The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028212	Bacillus subtilis strain SRCM102748 chromosome, complete genome	4210797	73833	111972	4210797	terminase,holin,plate,tail,portal	uncultured_Caudovirales_phage(30.3%)	55	NA	NA
WP_004398704.1|73833_74184_-	transcriptional regulator SknR	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	30.6	2.0e-06
WP_004398958.1|74360_74591_+	helix-turn-helix transcriptional regulator	NA	A8ATK0	Listeria_phage	53.4	1.1e-08
WP_003229902.1|74620_74761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398626.1|74834_75404_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	1.5e-64
WP_003245994.1|75400_75658_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	6.4e-10
WP_119123069.1|75654_75828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229905.1|75787_75982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398673.1|76087_77047_+	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	72.9	2.2e-135
WP_003229907.1|77049_77904_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	79.0	7.1e-122
WP_116362964.1|77979_78657_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	31.8	1.1e-05
WP_075058863.1|78538_79480_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	8.0e-58
WP_003229910.1|79470_79620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967809.1|79715_80144_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.7	5.6e-43
WP_003229912.1|80225_80432_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	71.6	5.5e-20
WP_003229913.1|80505_81435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398775.1|81632_82088_+	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	74.8	2.4e-60
WP_004398685.1|82231_82696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048655095.1|82763_83483_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	58.0	6.7e-57
WP_015714325.1|83475_84771_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.2	8.7e-156
WP_015714324.1|84774_86307_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.5	1.4e-147
WP_004398748.1|86303_87221_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.1	2.4e-51
WP_003229920.1|87261_87915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229921.1|87947_88916_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.3	7.4e-59
WP_003229922.1|88934_89870_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	65.0	8.6e-105
WP_003229923.1|89880_90192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398566.1|90195_90591_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_003229925.1|90587_90950_+	YqbH/XkdH family protein	NA	A0A249XXE9	Clostridium_phage	39.3	6.9e-10
WP_003246050.1|90946_91450_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.9	8.3e-38
WP_003229927.1|91462_91900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010886574.1|91896_92088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229929.1|92088_93489_+|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	39.1	4.1e-74
WP_003229930.1|93491_93935_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.4	3.2e-25
WP_075058862.1|94188_94278_-	type I toxin-antitoxin system toxin BsrH	NA	NA	NA	NA	NA
WP_004398662.1|94649_94829_-	type I toxin-antitoxin system toxin TxpA	NA	NA	NA	NA	NA
WP_032722171.1|94974_95424_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	41.1	2.7e-11
WP_021480099.1|95465_95603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032722170.1|95605_100363_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	1.8e-44
WP_032722169.1|100355_101015_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	2.1e-25
WP_032722168.1|101027_102008_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	1.6e-40
WP_032722167.1|102004_102271_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_032722166.1|102283_102709_+	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	33.3	5.6e-11
WP_032722165.1|102701_103748_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	4.8e-72
WP_032722164.1|103731_104310_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	1.9e-14
WP_032722163.1|104306_104579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032722161.1|104582_105683_+	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
WP_009967793.1|105692_106028_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003229944.1|106024_106189_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	2.7e-14
WP_032722160.1|106276_107170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017697460.1|107215_107638_+|holin	holin family protein	holin	D6R405	Bacillus_phage	72.9	1.7e-47
WP_017697459.1|107682_108501_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	73.8	3.8e-64
WP_004399085.1|108665_109145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229947.1|109160_109523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967791.1|109519_109666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967790.1|109783_110362_-	type II toxin-antitoxin system antitoxin YqcF	NA	NA	NA	NA	NA
WP_004399034.1|110376_111972_-	type II toxin-antitoxin system toxin ribonuclease YqcG	NA	A0A1P8CWI7	Bacillus_phage	61.3	6.9e-78
>prophage 2
NZ_CP028212	Bacillus subtilis strain SRCM102748 chromosome, complete genome	4210797	341706	347802	4210797		Staphylococcus_phage(66.67%)	8	NA	NA
WP_032722052.1|341706_342792_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	6.6e-56
WP_004398505.1|342802_343450_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	5.0e-43
WP_003230496.1|343464_344661_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	5.3e-115
WP_003223915.1|344693_345158_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_003223910.1|345270_345645_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_032722049.1|345658_346183_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003246108.1|346463_347219_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_003223904.1|347208_347802_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
>prophage 3
NZ_CP028212	Bacillus subtilis strain SRCM102748 chromosome, complete genome	4210797	489961	616393	4210797	integrase,holin	Bacillus_phage(95.95%)	179	555126:555147	578237:578258
WP_109962771.1|489961_490846_-	endonuclease YokF	NA	A0A1P8CWK6	Bacillus_phage	93.2	2.2e-110
WP_109962770.1|491360_491894_+	hypothetical protein	NA	A0A1P8CWM2	Bacillus_phage	96.3	2.8e-07
WP_109962769.1|492026_493913_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	82.1	1.6e-161
WP_109962768.1|493925_494384_+	SMI1 / KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	83.6	1.5e-70
WP_009967548.1|494475_494592_-	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	100.0	9.8e-11
WP_041338710.1|494852_495212_+	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	100.0	3.5e-62
WP_041054825.1|495255_495591_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	100.0	4.2e-54
WP_114168637.1|495764_496097_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	98.2	1.4e-54
WP_114168635.1|496089_497340_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	95.9	9.4e-232
WP_019712878.1|497380_497557_-	hypothetical protein	NA	A0A1P8CWP3	Bacillus_phage	98.3	6.9e-24
WP_114168633.1|497546_498683_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	98.7	8.9e-213
WP_114168631.1|498809_499061_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	92.8	4.3e-35
WP_010328137.1|499081_499474_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	99.2	2.9e-62
WP_114168629.1|499589_500693_-	N-acetylmuramoyl-L-alanine amidase BlyA	NA	A0A1P8CWN6	Bacillus_phage	94.8	2.0e-177
WP_114168627.1|501327_503262_-	hypothetical protein	NA	A0A1P8CWN9	Bacillus_phage	99.8	0.0e+00
WP_026009860.1|503298_504120_-	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	99.3	3.5e-134
WP_114168625.1|504135_506778_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	96.0	0.0e+00
WP_032721609.1|506790_507552_-	hypothetical protein	NA	A0A1P8CWP8	Bacillus_phage	96.6	1.6e-128
WP_114168623.1|507595_514492_-	transglycosylase CwlP	NA	A0A1P8CWQ1	Bacillus_phage	70.2	0.0e+00
WP_003246141.1|514545_515229_-	hypothetical protein	NA	Q37974	Bacillus_phage	100.0	2.1e-116
WP_009967530.1|515310_515757_-	hypothetical protein	NA	O64047	Bacillus_phage	100.0	8.1e-77
WP_009966645.1|516102_516279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967529.1|516303_516990_+	hypothetical protein	NA	O64048	Bacillus_phage	100.0	2.2e-126
WP_072183687.1|517117_518125_-|integrase	site-specific integrase	integrase	A0A0H3V0P2	Geobacillus_virus	65.7	9.9e-123
WP_114168683.1|518138_518558_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	78.3	3.7e-55
WP_114168621.1|518557_519046_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	72.4	3.5e-57
WP_114168619.1|519097_519289_-	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	98.4	1.3e-28
WP_017696884.1|519285_519636_-	hypothetical protein	NA	O64053	Bacillus_phage	97.4	3.9e-58
WP_114168617.1|519646_520864_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	98.3	1.1e-168
WP_114168615.1|520865_521222_-	hypothetical protein	NA	O64055	Bacillus_phage	99.2	2.3e-58
WP_009967521.1|521285_521513_-	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	100.0	6.4e-38
WP_010886547.1|521512_522124_-	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	100.0	3.3e-65
WP_004399252.1|522141_522939_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	100.0	2.1e-91
WP_003230954.1|522981_523692_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	100.0	1.8e-131
WP_019712889.1|523688_524195_-	hypothetical protein	NA	O64060	Bacillus_phage	99.4	2.9e-91
WP_003230958.1|524191_524842_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	100.0	3.2e-122
WP_009967519.1|524825_525080_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	100.0	2.2e-39
WP_004399452.1|525076_525472_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	100.0	2.5e-69
WP_019712890.1|525486_525957_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	99.4	1.1e-81
WP_003230962.1|525992_527009_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	99.4	6.4e-186
WP_019712260.1|527047_527584_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	98.9	3.0e-94
WP_160214967.1|527608_529045_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	98.7	4.8e-264
WP_019712262.1|529075_530596_-	hypothetical protein	NA	O64068	Bacillus_phage	99.0	2.3e-280
WP_003230970.1|530613_532383_-	hypothetical protein	NA	O64069	Bacillus_phage	99.8	0.0e+00
WP_019712263.1|532369_533290_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	99.7	2.1e-175
WP_019712264.1|533392_533917_-	hypothetical protein	NA	U5J9P3	Bacillus_phage	38.4	5.7e-21
WP_160214968.1|533954_534284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019712266.1|534320_534776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128472250.1|534801_535989_-	metallophosphoesterase	NA	W5RV85	Staphylococcus_phage	41.3	1.5e-69
WP_003230977.1|536000_536201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128472249.1|537146_537317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399274.1|537886_538165_-	HU-related DNA-binding protein HupN	NA	A0A1P8CWT5	Bacillus_phage	76.9	1.2e-30
WP_019712270.1|538408_540928_-	hypothetical protein	NA	O64076	Bacillus_phage	99.8	0.0e+00
WP_003230986.1|540967_541162_-	hypothetical protein	NA	O64077	Bacillus_phage	98.4	7.9e-29
WP_017696861.1|542190_542367_+	hypothetical protein	NA	O64080	Bacillus_phage	92.3	4.4e-10
WP_080010576.1|542385_542637_+	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	95.8	9.3e-30
WP_003230987.1|542681_542870_+	hypothetical protein	NA	O64081	Bacillus_phage	96.8	9.7e-24
WP_160214969.1|542985_543831_+	GIY-YIG nuclease family protein	NA	A0A076G735	Bacillus_phage	40.7	4.3e-10
WP_061891096.1|543849_545067_+	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	82.9	5.4e-200
WP_061891097.1|545385_545892_+	hypothetical protein	NA	O64083	Bacillus_phage	96.4	3.9e-67
WP_061891098.1|546036_546489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061891099.1|546485_546707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019712272.1|546744_546999_+	hypothetical protein	NA	A0A088C4P6	Shewanella_sp._phage	44.2	4.1e-09
WP_019712273.1|547046_547322_+	hypothetical protein	NA	A0A1P8CWV2	Bacillus_phage	92.3	1.1e-39
WP_019712274.1|547347_547551_+	hypothetical protein	NA	A0A1P8CWV4	Bacillus_phage	97.0	1.5e-30
WP_157173890.1|547682_547949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019712277.1|548158_548395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019712278.1|548409_548655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003230992.1|548687_549014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019712279.1|549116_549284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019712280.1|549366_549699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032721663.1|549772_549994_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	98.6	1.9e-34
WP_019712282.1|550066_550300_+	hypothetical protein	NA	A0A1P8CWU8	Bacillus_phage	100.0	6.6e-38
WP_160214970.1|550624_551254_+	hypothetical protein	NA	A0A1P8CWV5	Bacillus_phage	49.8	3.1e-50
WP_160214971.1|551299_551479_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	96.6	3.6e-28
WP_160214972.1|551549_551801_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	92.8	8.1e-34
WP_160214973.1|551804_552020_+	hypothetical protein	NA	O64089	Bacillus_phage	85.9	1.8e-26
WP_160214974.1|552030_552165_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	90.7	2.8e-17
WP_160215024.1|552330_552864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160214975.1|552940_553357_+	hypothetical protein	NA	O64093	Bacillus_phage	95.7	1.4e-67
WP_019712293.1|553533_554694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967508.1|554707_554833_+	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
555126:555147	attL	AAAGATAAAAAATATGTATATA	NA	NA	NA	NA
WP_019712294.1|555160_555361_+	hypothetical protein	NA	O64096	Bacillus_phage	98.5	3.4e-27
WP_114168596.1|555363_555681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019712296.1|555729_555942_+	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	95.7	1.6e-27
WP_019712297.1|555931_557008_+|integrase	site-specific integrase	integrase	O64099	Bacillus_phage	99.7	2.0e-198
WP_114168594.1|557114_558497_+	hypothetical protein	NA	O64100	Bacillus_phage	99.3	3.7e-261
WP_019712299.1|558520_559498_+	hypothetical protein	NA	O64101	Bacillus_phage	99.4	8.8e-177
WP_004399410.1|559686_559911_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	100.0	1.9e-34
WP_017697044.1|560093_560312_+	YopT family protein	NA	O64103	Bacillus_phage	98.6	2.5e-31
WP_017697045.1|560381_560579_+	hypothetical protein	NA	O64104	Bacillus_phage	98.5	6.8e-28
WP_003231036.1|560690_560885_+	hypothetical protein	NA	O64105	Bacillus_phage	100.0	1.9e-27
WP_114168679.1|561106_561475_+	hypothetical protein	NA	A0A024B0P0	Bacillus_phage	61.3	5.9e-17
WP_114168592.1|561471_561876_+	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	40.3	7.2e-16
WP_114168677.1|561862_562072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114168590.1|562038_562416_+	hypothetical protein	NA	A0A1P8CWX8	Bacillus_phage	84.7	1.0e-48
WP_114168588.1|562412_562610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004399389.1|562683_563439_+	SPBc2 prophage-derived antirepressor protein YoqD	NA	A0A1P8CWY0	Bacillus_phage	100.0	1.1e-137
WP_072692923.1|563526_563973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160214976.1|564004_564643_+	DUF3920 family protein	NA	NA	NA	NA	NA
WP_160214977.1|564692_565145_+	hypothetical protein	NA	O64117	Bacillus_phage	88.0	5.7e-70
WP_160214978.1|565193_565388_+	hypothetical protein	NA	O64118	Bacillus_phage	96.3	5.0e-23
WP_134982136.1|565428_565671_+	hypothetical protein	NA	A0A1P8CWY6	Bacillus_phage	95.0	5.8e-37
WP_160215025.1|565709_566363_+	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	93.5	6.2e-118
WP_160215026.1|566382_566586_+	hypothetical protein	NA	O64120	Bacillus_phage	95.5	6.1e-32
WP_160215027.1|566625_567318_+	HNH endonuclease	NA	O64121	Bacillus_phage	97.4	5.7e-130
WP_004399461.1|567465_567684_+	hypothetical protein	NA	O64123	Bacillus_phage	100.0	2.7e-33
WP_009967489.1|567700_568075_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	100.0	3.4e-60
WP_003231051.1|568188_568479_+	hypothetical protein	NA	A0A1P8CWY9	Bacillus_phage	100.0	4.2e-50
WP_160214979.1|568565_568718_-	hypothetical protein	NA	A0A1P8CWZ1	Bacillus_phage	92.0	5.8e-19
WP_160214980.1|568863_569700_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	73.3	6.1e-110
WP_160214981.1|570341_571154_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	95.2	3.8e-149
WP_120028220.1|571223_571898_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	98.6	1.0e-78
WP_160214982.1|571968_572190_+	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	94.5	4.6e-33
WP_160214983.1|572238_573126_+	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	95.3	1.9e-162
WP_160214984.1|573115_573388_+	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	95.6	2.7e-43
WP_160214985.1|573568_574039_+	hypothetical protein	NA	D9J0I1	Brochothrix_phage	36.3	2.7e-14
WP_017697067.1|574075_574471_+	hypothetical protein	NA	O64133	Bacillus_phage	94.7	7.9e-68
WP_019712318.1|574569_575394_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	93.1	1.4e-138
WP_019712319.1|575390_577151_+	hypothetical protein	NA	O64135	Bacillus_phage	98.3	0.0e+00
WP_019712320.1|577238_577535_+	hypothetical protein	NA	O64136	Bacillus_phage	99.0	3.1e-48
WP_019712321.1|577597_577978_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	96.0	1.2e-65
WP_072692915.1|578292_578664_+	hypothetical protein	NA	O64139	Bacillus_phage	95.1	3.6e-62
578237:578258	attR	AAAGATAAAAAATATGTATATA	NA	NA	NA	NA
WP_114168567.1|578685_579600_+	hypothetical protein	NA	O64140	Bacillus_phage	89.5	4.7e-156
WP_004399537.1|579682_580654_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	100.0	1.7e-180
WP_042976136.1|580696_581167_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	98.7	1.5e-86
WP_114168565.1|581181_582696_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	99.4	2.3e-285
WP_009967477.1|582711_583848_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	100.0	1.2e-225
WP_114168563.1|583847_585578_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	98.4	0.0e+00
WP_114168561.1|585590_589508_+	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	96.5	0.0e+00
WP_114168675.1|589536_590253_+	3D domain-containing protein	NA	O64147	Bacillus_phage	85.3	7.6e-109
WP_069322668.1|590370_590520_+	hypothetical protein	NA	O64148	Bacillus_phage	98.0	2.0e-19
WP_041336515.1|590554_590752_+	hypothetical protein	NA	O64149	Bacillus_phage	96.9	2.1e-29
WP_019712328.1|590784_591000_+	YorP family protein	NA	O64150	Bacillus_phage	98.6	3.0e-37
WP_114168559.1|590992_591148_+	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	92.2	2.4e-20
WP_114168557.1|591147_591645_+	deoxynucleoside kinase	NA	A0A1P8CX28	Bacillus_phage	87.9	2.1e-78
WP_052475786.1|591934_592582_+	HNH endonuclease	NA	O64121	Bacillus_phage	40.5	7.0e-29
WP_114168555.1|592634_593954_+	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	63.1	4.6e-168
WP_017697085.1|593997_594216_+	hypothetical protein	NA	A0A1P8CX26	Bacillus_phage	98.6	1.2e-30
WP_114168552.1|594218_594584_+	hypothetical protein	NA	O64156	Bacillus_phage	97.5	2.1e-62
WP_041056330.1|594623_594851_+	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	100.0	2.7e-36
WP_080031102.1|594863_595046_+	hypothetical protein	NA	O64158	Bacillus_phage	95.0	2.2e-25
WP_041353154.1|595112_595325_+	hypothetical protein	NA	O64159	Bacillus_phage	91.4	1.1e-31
WP_087960928.1|595945_596266_+	hypothetical protein	NA	A0A1P8CX20	Bacillus_phage	99.1	2.5e-56
WP_128472236.1|596278_596701_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	80.0	9.4e-59
WP_032721796.1|596752_597082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470226.1|597115_597493_+	hypothetical protein	NA	A0A172JI43	Bacillus_phage	47.4	4.2e-18
WP_128472235.1|597499_597712_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	82.9	4.6e-30
WP_128472234.1|597725_597860_+	hypothetical protein	NA	O64168	Bacillus_phage	88.6	3.1e-16
WP_128472233.1|597879_598083_+	hypothetical protein	NA	O64169	Bacillus_phage	93.8	9.8e-30
WP_014471944.1|598130_598484_+	hypothetical protein	NA	A0A1P8CX44	Bacillus_phage	100.0	3.8e-61
WP_017697102.1|598483_598879_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	100.0	6.1e-68
WP_128472232.1|598805_599564_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	88.0	6.3e-106
WP_128472231.1|602228_602750_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	86.1	9.1e-80
WP_128472230.1|603330_603573_+	thioredoxin	NA	A0A1P8CX24	Bacillus_phage	97.5	1.5e-37
WP_003231121.1|603623_604052_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	92.3	8.9e-73
WP_003231123.1|604145_604760_-	VanZ family protein	NA	NA	NA	NA	NA
WP_019712224.1|605085_605379_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	88.7	6.1e-41
WP_026009818.1|605521_605863_+	hypothetical protein	NA	O64181	Bacillus_phage	99.1	3.3e-54
WP_003231129.1|605871_606477_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_109962702.1|606552_607392_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	96.4	2.9e-160
WP_032721841.1|607391_607913_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	44.1	5.2e-35
WP_059293307.1|608033_608303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109962700.1|608337_608691_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	62.4	2.5e-33
WP_109962699.1|608937_609126_+	hypothetical protein	NA	A0A1P8CX75	Bacillus_phage	100.0	1.2e-26
WP_042976081.1|609206_609419_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	100.0	4.1e-31
WP_032721857.1|609688_609994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160171068.1|610034_610184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032721859.1|610205_610622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160215028.1|610701_611034_+	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	61.4	4.0e-28
WP_160214986.1|611014_611563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129137703.1|611563_611737_+	hypothetical protein	NA	O64190	Bacillus_phage	86.0	3.5e-20
WP_129137702.1|611733_611913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129137701.1|611909_612125_+	hypothetical protein	NA	U5PU52	Bacillus_phage	65.2	2.2e-19
WP_109962698.1|612387_614448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109962790.1|614668_614854_+	hypothetical protein	NA	O64193	Bacillus_phage	96.6	3.3e-24
WP_026009816.1|614855_615098_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	97.5	2.1e-39
WP_114168541.1|615172_615763_+	hypothetical protein	NA	O64195	Bacillus_phage	94.9	7.9e-104
WP_160214987.1|615925_616393_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	37.6	4.1e-15
>prophage 4
NZ_CP028212	Bacillus subtilis strain SRCM102748 chromosome, complete genome	4210797	702623	708310	4210797	holin	Bacillus_phage(100.0%)	11	NA	NA
WP_009967409.1|702623_702959_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	86.5	7.2e-46
WP_003231333.1|703167_703461_+	YolD-like family protein	NA	O64030	Bacillus_phage	86.6	7.5e-39
WP_010886527.1|703453_703801_+	DNA repair protein YozK	NA	O64031	Bacillus_phage	95.7	1.5e-57
WP_003231337.1|703837_704491_+	DNA repair protein YobH	NA	O64031	Bacillus_phage	95.3	6.2e-118
WP_004399440.1|704616_704739_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003231340.1|704735_705851_-	response regulator aspartate phosphatase RapK	NA	D6R410	Bacillus_phage	49.2	1.5e-95
WP_075058859.1|706005_706170_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	92.6	3.9e-21
WP_010886526.1|706923_707184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231345.1|707308_707764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967407.1|707767_707992_-	hypothetical protein	NA	A0A1P8CWZ1	Bacillus_phage	82.0	8.9e-16
WP_003231348.1|708136_708310_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	82.5	5.6e-18
>prophage 5
NZ_CP028212	Bacillus subtilis strain SRCM102748 chromosome, complete genome	4210797	891582	898137	4210797		Bacillus_phage(50.0%)	6	NA	NA
WP_003231746.1|891582_892551_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_003244862.1|893174_893942_+	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	9.1e-52
WP_003245105.1|894005_894626_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_003231754.1|894675_895665_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_014479842.1|895682_897785_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231758.1|897744_898137_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
>prophage 6
NZ_CP028212	Bacillus subtilis strain SRCM102748 chromosome, complete genome	4210797	1407552	1452378	4210797	terminase,holin,plate,protease,portal	uncultured_Caudovirales_phage(28.57%)	57	NA	NA
WP_009967069.1|1407552_1408902_+|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.7	5.7e-25
WP_003232632.1|1409419_1410391_-	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.0	1.9e-62
WP_160214995.1|1410402_1412553_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_003244977.1|1412560_1412707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245086.1|1412807_1413758_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_003244819.1|1414146_1415463_+	serine/threonine exchanger	NA	NA	NA	NA	NA
WP_003218470.1|1415738_1416356_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_003232642.1|1416368_1417370_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_003244695.1|1417479_1418226_+	toxin-antitoxin-antitoxin system toxin SpoIISA	NA	NA	NA	NA	NA
WP_003232646.1|1418225_1418396_+	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
WP_003232648.1|1418481_1418619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245230.1|1418655_1419549_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.7	1.8e-83
WP_003232653.1|1419561_1419825_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	4.7e-24
WP_003232655.1|1419837_1420107_-	hypothetical protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	6.2e-24
WP_032721388.1|1420159_1420999_-	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_003232658.1|1421042_1421207_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	66.0	3.2e-15
WP_003232660.1|1421203_1421533_-	phage-like element PBSX protein XkdW	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	41.3	1.7e-15
WP_003244681.1|1421544_1423608_-	phage-like element PBSX protein XkdV	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	37.4	4.8e-31
WP_003232665.1|1423610_1423883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244743.1|1423879_1424458_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.0e-15
WP_003232669.1|1424441_1425488_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
WP_003232671.1|1425480_1425906_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	7.8e-13
WP_003244812.1|1425962_1426229_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_003245730.1|1426228_1427206_-	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_003232674.1|1427221_1427881_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	3.7e-25
WP_010886493.1|1427873_1431872_-	phage-like element PBSX protein XkdO	NA	A0A1L2JY60	Aeribacillus_phage	44.9	2.1e-43
WP_003239113.1|1431873_1432023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232676.1|1432052_1432499_-	phage-like element PBSX protein XkdN	NA	A0A249XXA9	Clostridium_phage	33.6	7.5e-14
WP_003232677.1|1432590_1433034_-	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003245369.1|1433035_1434436_-	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
WP_003232679.1|1434432_1434651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032721380.1|1434654_1435095_-	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
WP_003245226.1|1435107_1435593_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_009967053.1|1435589_1435946_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003245011.1|1435942_1436326_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.2	1.9e-13
WP_019712464.1|1436347_1437283_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	63.4	1.9e-104
WP_003232691.1|1437308_1438136_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
WP_019712463.1|1438155_1439643_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.0e-139
WP_019712462.1|1439646_1440948_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.5	1.1e-153
WP_019712461.1|1440944_1441742_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.0	2.7e-59
WP_019712460.1|1441856_1442366_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	2.9e-22
WP_032721378.1|1442481_1442688_-	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	51.6	1.6e-11
WP_021479479.1|1442684_1443035_-	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_003245588.1|1443119_1443287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080009791.1|1443286_1444087_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	3.8e-61
WP_019712458.1|1443986_1444823_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_019712457.1|1444809_1444989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232719.1|1445167_1445509_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_019712456.1|1445671_1446268_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003245071.1|1446303_1447140_-	manganese catalase	NA	NA	NA	NA	NA
WP_015252289.1|1447216_1447819_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.2	3.8e-45
WP_014476529.1|1447923_1448301_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	4.7e-17
WP_032721375.1|1448340_1449294_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	75.3	8.6e-68
WP_003232731.1|1449413_1449671_+	YciI family protein	NA	NA	NA	NA	NA
WP_003245487.1|1449701_1449836_-	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_015252291.1|1449825_1450962_-	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
WP_003245490.1|1451106_1452378_-	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
>prophage 7
NZ_CP028212	Bacillus subtilis strain SRCM102748 chromosome, complete genome	4210797	1485954	1520150	4210797	coat,tRNA	Bacillus_phage(66.67%)	42	NA	NA
WP_003245601.1|1485954_1486203_+|coat	spore coat protein CotT	coat	NA	NA	NA	NA
WP_010886488.1|1486325_1487315_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_003232822.1|1487934_1488264_+	YjdJ family protein	NA	NA	NA	NA	NA
WP_003232825.1|1488429_1488624_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_003244878.1|1488663_1489143_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_009967031.1|1489371_1489767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032721367.1|1489985_1490492_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015252318.1|1490537_1491020_-	YjdF family protein	NA	NA	NA	NA	NA
WP_032721363.1|1491188_1492136_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_032721362.1|1492150_1494103_-	PTS mannose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_032721360.1|1494252_1496199_-	mannose transport/utilization transcriptional regulator ManR	NA	NA	NA	NA	NA
WP_003232839.1|1496749_1497097_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_003245148.1|1497245_1498001_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_080010590.1|1498237_1498555_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003232842.1|1498987_1499179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015715692.1|1499682_1499883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014476481.1|1500011_1500527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128422176.1|1500767_1500971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232844.1|1501653_1502382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232845.1|1502435_1502672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032677399.1|1502945_1504724_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	56.3	1.2e-123
WP_003232847.1|1504735_1505128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232848.1|1505161_1505470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726265.1|1506204_1507395_+	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_003232852.1|1507464_1508010_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017695700.1|1508042_1509215_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_003232857.1|1509207_1510329_-	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	3.7e-17
WP_003232859.1|1510684_1511407_+	esterase family protein	NA	NA	NA	NA	NA
WP_003232861.1|1511443_1511959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232863.1|1511962_1512385_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003232866.1|1512457_1512712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032677401.1|1512828_1515108_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.9	7.8e-91
WP_003232870.1|1515181_1515436_-	sporulation-specific transcription regulator SopVIF	NA	NA	NA	NA	NA
WP_015252337.1|1515568_1515715_-	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_017695696.1|1515796_1516003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232879.1|1516284_1516641_-	sporulation protein YjcA	NA	NA	NA	NA	NA
WP_021479535.1|1516800_1517187_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015252340.1|1517226_1517550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015252341.1|1517644_1518157_+|coat	Spore coat protein X	coat	NA	NA	NA	NA
WP_014479465.1|1518308_1518797_+|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_029317620.1|1518924_1519374_+|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_080265338.1|1519466_1520150_-|coat	spore coat protein CotO	coat	NA	NA	NA	NA
>prophage 8
NZ_CP028212	Bacillus subtilis strain SRCM102748 chromosome, complete genome	4210797	2057467	2065833	4210797		Synechococcus_phage(50.0%)	8	NA	NA
WP_032722972.1|2057467_2058055_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	3.1e-28
WP_003233945.1|2058051_2059092_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	2.8e-64
WP_003233947.1|2059193_2060624_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_015715441.1|2060599_2062828_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	5.0e-159
WP_015715440.1|2062811_2063495_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003219409.1|2063491_2063746_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003233953.1|2063738_2064464_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
WP_014663060.1|2064537_2065833_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
>prophage 9
NZ_CP028212	Bacillus subtilis strain SRCM102748 chromosome, complete genome	4210797	2988625	3103475	4210797	holin,lysis,protease,coat,tRNA,bacteriocin	Bacillus_phage(23.53%)	111	NA	NA
WP_072692793.1|2988625_2989867_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_019712840.1|2990117_2990633_-	tyrZ transcriptional regulator YwaE	NA	NA	NA	NA	NA
WP_019712839.1|2990783_2991497_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_019712838.1|2991606_2992467_+	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.2	2.9e-06
WP_003227349.1|2992519_2993362_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003227351.1|2993415_2994795_-	SacY negative regulator SacX	NA	NA	NA	NA	NA
WP_019712837.1|2997390_2998722_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_019712836.1|2999863_3001156_+	DUF1668 domain-containing protein	NA	NA	NA	NA	NA
WP_003227362.1|3001405_3001786_-	glyoxalase GlxA	NA	NA	NA	NA	NA
WP_019712835.1|3001906_3003094_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.2	9.1e-75
WP_003227367.1|3003127_3003325_-	YwbE family protein	NA	NA	NA	NA	NA
WP_019712834.1|3003358_3004561_-	MFS transporter	NA	NA	NA	NA	NA
WP_003227371.1|3004664_3005342_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_003227375.1|3005323_3005710_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003227377.1|3005815_3006721_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015250932.1|3006728_3007547_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_029318655.1|3007543_3008212_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_029318656.1|3008368_3009814_+	ferrous ion permease EfeU	NA	NA	NA	NA	NA
WP_032722722.1|3009810_3010968_+	iron uptake system lipoprotein EfeM	NA	NA	NA	NA	NA
WP_029318658.1|3010986_3012237_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_003227388.1|3012325_3012928_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003227390.1|3012958_3014500_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_032722721.1|3014496_3014805_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_003243648.1|3015247_3015406_-	transcriptional regulator SlrA	NA	NA	NA	NA	NA
WP_003227396.1|3015761_3016433_+	transcriptional regulator SlrC	NA	NA	NA	NA	NA
WP_003227398.1|3016450_3016834_+	GtrA family protein	NA	NA	NA	NA	NA
WP_003227400.1|3016914_3018087_+	galactokinase	NA	NA	NA	NA	NA
WP_032722720.1|3018090_3019632_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_009968363.1|3019702_3019948_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_010886637.1|3020463_3021429_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003227407.1|3021456_3023406_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003227409.1|3023419_3024034_+	Quinol oxidase subunit 3	NA	NA	NA	NA	NA
WP_003227410.1|3024035_3024410_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003227411.1|3024452_3024716_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_015250943.1|3025210_3026392_+	cell shape-determining peptidoglycan glycosyltransferase RodA	NA	NA	NA	NA	NA
WP_017696211.1|3026497_3027247_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_032722719.1|3027420_3028422_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032722717.1|3028459_3030880_-|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	36.8	6.9e-21
WP_003222155.1|3031409_3031712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227423.1|3031751_3032582_+	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003243563.1|3032620_3033391_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003227426.1|3033692_3035078_+	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003227428.1|3035074_3036514_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	26.3	7.0e-21
WP_003243437.1|3036607_3036856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003242645.1|3036945_3037761_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_017696218.1|3037951_3038758_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015384978.1|3038771_3039449_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	1.8e-48
WP_032722715.1|3039473_3040844_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003243806.1|3041011_3041329_+	YwdI family protein	NA	NA	NA	NA	NA
WP_032722714.1|3041348_3042671_+	purine permease	NA	NA	NA	NA	NA
WP_003227446.1|3042732_3043104_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_014481253.1|3043147_3043693_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_015250957.1|3044012_3044783_+|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_032722713.1|3044787_3046212_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_003243878.1|3046232_3047402_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	26.6	5.5e-16
WP_003243179.1|3047402_3048272_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003243135.1|3048271_3049393_+|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_003243421.1|3049385_3050108_+|coat	spore coat polysaccharide biosynthesis protein SpsF	coat	NA	NA	NA	NA
WP_003244190.1|3050110_3051130_+|coat	spore coat polysaccharide biosynthesis protein SpsG	coat	NA	NA	NA	NA
WP_003243368.1|3051154_3051895_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	41.9	2.6e-48
WP_003244201.1|3051894_3052842_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_003242585.1|3052855_3053707_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.5	4.1e-37
WP_003242881.1|3053699_3054155_+|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_003242493.1|3054478_3054943_+	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_003227482.1|3055119_3056394_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003243454.1|3056620_3058168_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003227487.1|3058241_3059942_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003244348.1|3059941_3061354_+	amino acid permease	NA	NA	NA	NA	NA
WP_003242790.1|3061563_3062802_+	MFS transporter	NA	NA	NA	NA	NA
WP_009968341.1|3062953_3063568_+	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_003244300.1|3063557_3064265_+	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_003243359.1|3064267_3065029_+	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
WP_032722711.1|3065047_3066466_+	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_003227502.1|3066462_3067647_+	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_032722710.1|3067647_3068847_+	transaminase BacF	NA	NA	NA	NA	NA
WP_003227505.1|3068861_3069641_-	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_003242896.1|3069773_3070538_-	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_003243393.1|3070807_3071779_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_029726229.1|3071925_3072825_+	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003227511.1|3072873_3073719_+	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_029726230.1|3073886_3074777_+	DMT family transporter	NA	NA	NA	NA	NA
WP_029726231.1|3074920_3075697_-	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_003222050.1|3075911_3076136_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_014665786.1|3076297_3077599_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	5.5e-25
WP_003227524.1|3077634_3078135_+	YwgA family protein	NA	NA	NA	NA	NA
WP_003227526.1|3078246_3078717_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227528.1|3078716_3080117_+	MFS transporter	NA	NA	NA	NA	NA
WP_032676970.1|3080961_3082878_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.4	2.5e-143
WP_003227535.1|3082997_3083417_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003222038.1|3083459_3083648_-	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003227536.1|3083756_3084416_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003227538.1|3084429_3084948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227540.1|3085240_3087316_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003227543.1|3087517_3088348_+	spermidine synthase	NA	NA	NA	NA	NA
WP_032722706.1|3088408_3089281_+	agmatinase	NA	NA	NA	NA	NA
WP_009968329.1|3089876_3089996_-	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_003227549.1|3089979_3091125_-	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
WP_009968328.1|3091127_3091358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032722703.1|3091354_3092710_+	YncE family protein	NA	NA	NA	NA	NA
WP_032722701.1|3092748_3094125_+	YncE family protein	NA	NA	NA	NA	NA
WP_015250988.1|3094130_3094832_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_032722698.1|3094828_3096109_-	insulinase family protein	NA	NA	NA	NA	NA
WP_080287644.1|3096113_3097274_-	insulinase family protein	NA	NA	NA	NA	NA
WP_019712818.1|3097263_3098574_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_032722693.1|3098566_3099286_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	4.3e-19
WP_003222006.1|3099282_3099444_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_032722691.1|3099456_3100803_-	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_010886632.1|3100827_3100980_-|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_003222002.1|3100936_3101068_-|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003243604.1|3101379_3101808_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_015250994.1|3101804_3103475_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP028212	Bacillus subtilis strain SRCM102748 chromosome, complete genome	4210797	3466226	3477423	4210797	holin	Anomala_cuprea_entomopoxvirus(50.0%)	14	NA	NA
WP_003243370.1|3466226_3467369_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
WP_003228349.1|3467391_3468045_+|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_003228350.1|3468064_3468976_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003244403.1|3468993_3469683_+|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_003243541.1|3469902_3470175_+	sporulation delaying system autorepressor SdpR	NA	NA	NA	NA	NA
WP_003228357.1|3470171_3470795_+	immunity protein SdpI	NA	NA	NA	NA	NA
WP_003243360.1|3470841_3471453_-	sporulation delaying protein SdpC	NA	NA	NA	NA	NA
WP_003228363.1|3471495_3472467_-	sporulation-delaying protein SdpB	NA	NA	NA	NA	NA
WP_009968174.1|3472463_3472940_-	sporulation-delaying system protein SdpA	NA	NA	NA	NA	NA
WP_003243347.1|3473161_3473695_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003242811.1|3473978_3475124_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
WP_003228370.1|3475140_3475794_+|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_032722530.1|3475805_3476726_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032722528.1|3476742_3477423_+|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
>prophage 11
NZ_CP028212	Bacillus subtilis strain SRCM102748 chromosome, complete genome	4210797	3486592	3522592	4210797	terminase,holin,plate,head,protease,portal,tail,capsid,integrase	Bacillus_phage(40.74%)	47	3486499:3486523	3523026:3523050
3486499:3486523	attL	GACTCCCACCGTCTCCATACATACT	NA	NA	NA	NA
WP_046663969.1|3486592_3487654_-|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	65.2	6.3e-136
WP_160215008.1|3487918_3489019_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_147801342.1|3489453_3489852_-	helix-turn-helix domain-containing protein	NA	S5M5X8	Brevibacillus_phage	33.7	5.6e-05
WP_147801343.1|3490086_3490290_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_116363038.1|3490342_3490534_+	helix-turn-helix transcriptional regulator	NA	A0A1B2APY7	Phage_Wrath	52.5	1.9e-11
WP_116363037.1|3490558_3490789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147801344.1|3490781_3491633_+	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	47.4	2.8e-62
WP_160215009.1|3491583_3492438_+	ATP-binding protein	NA	Q4ZAS1	Staphylococcus_virus	29.4	2.9e-22
WP_160215010.1|3492424_3492586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041850158.1|3492737_3493286_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	39.3	4.6e-05
WP_003237439.1|3493393_3493534_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_116363033.1|3493780_3493978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160215011.1|3494020_3494305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102702890.1|3494301_3494529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064670940.1|3494525_3494774_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	44.9	7.8e-05
WP_160215012.1|3494787_3495597_+	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	58.3	2.2e-88
WP_160215013.1|3495609_3496524_+	DNA cytosine methyltransferase	NA	A8YQM6	Lactobacillus_phage	47.0	4.5e-66
WP_160215014.1|3496731_3497184_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.6	1.5e-38
WP_160215015.1|3497180_3497723_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	63.9	5.8e-61
WP_116363025.1|3497977_3498526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116363024.1|3498672_3499344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116363023.1|3499504_3499867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116363022.1|3499863_3500079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116363021.1|3500075_3500444_+	HNH endonuclease	NA	A0A1B0T6C5	Bacillus_phage	53.5	8.5e-32
WP_041850148.1|3500513_3500927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041850147.1|3500923_3502657_+|terminase	terminase large subunit	terminase	A0A1B0T685	Bacillus_phage	52.9	1.3e-170
WP_046664045.1|3502698_3503835_+|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	53.2	1.7e-107
WP_026113656.1|3503824_3504418_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	59.0	5.4e-52
WP_160215016.1|3504414_3505698_+|capsid	phage major capsid protein	capsid	A0A2H4J9Y4	uncultured_Caudovirales_phage	52.1	7.2e-86
WP_041344993.1|3505678_3505972_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	42.5	2.4e-13
WP_152614393.1|3505934_3506279_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_041344996.1|3506262_3506673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041344998.1|3506677_3507061_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_041345000.1|3507057_3507690_+	hypothetical protein	NA	A0A1J0MFV0	Staphylococcus_phage	29.2	1.7e-11
WP_017695872.1|3507689_3508073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160215017.1|3508093_3508258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160215031.1|3509635_3512569_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	46.8	1.6e-56
WP_160215018.1|3512573_3513404_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_160215019.1|3513416_3515300_+	autolysin	NA	M5AC19	Bacillus_phage	25.5	5.2e-48
WP_160215020.1|3515307_3517872_+	peptidase G2	NA	D6R401	Bacillus_phage	66.2	0.0e+00
WP_160215032.1|3517887_3519120_+|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	71.2	3.9e-121
WP_160215021.1|3519116_3519503_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	50.0	7.6e-23
WP_160215022.1|3519503_3519698_+	XkdX family protein	NA	A0A2H4J2R9	uncultured_Caudovirales_phage	50.0	2.9e-07
WP_046160686.1|3519758_3520181_+|holin	holin family protein	holin	D6R405	Bacillus_phage	86.5	3.0e-57
WP_116363009.1|3520223_3521165_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	78.5	2.1e-98
WP_116363008.1|3521505_3522360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041345331.1|3522403_3522592_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	53.3	2.5e-11
3523026:3523050	attR	GACTCCCACCGTCTCCATACATACT	NA	NA	NA	NA
>prophage 12
NZ_CP028212	Bacillus subtilis strain SRCM102748 chromosome, complete genome	4210797	4076808	4119756	4210797	coat,protease,tRNA	Yellowstone_lake_phycodnavirus(16.67%)	39	NA	NA
WP_004398743.1|4076808_4077144_-|coat	inner spore coat protein CotQ	coat	NA	NA	NA	NA
WP_004398643.1|4077959_4079684_+	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.4	8.3e-61
WP_004399096.1|4079680_4080199_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003222549.1|4080222_4081251_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_009967929.1|4081237_4082794_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
WP_004399139.1|4082814_4083912_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_003229604.1|4083961_4085380_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_003229606.1|4085392_4085992_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003229609.1|4086110_4087115_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003229611.1|4087342_4088617_+	trigger factor	NA	NA	NA	NA	NA
WP_003229613.1|4088888_4090151_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
WP_004398923.1|4090302_4091961_+|protease	Lon protease 2	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229618.1|4092141_4094466_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	3.4e-182
WP_003229621.1|4094462_4095050_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003229624.1|4095071_4095569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399038.1|4095798_4097166_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003222575.1|4097173_4098004_+	protein HemX	NA	NA	NA	NA	NA
WP_010886587.1|4098036_4098981_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003229629.1|4098970_4099759_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003229631.1|4099755_4100730_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_003229633.1|4100759_4102052_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003246083.1|4102182_4103910_+|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_004399056.1|4103942_4104968_+|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_003222590.1|4104986_4105178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398606.1|4105625_4108268_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
WP_003229640.1|4108327_4109620_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_072592551.1|4109761_4110508_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_015714459.1|4110641_4111640_+	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_004398496.1|4111792_4112362_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_003246034.1|4112398_4113094_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_003229650.1|4113185_4114199_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_009967915.1|4114229_4115102_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004398811.1|4115098_4115617_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004398901.1|4115669_4116350_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014664846.1|4116351_4117158_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398684.1|4117306_4118101_+	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_004398649.1|4118093_4118960_+	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_003229668.1|4119106_4119415_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003229669.1|4119417_4119756_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
