia_ni_ascovirus(50.0%)	8	NA	NA
WP_061891218.1|3349518_3350958_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	1.0e-24
WP_080481037.1|3350964_3351525_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_003245216.1|3351659_3352958_-	heme-based aerotactic transducer HemAT	NA	A0A2H4J162	uncultured_Caudovirales_phage	66.7	2.6e-06
WP_049140685.1|3353096_3354626_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003245662.1|3354737_3355595_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.6	3.5e-52
WP_003233142.1|3355622_3355856_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_003245329.1|3356148_3356727_+	competence transcription factor ComK	NA	NA	NA	NA	NA
WP_003245421.1|3356773_3357673_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	51.6	3.0e-70
>prophage 258
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3367312	3368638	4098278		Tupanvirus(100.0%)	1	NA	NA
WP_046380910.1|3367312_3368638_-	3-dehydro-glucose-6-phosphate--glutamate transaminase	NA	A0A2K9L0G1	Tupanvirus	27.5	9.6e-25
>prophage 259
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3378833	3387168	4098278		Clostridium_botulinum_C_phage(50.0%)	3	NA	NA
WP_160216283.1|3378833_3382532_+	helicase-exonuclease AddAB subunit AddA	NA	Q331U3	Clostridium_botulinum_C_phage	23.6	2.7e-16
WP_069704117.1|3382603_3383779_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_069704116.1|3383775_3387168_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	27.1	1.5e-10
>prophage 260
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3392815	3398102	4098278	protease	Bacillus_phage(50.0%)	3	NA	NA
WP_069704115.1|3392815_3395500_+|protease	cell wall-associated protease WprA	protease	A0A217EQY2	Bacillus_phage	37.0	8.2e-31
WP_080481060.1|3395530_3396112_-	DUF2777 domain-containing protein	NA	NA	NA	NA	NA
WP_029726288.1|3396257_3398102_+	asparagine synthase (glutamine-hydrolyzing)	NA	E3T4J5	Cafeteria_roenbergensis_virus	24.6	5.4e-34
>prophage 261
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3408065	3410665	4098278		Mycobacterium_phage(33.33%)	3	NA	NA
WP_003245141.1|3408065_3408872_+	alpha/beta hydrolase	NA	A0A0A1ELD0	Mycobacterium_phage	26.9	2.5e-12
WP_003245829.1|3408899_3409499_-	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	40.2	3.0e-10
WP_046380919.1|3409495_3410665_-	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	33.0	6.4e-49
>prophage 262
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3426724	3427576	4098278		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003245785.1|3426724_3427576_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	32.1	4.6e-12
>prophage 263
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3431651	3433313	4098278		Bacteriophage(50.0%)	2	NA	NA
WP_003232996.1|3431651_3431822_+	YqaE/Pmp3 family membrane protein	NA	A0A0C5AJ71	Bacteriophage	60.0	9.4e-10
WP_046380925.1|3431882_3433313_+	FAD-binding oxidoreductase	NA	A0A2K9KZR0	Tupanvirus	29.8	2.9e-51
>prophage 264
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3437122	3439413	4098278		Klosneuvirus(50.0%)	2	NA	NA
WP_046380927.1|3437122_3438280_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	3.1e-27
WP_046380928.1|3438351_3439413_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	40.1	6.0e-62
>prophage 265
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3442485	3443445	4098278		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_014479432.1|3442485_3443445_+	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	28.6	1.2e-21
>prophage 266
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3446842	3498636	4098278	tRNA,coat	Bacillus_phage(30.0%)	60	NA	NA
WP_003232972.1|3446842_3447082_-|coat	spore coat protein YjzB	coat	NA	NA	NA	NA
WP_003232971.1|3447246_3448185_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003244890.1|3448207_3449449_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_160216284.1|3449524_3450310_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_003232965.1|3450501_3451488_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_003232964.1|3451484_3452474_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
WP_003245082.1|3452561_3454193_+	oligopeptide-binding protein AppA	NA	NA	NA	NA	NA
WP_003245828.1|3454268_3455219_+	oligopeptide ABC transporter permease AppB	NA	NA	NA	NA	NA
WP_003232961.1|3455235_3456147_+	oligopeptide ABC transporter permease AppC	NA	NA	NA	NA	NA
WP_046380932.1|3456352_3457105_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
WP_003245134.1|3457139_3458132_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015252360.1|3458875_3460513_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_003245554.1|3460620_3461556_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_003232954.1|3461559_3462477_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_072173823.1|3462481_3463558_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|3463559_3464477_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_080478438.1|3464584_3465802_+	MFS transporter	NA	NA	NA	NA	NA
WP_003224597.1|3465966_3466545_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014476435.1|3466725_3467121_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003232944.1|3467163_3467820_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_119122854.1|3467989_3468130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245194.1|3468096_3468753_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003245684.1|3468747_3468870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046380934.1|3468913_3470065_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_014479450.1|3470111_3472124_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|3472161_3472329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024573348.1|3472642_3473542_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_046380935.1|3473538_3473937_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_080481059.1|3474191_3474737_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	59.7	2.4e-38
WP_014479452.1|3474940_3475513_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_046380937.1|3475637_3476006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|3476034_3476670_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|3476688_3477489_+	NAD kinase	NA	NA	NA	NA	NA
WP_080481058.1|3477551_3478403_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003244765.1|3478415_3479150_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	M4Q4T6	Vibrio_phage	25.0	3.2e-06
WP_029317615.1|3479384_3481229_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003232909.1|3481477_3482188_+	thiaminase II	NA	NA	NA	NA	NA
WP_046380938.1|3482162_3482780_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_046380939.1|3482763_3483873_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_015252345.1|3483872_3484073_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_010886483.1|3484069_3484840_+	thiazole synthase	NA	NA	NA	NA	NA
WP_046380940.1|3484836_3485847_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_046380941.1|3485865_3486681_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_046380942.1|3486816_3487593_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_003232894.1|3487693_3488377_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_014479464.1|3488469_3488919_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_014479465.1|3489046_3489535_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_003232886.1|3489686_3490196_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003232884.1|3490290_3490614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032677403.1|3490655_3491042_-|coat	spore coat protein CotV	coat	NA	NA	NA	NA
WP_003232879.1|3491201_3491558_+	sporulation protein YjcA	NA	NA	NA	NA	NA
WP_003232875.1|3491837_3492044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232872.1|3492125_3492275_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_003232870.1|3492407_3492662_+	sporulation-specific transcription regulator SopVIF	NA	NA	NA	NA	NA
WP_032677401.1|3492735_3495015_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.9	7.8e-91
WP_003232866.1|3495131_3495386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232863.1|3495458_3495881_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003232861.1|3495884_3496400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232859.1|3496436_3497159_-	esterase family protein	NA	NA	NA	NA	NA
WP_015715681.1|3497514_3498636_+	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	6.2e-17
>prophage 267
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3504909	3507124	4098278		uncultured_Caudovirales_phage(66.67%)	4	NA	NA
WP_003245063.1|3504909_3505371_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	46.7	1.8e-23
WP_003245581.1|3505636_3506140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245536.1|3506151_3506436_+	hypothetical protein	NA	Q9AYW8	Lactococcus_phage	33.3	3.1e-05
WP_003245120.1|3506596_3507124_+	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	55.0	8.2e-36
>prophage 268
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3516708	3587242	4098278	holin,tRNA,portal,terminase,plate,coat	Bacillus_phage(27.03%)	84	NA	NA
WP_003244878.1|3516708_3517188_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003232825.1|3517227_3517422_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_003232822.1|3517587_3517917_-	YjdJ family protein	NA	NA	NA	NA	NA
WP_080481057.1|3518536_3519526_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_003245601.1|3519648_3519897_-|coat	spore coat protein CotT	coat	NA	NA	NA	NA
WP_003245023.1|3520150_3521554_+	peptidoglycan-N-acetylmuramic acid deacetylase PdaC	NA	NA	NA	NA	NA
WP_042974194.1|3521593_3522067_-	YjfA family protein	NA	NA	NA	NA	NA
WP_014476499.1|3522191_3522359_-	putative motility protein	NA	NA	NA	NA	NA
WP_160216285.1|3522484_3523384_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_009967034.1|3523392_3523791_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_003245827.1|3523891_3524467_-	YjgB family protein	NA	NA	NA	NA	NA
WP_160216286.1|3524612_3527570_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_003232799.1|3527562_3528123_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_003244850.1|3528319_3528961_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_010886490.1|3529039_3529666_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003232791.1|3529696_3529975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087614511.1|3530365_3531556_+	monooxygenase YjiB	NA	NA	NA	NA	NA
WP_003232783.1|3531578_3532757_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	28.3	5.6e-08
WP_003232781.1|3532797_3532986_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	3.4e-21
WP_003245334.1|3533159_3533972_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003232776.1|3534017_3534770_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_003232774.1|3534769_3535522_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	6.4e-18
WP_003232772.1|3535641_3536616_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
WP_003232768.1|3536747_3537245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003220510.1|3537633_3538056_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_003232765.1|3538095_3539274_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003245001.1|3539472_3540894_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_003245721.1|3540961_3542341_+	MFS transporter	NA	NA	NA	NA	NA
WP_046380951.1|3542445_3543459_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_003245542.1|3543464_3544484_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_046380952.1|3544508_3545588_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003245605.1|3545584_3546421_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	30.4	2.7e-09
WP_003245531.1|3546468_3547737_+	MFS transporter	NA	NA	NA	NA	NA
WP_003244946.1|3547824_3548826_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_003245710.1|3548902_3550345_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_019712454.1|3550341_3551835_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_014476525.1|3551873_3552638_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014479541.1|3552861_3553326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245490.1|3553474_3554746_+	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
WP_015252291.1|3554891_3556028_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
WP_003245487.1|3556017_3556152_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_046380953.1|3556181_3556424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046380954.1|3556551_3557505_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	74.1	4.3e-67
WP_014476529.1|3557544_3557922_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	4.7e-17
WP_015252289.1|3558026_3558629_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.2	3.8e-45
WP_046380955.1|3558705_3559542_+	manganese catalase	NA	NA	NA	NA	NA
WP_019712456.1|3559577_3560174_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|3560336_3560678_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_019712457.1|3560856_3561036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019712458.1|3561022_3561859_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_080009791.1|3561758_3562559_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	3.8e-61
WP_003245588.1|3562558_3562726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021479479.1|3562810_3563161_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_014476537.1|3563157_3563364_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	2.1e-11
WP_019712460.1|3563479_3563989_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	2.9e-22
WP_019712461.1|3564103_3564901_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.0	2.7e-59
WP_019712462.1|3564897_3566199_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.5	1.1e-153
WP_019712463.1|3566202_3567690_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.0e-139
WP_003232691.1|3567709_3568537_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
WP_019712464.1|3568562_3569498_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	63.4	1.9e-104
WP_003245011.1|3569519_3569903_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.2	1.9e-13
WP_009967053.1|3569899_3570256_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003245226.1|3570252_3570738_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_003232680.1|3570750_3571191_+	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
WP_003232679.1|3571194_3571413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245369.1|3571409_3572810_+	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
WP_003232677.1|3572811_3573255_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003232676.1|3573346_3573793_+	phage-like element PBSX protein XkdN	NA	A0A249XXA9	Clostridium_phage	33.6	7.5e-14
WP_003239113.1|3573822_3573972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080481029.1|3573973_3577972_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	43.8	6.9e-42
WP_046380957.1|3577964_3578624_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	6.2e-25
WP_003245730.1|3578639_3579617_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_003244812.1|3579616_3579883_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_014663657.1|3579940_3580366_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	37.3	6.6e-12
WP_015252271.1|3580358_3581405_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.8e-73
WP_014476551.1|3581388_3581967_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.9e-15
WP_029317674.1|3581963_3582236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046380958.1|3582238_3584350_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	30.1	1.9e-19
WP_046380959.1|3584361_3584691_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	39.8	3.8e-15
WP_014479563.1|3584687_3584852_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
WP_046380960.1|3584898_3585738_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_015252265.1|3585790_3586060_+	hypothetical protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	4.8e-24
WP_003232653.1|3586072_3586336_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	4.7e-24
WP_003245230.1|3586348_3587242_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.7	1.8e-83
>prophage 269
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3595467	3598315	4098278	protease	Salmonella_phage(50.0%)	2	NA	NA
WP_046380963.1|3595467_3596439_+	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.0	1.1e-62
WP_046160313.1|3596956_3598315_-|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.7	5.8e-25
>prophage 270
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3602170	3603178	4098278		Planktothrix_phage(100.0%)	1	NA	NA
WP_015252254.1|3602170_3603178_+	dipeptide ABC transporter ATP-binding subunit DppD	NA	G9BWD6	Planktothrix_phage	28.7	2.4e-15
>prophage 271
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3606970	3608863	4098278		Clostridium_phage(50.0%)	2	NA	NA
WP_069704113.1|3606970_3607861_+	gamma-D-glutamyl-L-lysine dipeptidyl-peptidase	NA	A0A0A8WIF2	Clostridium_phage	43.5	6.9e-19
WP_029317689.1|3607873_3608863_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.2e-17
>prophage 272
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3617525	3633039	4098278	protease	Streptococcus_phage(33.33%)	15	NA	NA
WP_014479591.1|3617525_3618623_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.1	4.3e-71
WP_014479592.1|3618634_3619882_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.1	4.2e-99
WP_003232574.1|3620007_3620433_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_014479593.1|3620463_3620907_-	organic hydroperoxide resistance transcriptional regulator OhrR	NA	NA	NA	NA	NA
WP_014479594.1|3621048_3621459_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_003245084.1|3621706_3622177_-	guanine deaminase	NA	S4VYZ2	Pandoravirus	45.8	1.8e-26
WP_046380967.1|3622351_3624640_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_046380968.1|3625055_3626015_-|protease	serine protease Isp	protease	A0A127AWU5	Bacillus_phage	49.5	5.6e-75
WP_003232560.1|3626237_3627071_+	RsbT co-antagonist RsbRB	NA	NA	NA	NA	NA
WP_019712472.1|3627101_3627866_-	HMP/thiamine ABC transporter permease ThiX	NA	NA	NA	NA	NA
WP_019712473.1|3627840_3629484_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.6e-19
WP_003232554.1|3629470_3630070_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_046380969.1|3630071_3630674_-	HMP/thiamine ABC transporter substrate-binding protein ThiU	NA	NA	NA	NA	NA
WP_046380970.1|3630984_3631671_+	two-component system response regulator YkoG	NA	NA	NA	NA	NA
WP_046380971.1|3631674_3633039_+	two-component system sensor histidine kinase YkoH	NA	A0A1V0SGX0	Hokovirus	32.4	6.4e-16
>prophage 273
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3642510	3646322	4098278		Salmonella_phage(50.0%)	3	NA	NA
WP_015252230.1|3642510_3643524_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	41.3	5.4e-52
WP_046380976.1|3643547_3645383_-	DNA ligase D	NA	NA	NA	NA	NA
WP_080481028.1|3645386_3646322_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	38.4	2.2e-44
>prophage 274
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3649683	3653024	4098278		Bacillus_phage(100.0%)	4	NA	NA
WP_009967096.1|3649683_3650658_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	41.9	2.5e-30
WP_003245855.1|3650921_3651677_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_046380977.1|3651673_3652819_+	anti-sigma-I factor RsgI	NA	NA	NA	NA	NA
WP_003218568.1|3652829_3653024_-	alpha/beta-type small acid-soluble spore protein	NA	A0A217EQS5	Bacillus_phage	66.7	1.4e-14
>prophage 275
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3658247	3660958	4098278		Bacillus_phage(50.0%)	2	NA	NA
WP_003232504.1|3658247_3660464_+	sporulation two-component system sensor histidine kinase KinE	NA	W8CYF6	Bacillus_phage	29.8	8.8e-23
WP_029726987.1|3660460_3660958_+	methylated-DNA--protein-cysteine methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	51.4	2.7e-20
>prophage 276
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3674664	3682575	4098278	protease	Pneumococcus_phage(40.0%)	8	NA	NA
WP_046380982.1|3674664_3676764_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	42.9	8.4e-132
WP_015715790.1|3677129_3678173_+	membrane protein	NA	NA	NA	NA	NA
WP_015715791.1|3678486_3679146_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	58.0	5.6e-66
WP_003232462.1|3679138_3679588_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_003232460.1|3679580_3680312_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.2	7.6e-56
WP_003218613.1|3680329_3680827_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	74.1	1.4e-56
WP_003245808.1|3681303_3681660_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046380983.1|3681828_3682575_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	4.6e-16
>prophage 277
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3687640	3698424	4098278		Bacillus_phage(25.0%)	9	NA	NA
WP_015252205.1|3687640_3688267_+	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	52.7	1.8e-26
WP_021479403.1|3688384_3689722_+	sporulation protein YkvU	NA	NA	NA	NA	NA
WP_029317723.1|3689772_3690270_+	sporulation thiol-disulfide oxidoreductase StoA	NA	NA	NA	NA	NA
WP_046380985.1|3690505_3692419_+	metal-transporting ATPase PfeT	NA	E4ZFI9	Streptococcus_phage	40.7	3.7e-118
WP_014476643.1|3692456_3692660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015715797.1|3692825_3693920_+	di/tri-peptidase	NA	NA	NA	NA	NA
WP_046380986.1|3694201_3695167_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.9	4.4e-19
WP_046380987.1|3695229_3696096_+	ptsGHI operon transcription antiterminator GlcT	NA	NA	NA	NA	NA
WP_046380988.1|3696324_3698424_+	PTS glucose transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	50.0	2.0e-08
>prophage 278
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3702764	3713659	4098278		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_032721455.1|3702764_3704732_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.8	1.3e-12
WP_003245029.1|3704869_3705736_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003244693.1|3705775_3706549_-	hypothetical protein	NA	U5Q0C0	Bacillus_phage	65.6	1.1e-41
WP_046380990.1|3706885_3709006_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_046380991.1|3709169_3710990_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	1.1e-07
WP_003232415.1|3710999_3712181_-	aminotransferase A	NA	NA	NA	NA	NA
WP_003245246.1|3712382_3712544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014476655.1|3712747_3713659_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.8	8.0e-47
>prophage 279
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3717214	3717979	4098278		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003232398.1|3717214_3717979_+	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	39.0	1.0e-39
>prophage 280
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3722832	3724663	4098278		Bacillus_phage(100.0%)	3	NA	NA
WP_032721469.1|3722832_3723309_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	34.9	4.7e-14
WP_032721471.1|3723298_3724192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032721472.1|3724207_3724663_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	38.2	3.8e-13
>prophage 281
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3728667	3729114	4098278		Bacillus_phage(100.0%)	1	NA	NA
WP_024571971.1|3728667_3729114_+	thiol-disulfide oxidoreductase YkuV	NA	A0A127AW88	Bacillus_phage	47.9	1.0e-34
>prophage 282
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3735680	3741900	4098278		Bacillus_phage(66.67%)	5	NA	NA
WP_003244670.1|3735680_3737438_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.5	1.4e-63
WP_046380994.1|3737449_3739264_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	7.2e-55
WP_003232360.1|3739373_3740069_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_038829597.1|3740073_3741207_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003232356.1|3741207_3741900_+	ABC transporter ATP-binding protein YknY	NA	G9BWD6	Planktothrix_phage	39.5	4.8e-36
>prophage 283
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3748160	3749783	4098278		Tupanvirus(100.0%)	1	NA	NA
WP_003232344.1|3748160_3749783_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.0	7.6e-48
>prophage 284
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3753651	3755406	4098278		Paenibacillus_phage(50.0%)	2	NA	NA
WP_160216288.1|3753651_3753930_+	transcriptional regulator AbhA	NA	A0A2I7SC16	Paenibacillus_phage	47.3	9.7e-12
WP_003232333.1|3754119_3755406_+	two-component sensor histidine kinase KinC	NA	W8CYF6	Bacillus_phage	29.7	4.8e-21
>prophage 285
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3761166	3762530	4098278		Lactococcus_phage(50.0%)	2	NA	NA
WP_003245153.1|3761166_3761940_+	Cof-type HAD-IIB family hydrolase	NA	Q0GXW5	Lactococcus_phage	22.6	2.0e-06
WP_003245474.1|3761975_3762530_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.8	3.2e-14
>prophage 286
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3767650	3769063	4098278		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003232309.1|3767650_3769063_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	7.5e-44
>prophage 287
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3781903	3786576	4098278		Streptococcus_phage(50.0%)	5	NA	NA
WP_003232278.1|3781903_3783742_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	38.8	3.8e-19
WP_003232274.1|3783798_3784116_+	membrane protein	NA	NA	NA	NA	NA
WP_003232271.1|3784171_3784381_-	YlaI family protein	NA	NA	NA	NA	NA
WP_003232269.1|3784463_3785093_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_003245272.1|3785247_3786576_+	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	34.3	3.1e-55
>prophage 288
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3802162	3806347	4098278		Bacillus_phage(50.0%)	7	NA	NA
WP_015483195.1|3802162_3803203_+	CAP domain-containing protein	NA	U5Q1E2	Bacillus_phage	39.5	9.9e-17
WP_003232233.1|3803434_3803833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046381000.1|3803848_3804088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003221370.1|3804203_3804653_+	competence/sporulation regulator complex protein RicF	NA	NA	NA	NA	NA
WP_015715839.1|3804707_3804980_+	YlbG family protein	NA	NA	NA	NA	NA
WP_029317761.1|3805302_3805857_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003245283.1|3805861_3806347_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	40.5	3.2e-26
>prophage 289
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3835066	3843138	4098278		Bacillus_phage(75.0%)	5	NA	NA
WP_046381007.1|3835066_3839368_+	bacillopeptidase F	NA	A0A217EQY2	Bacillus_phage	32.1	3.5e-23
WP_003232163.1|3839562_3840492_+	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_003221446.1|3840554_3841274_+	RNA polymerase sporulation sigma factor SigE	NA	A0A0A0RV91	Bacillus_phage	28.3	8.1e-18
WP_009967190.1|3841413_3842196_+	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.9	2.0e-46
WP_014479731.1|3842343_3843138_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	2.8e-11
>prophage 290
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3849138	3859532	4098278	tRNA	Moumouvirus(25.0%)	9	NA	NA
WP_029946171.1|3849138_3851904_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	26.0	1.0e-81
WP_003245479.1|3852048_3852423_+	sporulation-related RNA polymerase-binding protein YlyA	NA	NA	NA	NA	NA
WP_003245047.1|3852525_3852990_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_014479742.1|3852991_3853903_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003232127.1|3854085_3854631_+	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015483210.1|3854804_3856112_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.7	2.6e-59
WP_046381008.1|3856256_3857171_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	35.0	3.2e-35
WP_003232117.1|3857154_3858441_+	dihydroorotase	NA	NA	NA	NA	NA
WP_003232115.1|3858437_3859532_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	38.2	1.5e-60
>prophage 291
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3865100	3869743	4098278		Pandoravirus(33.33%)	5	NA	NA
WP_072557155.1|3865100_3865751_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	37.9	1.4e-32
WP_042975738.1|3866162_3866864_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_024572289.1|3866875_3867940_+	sulfate permease	NA	NA	NA	NA	NA
WP_046381009.1|3867988_3869137_+	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	29.2	1.0e-38
WP_015252120.1|3869149_3869743_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	41.9	2.5e-09
>prophage 292
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3873745	3883735	4098278	tRNA	Acanthocystis_turfacea_Chlorella_virus(20.0%)	9	NA	NA
WP_046381012.1|3873745_3876418_+	calcium-translocating P-type ATPase, SERCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.5	2.3e-86
WP_015252115.1|3876500_3877376_+	YicC family protein	NA	NA	NA	NA	NA
WP_003154355.1|3877452_3877722_+	extracellular matrix/biofilm regulator RemA	NA	NA	NA	NA	NA
WP_003232083.1|3877729_3878344_+	guanylate kinase	NA	S4W1R9	Pandoravirus	33.7	1.1e-12
WP_003221520.1|3878347_3878551_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017694849.1|3878633_3879854_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.6	4.1e-46
WP_046381013.1|3879850_3882268_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_072175956.1|3882279_3882777_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.7	1.2e-17
WP_046381014.1|3882781_3883735_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	33.6	8.2e-10
>prophage 293
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3886924	3888871	4098278		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_015252109.1|3886924_3888871_+	serine/threonine protein kinase PrkC	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	36.1	8.3e-25
>prophage 294
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3900295	3902242	4098278		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_046381016.1|3900295_3901036_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	8.9e-20
WP_003154310.1|3901119_3901353_+	acyl carrier protein	NA	M4M9G2	Vibrio_phage	44.9	7.1e-08
WP_003232030.1|3901492_3902242_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.9	4.2e-25
>prophage 295
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3913230	3913998	4098278		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_038828231.1|3913230_3913998_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	43.1	8.6e-26
>prophage 296
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3918359	3925859	4098278	protease,tRNA	Thermus_phage(25.0%)	6	NA	NA
WP_014479775.1|3918359_3919253_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	37.1	1.3e-28
WP_046381022.1|3919440_3921516_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	39.9	2.1e-103
WP_003244725.1|3921591_3922899_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003231988.1|3922966_3923881_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.8	5.2e-30
WP_003238555.1|3923893_3924439_+|protease	ATP-dependent protease subunit ClpQ	protease	NA	NA	NA	NA
WP_046381023.1|3924455_3925859_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.4	4.9e-43
>prophage 297
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3952272	3953037	4098278		Bacillus_phage(100.0%)	1	NA	NA
WP_015252090.1|3952272_3953037_+	RNA polymerase sigma-28 factor SigD	NA	A0A0A0PIT2	Bacillus_phage	26.0	2.3e-07
>prophage 298
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3956993	3957776	4098278		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003231925.1|3956993_3957776_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.0	3.7e-24
>prophage 299
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3962912	3974564	4098278	tRNA	Clostridium_phage(33.33%)	10	NA	NA
WP_046381028.1|3962912_3967226_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	33.2	1.6e-23
WP_003231915.1|3967555_3968026_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003231912.1|3968060_3969176_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_009967250.1|3969189_3969465_+	glucose-induced regulator RulR	NA	NA	NA	NA	NA
WP_003220946.1|3969466_3969769_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_014479801.1|3969788_3971939_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.2	3.8e-23
WP_003220950.1|3971935_3972214_+	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_009967251.1|3972230_3972584_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_015252083.1|3972665_3973595_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_046381029.1|3973613_3974564_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	28.5	1.2e-08
>prophage 300
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3978395	3979625	4098278		Bacillus_virus(100.0%)	1	NA	NA
WP_003245717.1|3978395_3979625_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	32.1	8.8e-49
>prophage 301
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	3988056	3996165	4098278		Mycobacterium_phage(25.0%)	6	NA	NA
WP_046381035.1|3988056_3990420_+	DNA translocase SpoIIIE	NA	A0A218M9A2	Mycobacterium_phage	47.1	1.4e-87
WP_003245732.1|3990563_3991289_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003231863.1|3991406_3992639_+	bacillibactin exporter BcbE	NA	NA	NA	NA	NA
WP_015715896.1|3992818_3994099_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	29.1	1.3e-50
WP_003244823.1|3994095_3995382_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	27.9	6.1e-08
WP_046381036.1|3995436_3996165_+	EF-P-5 aminopentanone reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.0	1.2e-13
>prophage 302
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	4000427	4008478	4098278		Bacillus_phage(40.0%)	7	NA	NA
WP_003245789.1|4000427_4001474_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	73.7	1.9e-137
WP_003245877.1|4001641_4002817_+	serine hydrolase	NA	A0A0B5A438	Mycobacterium_phage	24.8	1.5e-08
WP_003221010.1|4003092_4004655_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_003245138.1|4004723_4005518_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_003154135.1|4005717_4005978_+	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	42.5	1.2e-08
WP_160216291.1|4006243_4007287_+	L-threonine 3-dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	2.3e-21
WP_003231837.1|4007299_4008478_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	33.1	7.7e-50
>prophage 303
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	4011527	4016003	4098278		Catovirus(50.0%)	2	NA	NA
WP_003244841.1|4011527_4014104_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.7	2.4e-40
WP_003245099.1|4014119_4016003_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.0	5.9e-68
>prophage 304
NZ_CP028215	Bacillus subtilis strain SRCM102750 chromosome, complete genome	4098278	4028588	4094310	4098278		Paenibacillus_phage(100.0%)	5	NA	NA
WP_046381038.1|4028588_4043720_+	non-ribosomal peptide synthetase	NA	D0R7J2	Paenibacillus_phage	59.6	3.8e-125
WP_160216293.1|4043703_4057332_+	polyketide synthase PksL	NA	D0R7J2	Paenibacillus_phage	31.3	8.3e-39
WP_069704101.1|4057347_4070130_+	polyketide synthase PksM	NA	D0R7J2	Paenibacillus_phage	31.7	9.6e-37
WP_080481053.1|4070197_4086661_+	non-ribosomal peptide synthetase	NA	D0R7J2	Paenibacillus_phage	56.1	1.2e-119
WP_069704100.1|4086675_4094310_+	methyltransferase	NA	D0R7J2	Paenibacillus_phage	29.4	2.0e-37
>prophage 1
NZ_CP028216	Bacillus subtilis strain SRCM102750 plasmid unnamed1, complete sequence	84569	0	28919	84569	tail,terminase,head,portal,capsid,protease,integrase	Enterococcus_phage(30.43%)	30	2407:2422	33848:33863
WP_009968675.1|419_740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009968676.1|946_1126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080028532.1|1142_1514_+	HNH endonuclease	NA	W5RV32	Staphylococcus_phage	54.2	1.5e-28
WP_160216301.1|1525_2017_+|terminase	phage terminase small subunit P27 family	terminase	A0A1G5SA54	Enterococcus_phage	60.1	3.3e-47
WP_074794807.1|2249_2873_+	hypothetical protein	NA	A0A1G5SA94	Enterococcus_phage	65.2	6.2e-67
2407:2422	attL	AACTTAAGAAAATTGA	NA	NA	NA	NA
WP_074794810.1|2983_3925_+	hypothetical protein	NA	A0A060AKE0	Staphylococcus_phage	64.8	9.2e-46
WP_080475147.1|4110_5241_+	hypothetical protein	NA	A0A1G5SA94	Enterococcus_phage	63.7	1.8e-133
WP_009968694.1|5263_6643_+|portal	phage portal protein	portal	A0A060AFC9	Staphylococcus_phage	48.8	2.1e-107
WP_020846131.1|6684_7626_+|head,protease	HK97 family phage prohead protease	head,protease	A0A060AB24	Staphylococcus_phage	45.2	8.0e-42
WP_013603369.1|7646_8795_+|capsid	phage major capsid protein	capsid	A0A060AEU4	Staphylococcus_phage	47.5	1.1e-66
WP_009968725.1|8896_9112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009968726.1|9101_9434_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q0SPK5	Clostridium_phage	33.7	5.6e-06
WP_013603366.1|9433_9772_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_013603365.1|9771_10152_+	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	30.3	4.9e-06
WP_009968607.1|10148_10553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009968606.1|10583_11234_+|tail	phage major tail protein	tail	A0A249XUT9	Enterococcus_phage	36.4	1.6e-20
WP_013603363.1|11311_11638_+	hypothetical protein	NA	A0A0M4R2F4	Enterococcus_phage	41.1	8.7e-12
WP_160216302.1|11835_16920_+|tail	phage tail tape measure protein	tail	A8ATA7	Listeria_phage	49.4	2.9e-106
WP_160216303.1|16916_18581_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	35.4	1.2e-85
WP_095374992.1|18596_20927_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	37.0	8.7e-138
WP_020846128.1|20929_21316_+	hypothetical protein	NA	U5J9M3	Bacillus_phage	49.1	2.4e-24
WP_144499943.1|21333_23001_+	hypothetical protein	NA	U5PU90	Bacillus_phage	57.9	1.2e-77
WP_074794733.1|23009_23489_+	hypothetical protein	NA	R4JMW6	Bacillus_phage	46.8	2.4e-34
WP_074794736.1|23526_23733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009968664.1|23775_24045_+	hypothetical protein	NA	A0A1L2JY68	Aeribacillus_phage	47.3	1.4e-12
WP_074794739.1|24049_24343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160216304.1|24356_25670_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A060AFE7	Listeria_phage	57.8	2.5e-09
WP_020846125.1|25779_26757_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1D3SNK9	Enterococcus_phage	64.0	6.4e-119
WP_160216305.1|26871_28491_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	61.3	1.0e-76
WP_043940285.1|28502_28919_+	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	58.0	1.6e-42
33848:33863	attR	TCAATTTTCTTAAGTT	NA	NA	NA	NA
>prophage 2
NZ_CP028216	Bacillus subtilis strain SRCM102750 plasmid unnamed1, complete sequence	84569	32815	40267	84569		Lactococcus_phage(40.0%)	6	NA	NA
WP_160216307.1|32815_33712_-	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	36.0	5.3e-35
WP_009968555.1|33837_35832_-	DNA gyrase/topoisomerase IV, subunit A	NA	E0YIY2	Lactococcus_phage	42.7	1.2e-148
WP_160216308.1|35952_37869_-	DNA topoisomerase	NA	V9VEW1	Lactococcus_phage	51.8	2.9e-187
WP_074794761.1|37982_38846_-	hypothetical protein	NA	A0A286QTB6	Streptococcus_phage	40.6	1.6e-12
WP_129138233.1|39204_39570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043940325.1|39679_40267_-	thymidine kinase	NA	A0A291LB21	Escherichia_phage	30.5	1.1e-09
>prophage 3
NZ_CP028216	Bacillus subtilis strain SRCM102750 plasmid unnamed1, complete sequence	84569	43663	81305	84569	integrase	Enterococcus_phage(34.78%)	45	68567:68582	81806:81821
WP_013603335.1|43663_44221_-	RusA family crossover junction endodeoxyribonuclease	NA	Q332C4	Clostridium_botulinum_C_phage	34.1	3.3e-19
WP_129110637.1|44217_44766_-	guanylate kinase/L-type calcium channel region	NA	A0A1D3SNH1	Enterococcus_phage	35.6	1.8e-25
WP_043940321.1|44762_45059_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_009968550.1|45218_45428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013603331.1|45601_45976_-	deoxycytidine-triphosphatase	NA	NA	NA	NA	NA
WP_160216309.1|46262_50105_-	DNA polymerase III subunit alpha	NA	W5RV95	Staphylococcus_phage	49.7	0.0e+00
WP_013603329.1|50220_50673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013603328.1|50672_51647_-	FAD-dependent thymidylate synthase	NA	NA	NA	NA	NA
WP_009968562.1|51743_51980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020846152.1|51976_52444_-	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	53.7	6.3e-40
WP_020846151.1|52443_52905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109789047.1|53097_53886_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_020846148.1|54715_55276_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_160216310.1|55344_55611_-	thioredoxin family protein	NA	A0A0K2FLN5	Brevibacillus_phage	34.1	8.1e-08
WP_013603320.1|55715_56174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013603319.1|56333_56858_+	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	28.2	2.3e-06
WP_043940319.1|56930_58685_-	hypothetical protein	NA	A0A1G5SBU4	Enterococcus_phage	37.3	3.8e-85
WP_009968515.1|58674_58878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160216311.1|58938_59979_-	hypothetical protein	NA	A0A1G5SB33	Enterococcus_phage	50.0	4.2e-92
WP_043940316.1|60058_61651_-	hypothetical protein	NA	A0A1G5SC52	Enterococcus_phage	52.8	1.6e-154
WP_009968733.1|61647_62136_-	hypothetical protein	NA	A0A1G5SA84	Enterococcus_phage	41.5	1.7e-27
WP_160216312.1|62227_63280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160216313.1|63525_63912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043940313.1|64010_64517_-	hypothetical protein	NA	A0A0S2SY00	Bacillus_phage	33.1	1.5e-10
WP_043940312.1|64768_65194_-	hypothetical protein	NA	A0A249XZV0	Enterococcus_phage	35.0	3.8e-15
WP_095375003.1|65195_66239_-	ribonucleotide-diphosphate reductase subunit beta	NA	W5RVC6	Staphylococcus_phage	52.7	2.8e-104
WP_160216314.1|66342_68712_-	ribonucleoside-diphosphate reductase subunit alpha	NA	W5RV23	Staphylococcus_phage	59.3	6.3e-277
68567:68582	attL	ACCACTTTAGAAATGT	NA	NA	NA	NA
WP_160216315.1|68783_69818_-	AAA family ATPase	NA	A0A1D3SNC4	Enterococcus_phage	47.6	2.8e-88
WP_064911619.1|69886_70126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013603306.1|70214_70577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020846142.1|70573_71095_-	nucleoside 2-deoxyribosyltransferase	NA	A0A218KC29	Bacillus_phage	56.7	1.5e-42
WP_020846141.1|71169_72135_-	hypothetical protein	NA	A0A1D3SNI1	Enterococcus_phage	43.2	3.4e-56
WP_020846140.1|72194_72404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020846139.1|72682_72937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013603301.1|73169_73499_-	DUF2653 family protein	NA	NA	NA	NA	NA
WP_013603300.1|73501_74278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009968486.1|74317_74896_-	hypothetical protein	NA	S5M867	Bacillus_phage	42.1	3.4e-19
WP_009968485.1|74900_75425_-	hypothetical protein	NA	A0A0H3UZF4	Geobacillus_virus	60.6	5.4e-48
WP_009968484.1|75436_75667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020846138.1|75696_76395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129138239.1|76451_77486_-	hypothetical protein	NA	A0A060AL21	Staphylococcus_phage	38.5	2.6e-54
WP_043940299.1|77744_78317_+|integrase	site-specific integrase	integrase	A3F636	Streptococcus_phage	43.4	2.2e-34
WP_009968570.1|78354_78690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100086170.1|79354_79786_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MM68	Bacillus_phage	48.9	5.5e-14
WP_020846136.1|80024_81305_-	ATP-dependent DNA ligase	NA	A0A0K2FLM0	Brevibacillus_phage	37.2	1.6e-72
81806:81821	attR	ACCACTTTAGAAATGT	NA	NA	NA	NA
