The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028213	Bacillus subtilis strain SRCM102749 chromosome, complete genome	4192708	245288	253020	4192708	holin	Anomala_cuprea_entomopoxvirus(50.0%)	9	NA	NA
WP_128740728.1|245288_246431_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.1e-12
WP_003228349.1|246453_247107_+|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_080481290.1|247126_248038_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014478003.1|248055_248730_+|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_014478002.1|248761_249295_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049140428.1|249578_250724_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
WP_003228370.1|250740_251394_+|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_021480617.1|251405_252326_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041850528.1|252342_253020_+|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
>prophage 2
NZ_CP028213	Bacillus subtilis strain SRCM102749 chromosome, complete genome	4192708	828808	870174	4192708	protease,coat,tRNA	Bacillus_virus(20.0%)	41	NA	NA
WP_003229613.1|828808_830071_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
WP_038827669.1|830222_831881_+|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229618.1|832061_834386_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	3.4e-182
WP_003229621.1|834382_834970_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014477563.1|834991_835489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740610.1|835718_837086_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003222575.1|837093_837924_+	protein HemX	NA	NA	NA	NA	NA
WP_128740609.1|837956_838901_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_085187368.1|838890_839679_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_128740608.1|839675_840650_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_128740607.1|840679_841972_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_124048036.1|842102_843827_+|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_014480462.1|843859_844885_+|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_003222590.1|844903_845095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740606.1|845542_848185_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	4.9e-161
WP_128740605.1|848244_849537_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_021480242.1|849677_850424_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_128740604.1|850557_851556_+	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_004398496.1|851709_852279_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_021480240.1|852315_853011_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_003229650.1|853102_854116_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_009967915.1|854146_855019_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_128740603.1|855015_855534_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004398901.1|855586_856267_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398624.1|856268_857075_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_029727118.1|857223_858018_+	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_004398649.1|858010_858877_+	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_003229668.1|859023_859332_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003229669.1|859334_859673_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003222623.1|859685_859970_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229671.1|860090_860213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399131.1|860290_860869_+	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229675.1|860902_862189_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003222630.1|862249_862693_+	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_041351759.1|862709_863567_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_004398582.1|863590_864133_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_041850179.1|864092_865280_-	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.1	1.5e-32
WP_072173585.1|865382_866978_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_103803778.1|866931_867801_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_032726311.1|867787_868894_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_021480233.1|869010_870174_+|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
>prophage 3
NZ_CP028213	Bacillus subtilis strain SRCM102749 chromosome, complete genome	4192708	1235282	1241378	4192708		Staphylococcus_phage(66.67%)	8	NA	NA
WP_041849980.1|1235282_1236368_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	6.6e-56
WP_014480161.1|1236378_1237026_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
WP_038828558.1|1237040_1238237_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_003223915.1|1238269_1238734_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_003223910.1|1238846_1239221_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_032726064.1|1239234_1239759_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_014477220.1|1240039_1240795_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_003223904.1|1240784_1241378_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
>prophage 4
NZ_CP028213	Bacillus subtilis strain SRCM102749 chromosome, complete genome	4192708	1384300	1407641	4192708	transposase,bacteriocin,holin	Bacillus_phage(88.24%)	25	NA	NA
WP_128740513.1|1384300_1385191_-	endonuclease YokF	NA	O64020	Bacillus_phage	95.3	2.5e-109
WP_004399120.1|1385492_1386566_+	SPBc2 prophage-derived pesticidal crystal protein-like YokG	NA	O64021	Bacillus_phage	100.0	9.3e-204
WP_160240593.1|1386811_1386997_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_128740509.1|1387080_1387647_+	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	88.6	3.9e-92
WP_128740507.1|1387733_1389488_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	91.8	1.4e-289
WP_128740505.1|1389488_1390043_+	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	59.9	4.1e-54
WP_082786706.1|1390347_1390431_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_101501624.1|1390662_1391130_+	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	83.9	3.8e-69
WP_101501623.1|1391136_1391493_+	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	86.6	1.9e-52
WP_128740503.1|1391535_1391871_-	hypothetical protein	NA	O64029	Bacillus_phage	96.4	1.3e-50
WP_128740501.1|1392044_1392377_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	96.4	4.2e-54
WP_128740499.1|1392369_1393620_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	99.3	1.2e-237
WP_009967545.1|1393721_1394039_+	sublancin immunity protein SunI	NA	NA	NA	NA	NA
WP_009967544.1|1394335_1394506_+|bacteriocin	bacteriocin sublancin-168	bacteriocin	NA	NA	NA	NA
WP_003246186.1|1394563_1396681_+	sublancin transporter SunT	NA	W8CYL7	Bacillus_phage	26.1	6.9e-25
WP_003230920.1|1396677_1397091_+	disulfide bond formation protein BdbA	NA	NA	NA	NA	NA
WP_004399050.1|1397090_1398359_+	SunS family peptide S-glycosyltransferase	NA	NA	NA	NA	NA
WP_009967541.1|1398355_1398802_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_004399099.1|1398857_1399124_-	SPBc2 prophage-derived protein BhlB	NA	A0A2H4J6M0	uncultured_Caudovirales_phage	50.0	1.1e-15
WP_003246119.1|1399134_1399347_-	SPBc2 prophage-derived protein BhlA	NA	A0A290GDY2	Caldibacillus_phage	59.7	4.2e-15
WP_004399108.1|1399434_1400538_-	N-acetylmuramoyl-L-alanine amidase BlyA	NA	O64040	Bacillus_phage	100.0	2.8e-187
WP_128740497.1|1401811_1401961_-	XkdX family protein	NA	NA	NA	NA	NA
WP_128740495.1|1401961_1402351_-	hypothetical protein	NA	O64053	Bacillus_phage	44.4	7.9e-20
WP_128740927.1|1404164_1404983_-	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	68.3	7.1e-103
WP_128740494.1|1404998_1407641_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	95.3	0.0e+00
>prophage 5
NZ_CP028213	Bacillus subtilis strain SRCM102749 chromosome, complete genome	4192708	1416166	1433766	4192708	integrase	Bacillus_phage(95.0%)	22	1409258:1409274	1429365:1429381
1409258:1409274	attL	TGTTGCTCTTGAAGCTG	NA	NA	NA	NA
WP_128740492.1|1416166_1416616_-	hypothetical protein	NA	O64047	Bacillus_phage	95.9	1.7e-74
WP_128740491.1|1416860_1417868_-|integrase	site-specific integrase	integrase	A0A0H3V0P2	Geobacillus_virus	66.0	1.3e-122
WP_128740490.1|1417881_1418301_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	88.5	4.3e-64
WP_128740489.1|1418284_1418785_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	94.6	3.2e-82
WP_128740488.1|1418942_1419182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101502382.1|1419193_1419919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740487.1|1419925_1421344_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	60.0	6.7e-08
WP_128740486.1|1421343_1421700_-	hypothetical protein	NA	O64055	Bacillus_phage	88.1	5.0e-53
WP_087961536.1|1421988_1422600_-	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	92.6	4.8e-64
WP_041054450.1|1422617_1423415_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	99.2	3.0e-90
WP_003230954.1|1423457_1424168_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	100.0	1.8e-131
WP_019712889.1|1424164_1424671_-	hypothetical protein	NA	O64060	Bacillus_phage	99.4	2.9e-91
WP_003230958.1|1424667_1425318_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	100.0	3.2e-122
WP_009967519.1|1425301_1425556_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	100.0	2.2e-39
WP_004399452.1|1425552_1425948_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	100.0	2.5e-69
WP_019712890.1|1425962_1426433_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	99.4	1.1e-81
WP_064814698.1|1426468_1427485_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	99.4	3.7e-186
WP_010328108.1|1427523_1428060_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	99.4	1.4e-94
WP_128740485.1|1428084_1429521_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	91.6	4.5e-246
1429365:1429381	attR	CAGCTTCAAGAGCAACA	NA	NA	NA	NA
WP_128740484.1|1429551_1431072_-	hypothetical protein	NA	O64068	Bacillus_phage	97.8	6.2e-278
WP_128740483.1|1431089_1432859_-	hypothetical protein	NA	O64069	Bacillus_phage	99.5	0.0e+00
WP_128740482.1|1432845_1433766_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	99.3	6.0e-175
>prophage 6
NZ_CP028213	Bacillus subtilis strain SRCM102749 chromosome, complete genome	4192708	1438057	1456006	4192708		Bacillus_phage(95.65%)	33	NA	NA
WP_072692660.1|1438057_1438333_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	96.7	1.1e-39
WP_003230983.1|1438595_1439210_-	hypothetical protein	NA	A0A1P8CWS4	Bacillus_phage	99.0	2.2e-112
WP_003230984.1|1439430_1440333_-	GIY-YIG nuclease family protein	NA	G3MAX5	Bacillus_virus	35.5	1.8e-06
WP_128740477.1|1440514_1442392_-	hypothetical protein	NA	A0A1P8CWS8	Bacillus_phage	98.9	0.0e+00
WP_072692657.1|1442431_1442626_-	hypothetical protein	NA	O64077	Bacillus_phage	95.3	8.7e-28
WP_128740476.1|1443577_1443904_+	helix-turn-helix transcriptional regulator	NA	O64078	Bacillus_phage	97.2	4.1e-54
WP_128740475.1|1444098_1444710_+	hypothetical protein	NA	O64079	Bacillus_phage	96.1	3.3e-81
WP_032721653.1|1445243_1445420_+	hypothetical protein	NA	O64080	Bacillus_phage	97.4	2.0e-10
WP_080010576.1|1445438_1445690_+	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	95.8	9.3e-30
WP_003230987.1|1445734_1445923_+	hypothetical protein	NA	O64081	Bacillus_phage	96.8	9.7e-24
WP_128740474.1|1446004_1447222_+	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	83.4	4.9e-201
WP_128740473.1|1447563_1447767_+	hypothetical protein	NA	Q38079	Bacillus_phage	40.4	2.6e-06
WP_124048602.1|1447830_1448034_+	hypothetical protein	NA	A0A1P8CWV4	Bacillus_phage	98.5	5.2e-31
WP_128740472.1|1448189_1448411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740471.1|1448435_1448747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740470.1|1448782_1448977_+	hypothetical protein	NA	U5PXS6	Bacillus_phage	73.8	1.1e-17
WP_128740469.1|1448976_1449213_+	hypothetical protein	NA	J9Q9W1	Bacillus_phage	38.9	1.0e-06
WP_128740468.1|1449227_1449491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740467.1|1449477_1449699_+	hypothetical protein	NA	A0A0K2D0N5	Bacillus_phage	42.4	7.4e-07
WP_128740466.1|1449727_1449934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740926.1|1450174_1450510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740465.1|1450592_1450976_+	hypothetical protein	NA	O64087	Bacillus_phage	33.3	1.5e-07
WP_046160477.1|1451066_1451504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740464.1|1451595_1451823_+	helix-turn-helix transcriptional regulator	NA	O64085	Bacillus_phage	84.0	6.4e-30
WP_160240594.1|1451916_1452024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740462.1|1452215_1452782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740461.1|1453240_1453648_+	hypothetical protein	NA	O64087	Bacillus_phage	47.3	1.6e-23
WP_128740460.1|1453805_1454930_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_075747637.1|1454926_1455115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231000.1|1455143_1455323_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	96.6	3.6e-28
WP_004399430.1|1455393_1455645_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	100.0	1.6e-37
WP_120028241.1|1455648_1455864_+	hypothetical protein	NA	O64089	Bacillus_phage	88.7	2.2e-27
WP_042976227.1|1455874_1456006_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	97.7	1.4e-18
>prophage 7
NZ_CP028213	Bacillus subtilis strain SRCM102749 chromosome, complete genome	4192708	1462137	1510958	4192708	integrase	Bacillus_phage(95.08%)	79	1462103:1462124	1479834:1479855
1462103:1462124	attL	AAAGATAAAAAATATGTATATA	NA	NA	NA	NA
WP_004399418.1|1462137_1462338_+	hypothetical protein	NA	O64096	Bacillus_phage	100.0	9.0e-28
WP_128740455.1|1462340_1462658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740454.1|1462706_1462919_+	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	97.1	7.3e-28
WP_128740453.1|1462908_1463985_+|integrase	site-specific integrase	integrase	O64099	Bacillus_phage	98.0	2.7e-195
WP_128740452.1|1464091_1465474_+	hypothetical protein	NA	O64100	Bacillus_phage	96.7	1.3e-253
WP_128740451.1|1465497_1466475_+	hypothetical protein	NA	O64101	Bacillus_phage	99.4	2.0e-176
WP_004399410.1|1466663_1466888_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	100.0	1.9e-34
WP_128740450.1|1467070_1467289_+	YopT family protein	NA	O64103	Bacillus_phage	94.4	4.7e-30
WP_128740449.1|1467358_1467556_+	hypothetical protein	NA	O64104	Bacillus_phage	93.8	9.8e-27
WP_128740448.1|1467667_1467862_+	hypothetical protein	NA	O64105	Bacillus_phage	90.6	4.5e-24
WP_128740446.1|1468229_1468448_+	hypothetical protein	NA	A0A0A0RMF3	Bacillus_phage	43.5	2.2e-11
WP_128740445.1|1468444_1468828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053574298.1|1468824_1469022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740444.1|1469121_1469418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740443.1|1469802_1470441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740442.1|1470490_1470940_+	hypothetical protein	NA	O64117	Bacillus_phage	83.2	2.7e-64
WP_128740441.1|1470992_1471187_+	hypothetical protein	NA	O64118	Bacillus_phage	73.4	1.2e-21
WP_128740440.1|1471239_1471482_+	hypothetical protein	NA	A0A1P8CWY6	Bacillus_phage	91.2	8.3e-36
WP_128740439.1|1471499_1472171_+	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	91.0	7.5e-119
WP_128740438.1|1472585_1472801_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	81.7	8.2e-27
WP_128740437.1|1472814_1473189_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	47.2	1.3e-22
WP_128740436.1|1473314_1473716_+	hypothetical protein	NA	K4JWE2	Caulobacter_phage	36.4	8.5e-17
WP_128740435.1|1473750_1474314_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	51.1	3.8e-39
WP_128740434.1|1474291_1474681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740433.1|1474931_1475297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740432.1|1475397_1476210_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	95.9	9.0e-151
WP_128740431.1|1477024_1477246_+	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	95.9	5.5e-34
WP_128740430.1|1477310_1477646_+	hypothetical protein	NA	A0A2H4J4P5	uncultured_Caudovirales_phage	69.9	4.6e-32
WP_128740429.1|1477680_1478058_+	hypothetical protein	NA	A8ASN9	Listeria_phage	40.3	9.4e-18
WP_116315996.1|1478126_1478642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116315997.1|1478746_1479127_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	98.4	2.5e-66
WP_128740428.1|1479889_1480261_+	hypothetical protein	NA	O64139	Bacillus_phage	98.4	1.7e-64
1479834:1479855	attR	AAAGATAAAAAATATGTATATA	NA	NA	NA	NA
WP_072692914.1|1480282_1481197_+	hypothetical protein	NA	O64140	Bacillus_phage	89.5	3.6e-156
WP_004399537.1|1481279_1482251_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	100.0	1.7e-180
WP_101502259.1|1482293_1482764_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	97.4	5.9e-86
WP_106021403.1|1482778_1484293_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	99.0	2.6e-284
WP_128740427.1|1484308_1485445_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	97.6	4.0e-221
WP_128740426.1|1485444_1487175_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	96.4	0.0e+00
WP_128740425.1|1487187_1491117_+	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	83.3	0.0e+00
WP_128740925.1|1491145_1491862_+	3D domain-containing protein	NA	O64147	Bacillus_phage	87.0	1.6e-111
WP_068947558.1|1491970_1492129_+	hypothetical protein	NA	A0A1P8CX11	Bacillus_phage	88.5	1.6e-19
WP_041336515.1|1492165_1492363_+	hypothetical protein	NA	O64149	Bacillus_phage	96.9	2.1e-29
WP_003231089.1|1492601_1492757_+	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	96.1	5.7e-22
WP_003231091.1|1492756_1493254_+	deoxynucleoside kinase	NA	A0A1P8CX28	Bacillus_phage	90.3	1.1e-79
WP_019712329.1|1493291_1493639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231092.1|1493773_1493992_+	hypothetical protein	NA	A0A1P8CX26	Bacillus_phage	98.6	7.3e-31
WP_061891141.1|1493994_1494360_+	hypothetical protein	NA	O64156	Bacillus_phage	97.5	3.5e-62
WP_128740424.1|1494399_1494627_+	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	92.0	1.1e-32
WP_128740423.1|1494641_1494839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740422.1|1495026_1495785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740421.1|1496073_1496286_+	hypothetical protein	NA	O64159	Bacillus_phage	84.3	5.1e-29
WP_128740924.1|1496282_1496489_+	hypothetical protein	NA	O64161	Bacillus_phage	92.7	2.0e-22
WP_128740420.1|1496847_1497243_+	hypothetical protein	NA	O64163	Bacillus_phage	96.2	6.5e-70
WP_128740419.1|1497257_1497605_+	hypothetical protein	NA	O64164	Bacillus_phage	93.9	1.1e-52
WP_119996827.1|1497705_1497984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740418.1|1498025_1498244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740417.1|1498278_1498470_+	hypothetical protein	NA	U5PY38	Bacillus_phage	41.9	3.1e-09
WP_106021375.1|1498485_1498698_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	92.9	5.8e-33
WP_128740416.1|1498714_1498981_+	hypothetical protein	NA	A0A1P8CX38	Bacillus_phage	97.7	1.6e-40
WP_004399476.1|1499012_1499147_+	hypothetical protein	NA	O64168	Bacillus_phage	100.0	2.5e-18
WP_128740415.1|1499166_1499367_+	hypothetical protein	NA	O64169	Bacillus_phage	95.3	4.3e-30
WP_032721808.1|1499417_1499765_+	hypothetical protein	NA	A0A1P8CX44	Bacillus_phage	55.0	3.3e-25
WP_069322652.1|1499764_1500160_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	94.7	5.3e-64
WP_128740923.1|1500167_1500845_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	99.6	6.0e-124
WP_019712228.1|1502530_1502962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740922.1|1503088_1504084_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	80.1	1.4e-150
WP_004399328.1|1504080_1504323_+	thioredoxin family protein	NA	A0A1P8CX24	Bacillus_phage	100.0	1.4e-38
WP_128740414.1|1504365_1504728_+	hypothetical protein	NA	A0A172JI43	Bacillus_phage	43.8	3.2e-15
WP_128740413.1|1504799_1505228_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	93.0	2.3e-73
WP_128740412.1|1505321_1505936_-	VanZ family protein	NA	NA	NA	NA	NA
WP_116316022.1|1506089_1506257_+	hypothetical protein	NA	A0A1P8CX64	Bacillus_phage	90.9	1.2e-22
WP_128740411.1|1506261_1506552_+	hypothetical protein	NA	O64180	Bacillus_phage	97.9	2.1e-46
WP_128740410.1|1506698_1507040_+	hypothetical protein	NA	O64181	Bacillus_phage	99.1	1.1e-54
WP_128740409.1|1507048_1507654_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_128740408.1|1507729_1508569_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	96.4	6.5e-160
WP_128740407.1|1509214_1509568_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	63.2	1.1e-31
WP_128740406.1|1509774_1509963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740405.1|1509970_1510180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474724.1|1510739_1510958_-	acid-soluble spore protein SspC	NA	Q77YX0	Bacillus_phage	98.6	2.8e-30
>prophage 8
NZ_CP028213	Bacillus subtilis strain SRCM102749 chromosome, complete genome	4192708	1786923	1793488	4192708		Bacillus_phage(50.0%)	6	NA	NA
WP_003231746.1|1786923_1787892_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_064671409.1|1788525_1789293_+	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.5	4.1e-52
WP_128740349.1|1789356_1789977_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	4.6e-46
WP_003231754.1|1790026_1791016_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_014479842.1|1791033_1793136_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231758.1|1793095_1793488_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
>prophage 9
NZ_CP028213	Bacillus subtilis strain SRCM102749 chromosome, complete genome	4192708	2273303	2344433	4192708	terminase,plate,holin,protease,portal	Bacillus_phage(26.19%)	85	NA	NA
WP_003232562.1|2273303_2274263_+|protease	serine protease Isp	protease	A0A127AWU5	Bacillus_phage	49.5	5.6e-75
WP_128740281.1|2274678_2276967_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_038829040.1|2277139_2277610_+	guanine deaminase	NA	S4VYZ2	Pandoravirus	45.1	5.2e-26
WP_128740280.1|2277861_2278272_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_101502047.1|2278414_2278858_+	organic hydroperoxide resistance transcriptional regulator OhrR	NA	NA	NA	NA	NA
WP_003232574.1|2278888_2279314_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_128740279.1|2279439_2280687_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.4	1.5e-99
WP_017695098.1|2280698_2281796_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.1	4.3e-71
WP_041850915.1|2282146_2283049_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_015252242.1|2283119_2283437_-	multidrug efflux SMR transporter subunit YkkD	NA	NA	NA	NA	NA
WP_003232583.1|2283436_2283775_-	multidrug efflux SMR transporter subunit YkkC	NA	NA	NA	NA	NA
WP_021479443.1|2283996_2284515_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_128740278.1|2284504_2285032_-	DinB family protein	NA	NA	NA	NA	NA
WP_015715759.1|2285123_2285855_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_032725555.1|2286003_2286228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232593.1|2286304_2287504_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003232595.1|2287744_2288263_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_128740277.1|2288422_2289283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070548863.1|2289372_2290422_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_003232600.1|2290465_2291455_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.2e-17
WP_072174129.1|2291467_2292358_-	gamma-D-glutamyl-L-lysine dipeptidyl-peptidase	NA	A0A0A8WIF2	Clostridium_phage	42.7	4.0e-19
WP_038829053.1|2292354_2293455_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_047182505.1|2293451_2294411_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_072174130.1|2294498_2296148_-	dipeptide ABC transporter substrate-binding protein DppE	NA	NA	NA	NA	NA
WP_038829055.1|2296150_2297158_-	dipeptide ABC transporter ATP-binding subunit DppD	NA	G9BWD6	Planktothrix_phage	28.7	2.4e-15
WP_014476568.1|2297162_2298125_-	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_003245446.1|2298130_2299057_-	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_014479576.1|2299073_2299898_-	D-aminopeptidase DppA	NA	NA	NA	NA	NA
WP_064671292.1|2300026_2300845_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_070548858.1|2301013_2302372_+|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.7	5.8e-25
WP_015715747.1|2302889_2303861_-	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.0	1.9e-62
WP_128740276.1|2303872_2306041_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_160240597.1|2306048_2306213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015252261.1|2306258_2307209_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_128740275.1|2307597_2308914_+	serine/threonine exchanger	NA	NA	NA	NA	NA
WP_003218470.1|2309189_2309807_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_070548855.1|2309819_2310821_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_003244695.1|2310930_2311677_+	toxin-antitoxin-antitoxin system toxin SpoIISA	NA	NA	NA	NA	NA
WP_003232646.1|2311676_2311847_+	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
WP_003232648.1|2311932_2312070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021479459.1|2312107_2313001_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.7	1.8e-83
WP_003232653.1|2313013_2313277_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	4.7e-24
WP_072174140.1|2313289_2313559_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	68.2	6.7e-26
WP_080375511.1|2313630_2313822_-|portal	phage portal protein	portal	A0A2H4JAA1	uncultured_Caudovirales_phage	61.3	8.9e-17
WP_072174134.1|2313811_2314273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072174135.1|2314290_2315766_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	41.0	2.4e-40
WP_003232665.1|2315768_2316041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072174136.1|2316037_2316616_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	32.4	5.7e-14
WP_021479465.1|2316599_2317646_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	3.7e-72
WP_069703540.1|2317638_2318064_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.9e-12
WP_003244812.1|2318121_2318388_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_128740274.1|2318387_2319365_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.9	7.8e-40
WP_128740273.1|2319380_2320040_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	2.8e-25
WP_128740272.1|2320032_2323914_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	43.8	5.6e-41
WP_003239113.1|2323915_2324065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232676.1|2324094_2324541_-	phage-like element PBSX protein XkdN	NA	A0A249XXA9	Clostridium_phage	33.6	7.5e-14
WP_003232677.1|2324632_2325076_-	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_032725521.1|2325077_2326478_-|portal	phage portal protein	portal	A0A0A7S087	Clostridium_phage	39.3	1.4e-77
WP_014113480.1|2326474_2326693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232680.1|2326696_2327137_-	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
WP_032725517.1|2327149_2327635_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	8.0e-38
WP_032725516.1|2327631_2327988_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_021479474.1|2327984_2328368_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	41.1	3.7e-14
WP_003232690.1|2328389_2329325_-	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_003245836.1|2329350_2330178_-	phage-like element PBSX protein XkdF	NA	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
WP_032725514.1|2330197_2331685_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_003232697.1|2331688_2332990_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
WP_072175745.1|2332986_2333784_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	50.6	2.1e-59
WP_101502029.1|2333901_2334411_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.0	1.1e-21
WP_014476537.1|2334526_2334733_-	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	2.1e-11
WP_021479479.1|2334729_2335080_-	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_003245588.1|2335164_2335332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010886492.1|2335331_2336132_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
WP_003245799.1|2336031_2336868_-	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	28.2	1.8e-24
WP_003232712.1|2336854_2337034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232719.1|2337212_2337554_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232721.1|2337716_2338313_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003245071.1|2338356_2339193_-	manganese catalase	NA	NA	NA	NA	NA
WP_128740271.1|2339269_2339872_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	48.7	1.1e-44
WP_124059756.1|2339977_2340355_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	43.3	1.6e-17
WP_041850941.1|2340394_2341348_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
WP_003232731.1|2341468_2341726_+	YciI family protein	NA	NA	NA	NA	NA
WP_003245487.1|2341756_2341891_-	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_015252291.1|2341880_2343017_-	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
WP_003232739.1|2343161_2344433_-	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
>prophage 10
NZ_CP028213	Bacillus subtilis strain SRCM102749 chromosome, complete genome	4192708	2380662	2453752	4192708	terminase,capsid,tRNA,holin,coat,head,tail,portal,integrase	Bacillus_phage(37.14%)	92	2387443:2387459	2451321:2451337
WP_072174191.1|2380662_2381142_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_128740261.1|2381370_2381766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740260.1|2381984_2382491_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_128740917.1|2382536_2383019_-	YjdF family protein	NA	NA	NA	NA	NA
WP_014479507.1|2383187_2384135_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_128740259.1|2384149_2386102_-	PTS mannose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_128740258.1|2386248_2388195_-	mannose transport/utilization transcriptional regulator ManR	NA	NA	NA	NA	NA
2387443:2387459	attL	TTCTTTCTTCTTTTTTA	NA	NA	NA	NA
WP_003232839.1|2388755_2389103_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_128740256.1|2389262_2390018_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_072692634.1|2390258_2390576_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_029317635.1|2391993_2392374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740255.1|2392571_2392769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740254.1|2392790_2393231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740253.1|2393509_2395288_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	56.7	4.2e-124
WP_003232847.1|2395299_2395692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232848.1|2395725_2396034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740252.1|2396754_2398779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740916.1|2398831_2399326_-	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	42.8	1.3e-27
WP_128740251.1|2399706_2401518_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	61.3	8.6e-125
WP_128740250.1|2401528_2401870_+|tRNA	tRNA-Val4	tRNA	NA	NA	NA	NA
WP_128740249.1|2401907_2402729_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	72.7	5.0e-64
WP_103803604.1|2402773_2403196_-|holin	holin family protein	holin	D6R405	Bacillus_phage	84.2	2.8e-55
WP_128740248.1|2403248_2403506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740247.1|2403516_2403687_-	XkdX family protein	NA	NA	NA	NA	NA
WP_128740246.1|2403815_2404217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740245.1|2404230_2407560_-	hypothetical protein	NA	Q5YA57	Bacillus_phage	47.0	3.7e-134
WP_128740244.1|2407572_2408337_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_128740243.1|2408333_2413049_-	hypothetical protein	NA	A0A1W6JQL3	Staphylococcus_phage	27.6	6.9e-33
WP_033884333.1|2413053_2413362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041055257.1|2413409_2413922_-	phage protein	NA	NA	NA	NA	NA
WP_128740242.1|2413976_2414216_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_128740241.1|2414235_2414451_-	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	74.2	1.3e-19
WP_128740240.1|2414491_2415016_-|tail	phage major tail protein, TP901-1 family	tail	Q0PDK9	Bacillus_phage	42.2	1.8e-27
WP_038428481.1|2415029_2415428_-	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	45.4	3.8e-25
WP_128740239.1|2415446_2415863_-	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	53.7	5.1e-33
WP_041055272.1|2415849_2416194_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_128740238.1|2416190_2416490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740237.1|2416498_2416750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740236.1|2416751_2417087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114523738.1|2417091_2418009_-|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	68.3	1.8e-115
WP_061187155.1|2418022_2418604_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	56.8	6.7e-55
WP_116315371.1|2418701_2418941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740235.1|2419344_2420268_-|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	45.5	5.8e-69
WP_128740234.1|2420254_2421658_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.8	3.0e-154
WP_063336234.1|2421654_2422929_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	63.1	6.0e-157
WP_128740233.1|2422928_2423636_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	64.8	7.8e-66
WP_085186896.1|2423806_2424685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041055798.1|2424755_2424974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041055801.1|2425111_2425324_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	48.6	7.3e-12
WP_041351378.1|2425856_2426372_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	42.0	1.4e-27
WP_085186894.1|2426731_2426932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010330964.1|2427210_2427459_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	43.6	5.4e-06
WP_128740232.1|2427455_2427686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095252456.1|2427682_2428006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041345368.1|2428076_2428283_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	1.6e-19
WP_128740231.1|2428650_2429109_-	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	80.0	2.1e-59
WP_041345236.1|2429095_2429395_-	hypothetical protein	NA	A0A2H4J4P5	uncultured_Caudovirales_phage	69.9	7.7e-31
WP_128740230.1|2429628_2430576_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.8e-57
WP_041344345.1|2430460_2431159_-	DNA-binding protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	42.6	7.0e-43
WP_128740915.1|2431354_2432092_-	hypothetical protein	NA	A0A0A7RUC1	Clostridium_phage	47.7	7.4e-59
WP_041850207.1|2432111_2433029_-	hypothetical protein	NA	A0A0A7RUE9	Clostridium_phage	62.8	9.4e-88
WP_128740229.1|2433025_2433217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044445046.1|2433317_2433512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015715352.1|2433641_2433899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740228.1|2433895_2434465_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	51.1	1.5e-54
WP_128740227.1|2434608_2435376_-	phage antirepressor KilAC domain-containing protein	NA	A0A290FZK7	Caldibacillus_phage	58.6	5.5e-73
WP_010329848.1|2435440_2435632_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_061188385.1|2435643_2435895_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_128740226.1|2436068_2436449_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	55.4	4.2e-26
WP_044445041.1|2436779_2437301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041057293.1|2437312_2437660_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	69.1	6.6e-18
WP_128740225.1|2437731_2438226_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	68.6	9.0e-61
WP_128740224.1|2438228_2439440_+|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	46.2	1.1e-96
WP_032725419.1|2439799_2440990_+	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_003232852.1|2441059_2441605_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014479474.1|2441637_2442810_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_003232857.1|2442802_2443924_-	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	3.7e-17
WP_101502001.1|2444279_2445002_+	esterase family protein	NA	NA	NA	NA	NA
WP_003232861.1|2445038_2445554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245407.1|2445557_2445980_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003232866.1|2446055_2446310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740223.1|2446426_2448706_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.9	7.8e-91
WP_003232870.1|2448779_2449034_-	sporulation-specific transcription regulator SopVIF	NA	NA	NA	NA	NA
WP_003232872.1|2449166_2449316_-	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_003244769.1|2449397_2449604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014476457.1|2449885_2450242_-	sporulation protein YjcA	NA	NA	NA	NA	NA
WP_041850969.1|2450401_2450788_+|coat	spore coat protein CotV	coat	NA	NA	NA	NA
WP_041850970.1|2450828_2451158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014476454.1|2451246_2451762_+|coat	spore coat protein	coat	NA	NA	NA	NA
2451321:2451337	attR	TAAAAAAGAAGAAAGAA	NA	NA	NA	NA
WP_003239243.1|2451912_2452401_+|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_128740222.1|2452528_2452975_+|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_128740221.1|2453068_2453752_-|coat	spore coat protein CotO	coat	NA	NA	NA	NA
>prophage 11
NZ_CP028213	Bacillus subtilis strain SRCM102749 chromosome, complete genome	4192708	3012520	3020885	4192708		Synechococcus_phage(50.0%)	8	NA	NA
WP_015252651.1|3012520_3013108_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
WP_003233945.1|3013104_3014145_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	2.8e-64
WP_046160143.1|3014246_3015677_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.1	2.0e-52
WP_128740084.1|3015652_3017881_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.0	1.1e-158
WP_003243954.1|3017864_3018548_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003219409.1|3018544_3018799_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_077671603.1|3018791_3019517_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
WP_014476028.1|3019589_3020885_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.4	1.7e-18
>prophage 12
NZ_CP028213	Bacillus subtilis strain SRCM102749 chromosome, complete genome	4192708	3945037	4001083	4192708	lysis,tRNA,holin,coat,protease	Bacillus_phage(42.86%)	57	NA	NA
WP_080286163.1|3945037_3946279_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_019712840.1|3946529_3947045_-	tyrZ transcriptional regulator YwaE	NA	NA	NA	NA	NA
WP_128740832.1|3947194_3947908_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_128740831.1|3948018_3948879_+	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.2	2.9e-06
WP_003227349.1|3948927_3949770_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003243800.1|3949823_3951203_-	SacY negative regulator SacX	NA	NA	NA	NA	NA
WP_128740830.1|3951630_3953568_-|protease	minor protease Epr	protease	A0A1B0T6A2	Bacillus_phage	35.4	7.7e-47
WP_128740829.1|3953795_3955130_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_128740828.1|3955208_3955886_+	DUF2711 domain-containing protein	NA	NA	NA	NA	NA
WP_064671794.1|3955923_3956304_-	glyoxalase GlxA	NA	NA	NA	NA	NA
WP_128740827.1|3956424_3957612_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.4	4.5e-74
WP_085185458.1|3957644_3957842_-	YwbE family protein	NA	NA	NA	NA	NA
WP_103803649.1|3957875_3959078_-	MFS transporter	NA	NA	NA	NA	NA
WP_014478359.1|3959180_3959858_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_003227375.1|3959839_3960226_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003227377.1|3960331_3961237_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003244274.1|3961244_3962063_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_128740826.1|3962059_3962728_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_128740825.1|3962884_3964330_+	ferrous ion permease EfeU	NA	NA	NA	NA	NA
WP_128740824.1|3964326_3965484_+	iron uptake system lipoprotein EfeM	NA	NA	NA	NA	NA
WP_128740823.1|3965502_3966753_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_021480940.1|3967035_3967656_+	DsbA family protein	NA	NA	NA	NA	NA
WP_128740822.1|3967668_3969210_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_038429826.1|3969206_3969515_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_003243648.1|3969957_3970116_-	transcriptional regulator SlrA	NA	NA	NA	NA	NA
WP_014478350.1|3970470_3971142_+	transcriptional regulator SlrC	NA	NA	NA	NA	NA
WP_003227398.1|3971159_3971543_+	GtrA family protein	NA	NA	NA	NA	NA
WP_128740821.1|3971623_3972796_+	galactokinase	NA	NA	NA	NA	NA
WP_103803655.1|3972799_3974341_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_009968363.1|3974411_3974657_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_010886637.1|3975172_3976138_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003227407.1|3976165_3978115_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003227409.1|3978128_3978743_+	Quinol oxidase subunit 3	NA	NA	NA	NA	NA
WP_003227410.1|3978744_3979119_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003227411.1|3979161_3979425_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_003227413.1|3979920_3981102_+	cell shape-determining peptidoglycan glycosyltransferase RodA	NA	NA	NA	NA	NA
WP_017696211.1|3981207_3981957_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_128740820.1|3982130_3983132_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_128740819.1|3983169_3985590_-|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	36.8	6.9e-21
WP_003222155.1|3986119_3986422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086344457.1|3986461_3987292_+	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003243563.1|3987330_3988101_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_029318665.1|3988402_3989788_+	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_128740818.1|3989784_3991224_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	26.1	9.1e-21
WP_003243437.1|3991317_3991566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014665830.1|3991655_3992471_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003227432.1|3992614_3992953_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227434.1|3992945_3993581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009968358.1|3993628_3994162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481257.1|3994251_3995058_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015384978.1|3995071_3995749_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	1.8e-48
WP_064671810.1|3995773_3997144_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014481255.1|3997311_3997629_+	YwdI family protein	NA	NA	NA	NA	NA
WP_015384975.1|3997648_3998971_+	purine permease	NA	NA	NA	NA	NA
WP_003227446.1|3999032_3999404_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_014481253.1|3999447_3999993_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_029946239.1|4000312_4001083_+|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
>prophage 13
NZ_CP028213	Bacillus subtilis strain SRCM102749 chromosome, complete genome	4192708	4004571	4061377	4192708	bacteriocin,protease,coat,tRNA	Enterobacteria_phage(20.0%)	57	NA	NA
WP_101502529.1|4004571_4005693_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_128740816.1|4005685_4006408_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_032725145.1|4006410_4007430_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_017696230.1|4007454_4008195_+	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	42.0	7.7e-48
WP_072173258.1|4008194_4009142_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	9.8e-72
WP_072176302.1|4009155_4010004_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	4.8e-38
WP_128740815.1|4010000_4010456_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014478326.1|4010779_4011244_+	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_003227482.1|4011420_4012695_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_072173260.1|4012920_4014468_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_072173261.1|4014541_4016242_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_021480909.1|4016241_4017654_+	amino acid permease	NA	NA	NA	NA	NA
WP_070548000.1|4017863_4019102_+	MFS transporter	NA	NA	NA	NA	NA
WP_009968341.1|4019253_4019868_+	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_003244300.1|4019857_4020565_+	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_003243359.1|4020567_4021329_+	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
WP_003242921.1|4021347_4022766_+	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_019712823.1|4022762_4023947_+	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_128740814.1|4023947_4025147_+	transaminase BacF	NA	NA	NA	NA	NA
WP_015714908.1|4025161_4025941_-	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_003242896.1|4026073_4026838_-	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_003235941.1|4027107_4028079_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_014481233.1|4028224_4029124_+	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_021480904.1|4029172_4030018_+	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_072173266.1|4030185_4031076_+	DMT family transporter	NA	NA	NA	NA	NA
WP_064671822.1|4031219_4031996_-	prespore-specific transcription regulator RsfA	NA	NA	NA	NA	NA
WP_003222050.1|4032211_4032436_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_064671823.1|4032597_4033899_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003227524.1|4033934_4034435_+	YwgA family protein	NA	NA	NA	NA	NA
WP_128740813.1|4034546_4035017_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_064671824.1|4035016_4036417_+	MFS transporter	NA	NA	NA	NA	NA
WP_064671453.1|4037261_4039178_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	42.5	1.1e-141
WP_003242889.1|4039297_4039717_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003222038.1|4039759_4039948_-	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003243167.1|4040056_4040716_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003244446.1|4040729_4041248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740812.1|4041846_4043922_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003227543.1|4044123_4044954_+	spermidine synthase	NA	NA	NA	NA	NA
WP_003227545.1|4045014_4045887_+	agmatinase	NA	NA	NA	NA	NA
WP_128740811.1|4045935_4046496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714896.1|4046488_4047136_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.0	7.7e-28
WP_021480845.1|4047138_4047945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021480844.1|4047945_4048620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714893.1|4048606_4049395_-	membrane protein	NA	NA	NA	NA	NA
WP_015714892.1|4049543_4050023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009968329.1|4050273_4050393_-	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_029318693.1|4050376_4051522_-	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.0	1.4e-77
WP_015250986.1|4051751_4053107_+	YncE family protein	NA	NA	NA	NA	NA
WP_128740810.1|4053145_4054522_+	YncE family protein	NA	NA	NA	NA	NA
WP_128740809.1|4054527_4055229_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_128740808.1|4055225_4056506_-	insulinase family protein	NA	NA	NA	NA	NA
WP_072175642.1|4056510_4057671_-	insulinase family protein	NA	NA	NA	NA	NA
WP_128740807.1|4057660_4058971_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_003227564.1|4058963_4059683_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	7.3e-19
WP_003222006.1|4059679_4059841_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_124047850.1|4059853_4061200_-	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_010886632.1|4061224_4061377_-|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
