The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	0	17236	4100473	tRNA	Bacillus_virus(33.33%)	18	NA	NA
WP_072588933.1|1539_2250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076423768.1|2261_2996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160223386.1|2965_3679_-	YhbD family protein	NA	NA	NA	NA	NA
WP_007610253.1|3733_4216_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_012117141.1|4252_5164_-	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_015239452.1|5239_6400_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_160222927.1|6484_7108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155407.1|7461_7665_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007408423.1|7661_8129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610245.1|8149_8419_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_160222926.1|8593_9730_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_160222925.1|9754_10588_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020955546.1|10587_11577_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160222924.1|11592_12360_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	2.1e-32
WP_033574447.1|12582_13518_-	amidohydrolase	NA	NA	NA	NA	NA
WP_003155420.1|13774_15220_+	catalase	NA	A0A2K9L0T1	Tupanvirus	41.7	8.1e-110
WP_015239443.1|15291_16257_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_059366796.1|16249_17236_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.8	6.7e-15
>prophage 2
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	21337	22693	4100473		Pandoravirus(100.0%)	1	NA	NA
WP_094031912.1|21337_22693_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	39.7	9.5e-44
>prophage 3
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	39395	41138	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_012117125.1|39395_41138_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	1.3e-48
>prophage 4
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	48540	50592	4100473		Salmonella_phage(50.0%)	2	NA	NA
WP_003155484.1|48540_49521_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.3	1.5e-59
WP_043020689.1|49731_50592_-	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	26.4	2.2e-06
>prophage 5
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	62542	64637	4100473		Mycobacterium_phage(50.0%)	2	NA	NA
WP_160222920.1|62542_64135_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.0	4.5e-21
WP_025284442.1|64094_64637_-	bacillithiol transferase BstA	NA	D0R7I3	Paenibacillus_phage	45.6	1.4e-17
>prophage 6
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	72953	79108	4100473		Bacillus_phage(100.0%)	3	NA	NA
WP_076425456.1|72953_74771_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	2.5e-55
WP_012117099.1|74751_76485_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	4.4e-46
WP_012117098.1|76780_79108_-	peptidase G2	NA	Q9ZXE2	Bacillus_phage	38.5	1.7e-133
>prophage 7
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	93831	95232	4100473		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_160222914.1|93831_95232_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.7	3.3e-84
>prophage 8
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	112104	112620	4100473		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_003155578.1|112104_112620_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.9	1.3e-09
>prophage 9
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	125856	127794	4100473		Streptococcus_phage(100.0%)	1	NA	NA
WP_007610031.1|125856_127794_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.9	8.0e-137
>prophage 10
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	131485	131620	4100473		Bacillus_virus(100.0%)	1	NA	NA
WP_003155609.1|131485_131620_+	YflJ family protein	NA	G3MBD1	Bacillus_virus	61.0	1.9e-05
>prophage 11
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	148090	153866	4100473		Hokovirus(50.0%)	2	NA	NA
WP_160222905.1|148090_151180_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.9	1.8e-29
WP_160223384.1|151334_153866_-	collagen-like repeat preface domain-containing protein	NA	A0A2R8FCV3	Brazilian_cedratvirus	64.7	1.5e-39
>prophage 12
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	168217	178023	4100473		Tupanvirus(33.33%)	8	NA	NA
WP_015239365.1|168217_169348_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	32.2	2.7e-44
WP_012117051.1|169519_171076_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	8.9e-54
WP_007408959.1|171118_172303_-	MFS transporter	NA	NA	NA	NA	NA
WP_012117050.1|172366_172789_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_136396192.1|172979_174869_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	4.1e-53
WP_020955481.1|175027_176095_+	glycosyltransferase family 2 protein	NA	A0A1V0SAJ8	Catovirus	30.2	1.2e-14
WP_136396191.1|176140_177040_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	50.0	1.4e-67
WP_007408955.1|177168_178023_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.6e-09
>prophage 13
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	185582	189466	4100473		Tupanvirus(50.0%)	3	NA	NA
WP_012117042.1|185582_186551_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	29.2	6.1e-29
WP_015239357.1|186557_187322_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003155677.1|187537_189466_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.5	1.1e-130
>prophage 14
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	198031	203295	4100473		Staphylococcus_phage(50.0%)	4	NA	NA
WP_015239351.1|198031_198922_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	3.5e-23
WP_007609957.1|198922_199234_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_015239350.1|199226_199820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222899.1|200112_203295_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.5	1.7e-80
>prophage 15
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	214234	229009	4100473		Bacillus_phage(33.33%)	12	NA	NA
WP_082999071.1|214234_216115_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	59.9	1.8e-125
WP_082999070.1|216120_216420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082999090.1|216529_218536_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	50.9	2.2e-129
WP_082999069.1|218540_219014_+	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_063095907.1|219047_219503_+	DUF600 family protein	NA	NA	NA	NA	NA
WP_082999068.1|219547_220018_+	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_052827156.1|220430_221306_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003155721.1|221306_222260_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	8.2e-18
WP_052827154.1|222611_223079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076425541.1|223268_224654_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	45.4	1.7e-109
WP_015239327.1|224801_225713_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.6	1.2e-21
WP_015239326.1|225865_229009_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.0	2.7e-65
>prophage 16
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	235277	242702	4100473		Bacillus_virus(33.33%)	5	NA	NA
WP_061581503.1|235277_235970_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.1	7.7e-18
WP_082999067.1|236006_237002_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
WP_007408912.1|237239_238436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025284377.1|238451_240458_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	39.8	4.5e-127
WP_032872525.1|240482_242702_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.6	5.9e-136
>prophage 17
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	250136	269402	4100473		Synechococcus_phage(36.36%)	18	NA	NA
WP_025284372.1|250136_251675_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	6.7e-78
WP_007408902.1|251671_252259_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
WP_094031563.1|252255_253296_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.9	3.7e-64
WP_007609856.1|253387_254818_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_082999063.1|254793_257022_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	1.0e-156
WP_007408898.1|257005_257689_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003155758.1|257685_257940_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_025284370.1|257939_258659_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	2.6e-48
WP_082999062.1|258734_260027_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.0	7.7e-19
WP_012116995.1|260026_261208_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_007609846.1|261161_261650_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.6	5.6e-23
WP_007609843.1|261962_262160_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_014469850.1|262156_262711_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_003155777.1|262833_263007_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_025284368.1|263145_263928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007408891.1|264125_265448_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.0	4.1e-36
WP_007408889.1|267224_267758_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_007408887.1|267860_269402_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.0	1.2e-21
>prophage 18
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	283774	285706	4100473		Pseudomonas_phage(100.0%)	1	NA	NA
WP_160222896.1|283774_285706_+	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	33.4	1.9e-42
>prophage 19
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	298262	300223	4100473		uncultured_virus(100.0%)	2	NA	NA
WP_003155941.1|298262_299897_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
WP_003155970.1|299938_300223_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
>prophage 20
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	303670	306863	4100473	tRNA	Tupanvirus(50.0%)	2	NA	NA
WP_015239290.1|303670_305599_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	2.1e-60
WP_020955419.1|305822_306863_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	4.1e-63
>prophage 21
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	328151	331652	4100473		Mycobacterium_phage(50.0%)	4	NA	NA
WP_160222889.1|328151_329510_-	beta-lactamase family protein	NA	A0A2D1G9Q2	Mycobacterium_phage	24.5	6.9e-10
WP_007409303.1|329646_329916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409304.1|330146_330401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160222888.1|330458_331652_-	UDP-glucosyltransferase	NA	O89808	Epiphyas_postvittana_nucleopolyhedrovirus	27.9	2.3e-09
>prophage 22
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	345537	347169	4100473		Streptococcus_phage(100.0%)	1	NA	NA
WP_160222883.1|345537_347169_+	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	27.4	1.7e-47
>prophage 23
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	350316	352854	4100473		Bacillus_phage(50.0%)	3	NA	NA
WP_160222881.1|350316_350952_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.3	3.2e-10
WP_160222880.1|350944_352162_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_060563176.1|352317_352854_-	sugar O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	33.8	9.3e-11
>prophage 24
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	356031	357168	4100473		Synechococcus_phage(100.0%)	1	NA	NA
WP_069006886.1|356031_357168_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.7	1.3e-14
>prophage 25
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	363114	364871	4100473		Bacillus_phage(100.0%)	2	NA	NA
WP_160222875.1|363114_364188_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.2	2.5e-23
WP_012116926.1|364184_364871_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.5	9.6e-45
>prophage 26
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	370295	371345	4100473		Tupanvirus(100.0%)	1	NA	NA
WP_032866822.1|370295_371345_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	41.2	1.6e-67
>prophage 27
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	376308	378882	4100473		Bacillus_phage(50.0%)	3	NA	NA
WP_043021449.1|376308_376842_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	66.9	4.0e-54
WP_069006874.1|377113_377746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012116910.1|377844_378882_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	25.5	8.3e-16
>prophage 28
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	389055	393038	4100473		Lactococcus_phage(50.0%)	4	NA	NA
WP_003156143.1|389055_389259_-	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	75.4	2.2e-21
WP_132106879.1|389705_389867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012116888.1|391550_391886_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012116887.1|392063_393038_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	26.9	4.6e-08
>prophage 29
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	399883	401287	4100473		Burkholderia_virus(100.0%)	1	NA	NA
WP_160222865.1|399883_401287_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	2.4e-58
>prophage 30
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	412696	413146	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_060563118.1|412696_413146_-	SprT family protein	NA	U5J9G1	Bacillus_phage	25.7	4.4e-06
>prophage 31
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	416202	416991	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_003156171.1|416202_416991_-	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	35.1	2.6e-25
>prophage 32
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	420560	420911	4100473		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003156187.1|420560_420911_-	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	5.8e-14
>prophage 33
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	426881	428366	4100473		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_015239193.1|426881_428366_-	ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.8	1.4e-61
>prophage 34
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	431382	431700	4100473		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003156200.1|431382_431700_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	32.0	1.8e-06
>prophage 35
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	435592	436519	4100473		Staphylococcus_phage(100.0%)	1	NA	NA
WP_012116860.1|435592_436519_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.0	3.4e-37
>prophage 36
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	451831	454057	4100473		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_014416943.1|451831_453553_-	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	26.0	1.2e-35
WP_150940997.1|453610_454057_-	NUDIX domain-containing protein	NA	Q56BL2	Escherichia_virus	44.6	9.8e-06
>prophage 37
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	463597	465784	4100473		Streptococcus_phage(100.0%)	1	NA	NA
WP_025284251.1|463597_465784_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.3	3.5e-40
>prophage 38
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	469747	475790	4100473		Diadromus_pulchellus_ascovirus(33.33%)	4	NA	NA
WP_007410307.1|469747_470608_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	38.1	2.0e-47
WP_025284249.1|470766_472281_-	acyl--CoA ligase	NA	Q75ZG1	Hepacivirus	26.3	6.6e-38
WP_160222851.1|472503_474588_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_014416927.1|474887_475790_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	2.3e-09
>prophage 39
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	493175	499318	4100473		Trichoplusia_ni_ascovirus(33.33%)	5	NA	NA
WP_076425704.1|493175_493961_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	3.1e-23
WP_003156317.1|493981_494845_-	glucose transporter GlcU	NA	NA	NA	NA	NA
WP_007410282.1|494999_496388_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023356706.1|496493_497801_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	1.4e-23
WP_043021405.1|497908_499318_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.3	5.2e-21
>prophage 40
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	504337	512605	4100473		Bacillus_phage(60.0%)	9	NA	NA
WP_003156330.1|504337_505096_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	29.8	5.9e-19
WP_160222847.1|505089_506037_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_059366593.1|506026_506980_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	53.4	2.7e-93
WP_059366589.1|507394_508759_+	aspartate kinase	NA	NA	NA	NA	NA
WP_012116800.1|508853_508949_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_033575081.1|509097_509217_-	phosphatase	NA	NA	NA	NA	NA
WP_007410270.1|509200_510349_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	44.6	1.2e-84
WP_076425708.1|510501_511932_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.6	1.6e-38
WP_007410267.1|511921_512605_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.2	1.9e-45
>prophage 41
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	517567	518317	4100473		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003156349.1|517567_518317_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	4.3e-14
>prophage 42
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	526277	529780	4100473		Bacillus_phage(50.0%)	2	NA	NA
WP_160222841.1|526277_528023_-	hypothetical protein	NA	U5PSS0	Bacillus_phage	40.8	4.5e-107
WP_012116786.1|528301_529780_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	39.4	4.3e-82
>prophage 43
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	535166	538708	4100473		Planktothrix_phage(50.0%)	4	NA	NA
WP_012116781.1|535166_535910_+	cystine ABC transporter ATP-binding protein TcyC	NA	G9BWD6	Planktothrix_phage	38.1	3.1e-33
WP_077392018.1|535982_536630_+	YitT family protein	NA	NA	NA	NA	NA
WP_024084876.1|536728_537403_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_160222840.1|537397_538708_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	41.6	3.2e-73
>prophage 44
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	542541	573016	4100473		Tupanvirus(60.0%)	9	NA	NA
WP_160222839.1|542541_546378_-	surfactin non-ribosomal peptide synthetase SrfAC	NA	A0A2K9KZV5	Tupanvirus	26.1	1.7e-85
WP_160222838.1|546412_557173_-	surfactin non-ribosomal peptide synthetase SrfAB	NA	A0A2K9KZV5	Tupanvirus	27.3	1.4e-166
WP_160222837.1|557194_567949_-	surfactin non-ribosomal peptide synthetase SrfAA	NA	A0A2K9KZV5	Tupanvirus	27.4	2.1e-162
WP_007409352.1|568540_568903_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015239130.1|569134_569770_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_007409354.1|569766_570324_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_003156588.1|570682_571120_+	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	62.6	1.2e-37
WP_007609299.1|571140_571539_+	peptidase S24	NA	NA	NA	NA	NA
WP_160222836.1|571579_573016_-	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	30.2	4.5e-52
>prophage 45
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	586834	587845	4100473		Bacillus_virus(100.0%)	1	NA	NA
WP_082998947.1|586834_587845_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	27.7	1.7e-18
>prophage 46
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	592546	594431	4100473		Staphylococcus_phage(50.0%)	2	NA	NA
WP_087920787.1|592546_593458_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	40.9	6.1e-63
WP_011996301.1|593645_594431_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	43.1	5.1e-42
>prophage 47
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	599758	600577	4100473		Bacillus_virus(100.0%)	1	NA	NA
WP_007409061.1|599758_600577_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.7	2.9e-96
>prophage 48
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	614899	616156	4100473		Bacillus_virus(100.0%)	1	NA	NA
WP_003156640.1|614899_616156_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.3	1.1e-33
>prophage 49
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	620641	631664	4100473		Bacillus_phage(37.5%)	12	NA	NA
WP_003156644.1|620641_621415_-	TerC family protein	NA	S5MAL1	Bacillus_phage	63.9	9.4e-81
WP_003156645.1|621453_622032_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.1	1.1e-28
WP_007409047.1|622064_622646_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.9	1.9e-30
WP_011996286.1|622669_623266_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	32.4	1.1e-25
WP_069007160.1|623541_624537_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007409044.1|624580_625420_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003156655.1|625377_626073_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.2e-15
WP_015239100.1|626127_627087_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160222828.1|627272_628952_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_007409041.1|629035_629815_-	glucose 1-dehydrogenase	NA	A0A0G2Y8L6	Acanthamoeba_polyphaga_mimivirus	31.2	1.2e-06
WP_007409040.1|629929_631051_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	36.9	1.0e-64
WP_059366518.1|631160_631664_+	M15 family metallopeptidase	NA	A0A127AWA8	Bacillus_phage	58.6	8.6e-35
>prophage 50
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	640792	644836	4100473		Mycobacterium_phage(50.0%)	4	NA	NA
WP_038455963.1|640792_642232_+	lincomycin efflux MFS transporter Lmr(B)	NA	A0A0M3UL24	Mycobacterium_phage	23.6	1.2e-12
WP_025284180.1|642267_643395_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_160222822.1|643466_644114_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_160222821.1|644110_644836_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	26.6	1.5e-19
>prophage 51
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	677576	678464	4100473		Staphylococcus_phage(100.0%)	1	NA	NA
WP_007408993.1|677576_678464_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	40.5	2.2e-41
>prophage 52
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	699207	701010	4100473		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_007609074.1|699207_701010_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	40.2	2.4e-103
>prophage 53
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	710740	712024	4100473		Mycobacterium_phage(100.0%)	1	NA	NA
WP_160222807.1|710740_712024_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	22.1	8.2e-05
>prophage 54
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	721889	726791	4100473		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_014720647.1|721889_723323_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	2.0e-137
WP_003156784.1|723554_724601_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	27.0	8.7e-13
WP_160222803.1|724575_725526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007408029.1|725522_726791_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.5	2.1e-21
>prophage 55
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	747920	749611	4100473		Staphylococcus_phage(50.0%)	2	NA	NA
WP_014416754.1|747920_748790_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	3.6e-12
WP_007615256.1|748765_749611_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	1.0e-19
>prophage 56
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	767333	778167	4100473		Streptococcus_phage(33.33%)	6	NA	NA
WP_007410399.1|767333_769412_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	2.4e-62
WP_003156447.1|769464_769935_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003156445.1|769974_770391_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003156443.1|770506_770755_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_007410398.1|770923_774523_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.1	8.9e-65
WP_003156440.1|774585_778167_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.4	4.0e-49
>prophage 57
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	781662	782196	4100473		Bacillus_virus(100.0%)	1	NA	NA
WP_003156423.1|781662_782196_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.8	5.4e-11
>prophage 58
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	785217	786618	4100473	tRNA	Catovirus(100.0%)	1	NA	NA
WP_160222801.1|785217_786618_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.4	2.6e-60
>prophage 59
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	794074	796507	4100473	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_007410388.1|794074_796507_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	35.4	4.4e-132
>prophage 60
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	809948	811448	4100473	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_014416740.1|809948_811448_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.2	9.0e-96
>prophage 61
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	815295	823784	4100473	protease	Acinetobacter_phage(20.0%)	8	NA	NA
WP_011996185.1|815295_815883_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	57.0	1.1e-62
WP_025284092.1|815898_817311_-	aminodeoxychorismate synthase, component I	NA	A0A0B5J984	Pandoravirus	30.7	1.9e-34
WP_007615206.1|817478_818405_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.5	2.0e-109
WP_039062448.1|818480_819371_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_004264606.1|819416_820292_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_007409940.1|820302_821079_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_160222798.1|821227_823147_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.0	8.5e-115
WP_004264611.1|823244_823784_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	24.3	1.0e-04
>prophage 62
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	835441	835978	4100473		Paenibacillus_phage(100.0%)	1	NA	NA
WP_004264646.1|835441_835978_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 63
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	841353	843699	4100473		Hokovirus(50.0%)	2	NA	NA
WP_007409928.1|841353_842307_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.1	3.9e-44
WP_004264658.1|842328_843699_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	34.8	7.1e-31
>prophage 64
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	850122	863509	4100473	tRNA	Streptococcus_phage(37.5%)	15	NA	NA
WP_023356663.1|850122_851448_-	DUF348 domain-containing protein	NA	A0A0E3D983	Bacillus_phage	73.0	5.3e-23
WP_025284081.1|851582_852350_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011996169.1|852425_854417_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.4	8.0e-100
WP_004264711.1|854906_855191_+	transition state genes transcriptional regulator AbrB	NA	A0A2I7SC16	Paenibacillus_phage	71.4	1.0e-16
WP_160222794.1|855240_856122_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	48.4	4.0e-67
WP_007409921.1|856096_856396_-	GIY-YIG nuclease family protein	NA	A0A068LKN9	Peridroma_alphabaculovirus	40.3	9.4e-05
WP_004264717.1|856382_857126_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004264720.1|857186_857546_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_004264723.1|857560_858388_-	competence/sporulation regulator complex protein RicT	NA	NA	NA	NA	NA
WP_007409919.1|858390_859380_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	32.8	2.5e-33
WP_004264730.1|859391_859832_-	DUF327 family protein	NA	NA	NA	NA	NA
WP_004264734.1|859844_860174_-	cyclic di-AMP receptor DarA	NA	NA	NA	NA	NA
WP_007409918.1|860244_860883_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	55.9	4.1e-58
WP_160222793.1|860879_862313_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_015239016.1|862390_863509_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	29.6	1.1e-34
>prophage 65
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	871426	873118	4100473		Clostridium_phage(100.0%)	1	NA	NA
WP_011996162.1|871426_873118_-	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	35.1	9.6e-54
>prophage 66
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	876167	885279	4100473	tRNA	Lactobacillus_virus(16.67%)	8	NA	NA
WP_160222792.1|876167_876791_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	33.5	5.3e-18
WP_007615132.1|876787_877441_+	deoxynucleoside kinase	NA	A0A127AVX2	Bacillus_phage	35.7	1.2e-25
WP_124692622.1|877881_879027_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.7	5.7e-50
WP_007408744.1|879037_880315_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.5	1.3e-98
WP_007615126.1|880634_881225_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_003150714.1|881246_882131_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_015239011.1|882328_883660_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.3	1.1e-20
WP_007408741.1|883812_885279_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	5.5e-98
>prophage 67
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	891687	899213	4100473		Bacillus_virus(66.67%)	6	NA	NA
WP_015239009.1|891687_894147_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.9	2.1e-113
WP_011996153.1|894362_896279_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	48.0	2.7e-153
WP_004392908.1|896335_896581_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_007409910.1|896598_897711_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004392910.1|897726_897942_-	ribosome maturation protein RlbA	NA	NA	NA	NA	NA
WP_007409909.1|898076_899213_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	32.9	1.1e-16
>prophage 68
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	907972	911371	4100473	protease	Leptospira_phage(25.0%)	4	NA	NA
WP_007409900.1|907972_908824_+	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	35.7	2.8e-17
WP_007409899.1|909122_909884_+	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	30.6	5.0e-26
WP_012118944.1|909876_910728_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	38.2	2.3e-19
WP_004392969.1|910756_911371_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	42.3	2.4e-18
>prophage 69
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	917225	920110	4100473		Bacillus_phage(33.33%)	5	NA	NA
WP_004392979.1|917225_917744_+	single-stranded DNA-binding protein	NA	M5ABV5	Bacillus_phage	70.9	2.1e-52
WP_004392983.1|917787_918027_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_160222791.1|918219_918801_+	methylphosphotriester-DNA--protein-cysteine methyltransferase family protein	NA	NA	NA	NA	NA
WP_015240986.1|918797_919355_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	45.8	2.1e-18
WP_124692627.1|919351_920110_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	45.1	2.1e-61
>prophage 70
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	935568	937672	4100473		Streptococcus_phage(50.0%)	3	NA	NA
WP_012118921.1|935568_936447_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.6	1.3e-33
WP_007409877.1|936585_937020_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004393039.1|937033_937672_+	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	49.0	3.1e-05
>prophage 71
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	944691	946248	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_160222786.1|944691_946248_-	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	38.2	1.9e-88
>prophage 72
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	962741	976082	4100473	protease	Bacillus_phage(42.86%)	11	NA	NA
WP_004393100.1|962741_964106_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.1	3.6e-128
WP_041482233.1|964222_964636_+	VOC family protein	NA	NA	NA	NA	NA
WP_012118894.1|964874_966167_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	35.9	1.1e-68
WP_004393104.1|967132_967840_+	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	42.3	1.2e-45
WP_160222782.1|967846_969682_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.1	1.7e-35
WP_025285568.1|969671_971030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160222781.1|971016_971856_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_007407895.1|971870_972665_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	34.1	4.1e-39
WP_007614967.1|972751_973948_+|protease	serine protease	protease	W5SAB9	Pithovirus	32.1	1.4e-11
WP_042635664.1|974457_974667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069007590.1|974663_976082_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	35.9	1.3e-32
>prophage 73
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	979876	990055	4100473		Klosneuvirus(40.0%)	9	NA	NA
WP_059367460.1|979876_981502_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.6	1.2e-45
WP_007407887.1|981515_982235_+	cupin	NA	NA	NA	NA	NA
WP_099567296.1|982276_983662_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_015240946.1|983866_984154_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	2.8e-06
WP_099567232.1|984150_984786_+	SdpI family protein	NA	NA	NA	NA	NA
WP_004393130.1|985015_986221_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	3.4e-29
WP_020958097.1|986444_987845_+	amino acid permease	NA	NA	NA	NA	NA
WP_007407883.1|987918_988809_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	28.8	5.8e-26
WP_032868107.1|988939_990055_+	aspartate phosphatase	NA	D6R410	Bacillus_phage	30.4	6.4e-38
>prophage 74
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1000428	1002315	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_152535318.1|1000428_1002315_+	UvrD-helicase domain-containing protein	NA	S5MMD7	Bacillus_phage	21.4	4.0e-16
>prophage 75
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1018818	1021625	4100473		Lactococcus_phage(100.0%)	2	NA	NA
WP_012118862.1|1018818_1020051_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	32.6	5.0e-52
WP_150941535.1|1020095_1021625_-	alkyl hydroperoxide reductase subunit F	NA	V9VEY6	Lactococcus_phage	29.4	3.7e-20
>prophage 76
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1034466	1039663	4100473		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_160223375.1|1034466_1036347_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	32.9	1.7e-83
WP_032869301.1|1036389_1037778_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_007407843.1|1037897_1038830_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_007614879.1|1038907_1039663_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.5	1.1e-20
>prophage 77
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1053300	1054074	4100473		Planktothrix_phage(100.0%)	1	NA	NA
WP_007614823.1|1053300_1054074_+	ABC transporter ATP-binding protein YxdL	NA	G9BWD6	Planktothrix_phage	36.8	9.9e-30
>prophage 78
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1063758	1065060	4100473		Geobacillus_virus(100.0%)	1	NA	NA
WP_160223365.1|1063758_1065060_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	60.7	7.2e-134
>prophage 79
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1070459	1077894	4100473		Catovirus(50.0%)	5	NA	NA
WP_039063838.1|1070459_1071998_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.6	4.7e-92
WP_004393292.1|1072110_1072557_-	hut operon transcriptional regulator HutP	NA	NA	NA	NA	NA
WP_124692658.1|1072798_1074205_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_160223362.1|1074384_1074774_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_160223361.1|1074762_1077894_-	DUF3427 domain-containing protein	NA	A0A1B1IW48	uncultured_Mediterranean_phage	24.4	1.4e-26
>prophage 80
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1097079	1098519	4100473		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_136396724.1|1097079_1098519_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	34.8	5.9e-60
>prophage 81
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1103288	1105340	4100473		Tupanvirus(100.0%)	1	NA	NA
WP_136396722.1|1103288_1105340_+	catalase	NA	A0A2K9L0T1	Tupanvirus	52.5	4.9e-153
>prophage 82
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1109471	1110608	4100473		uncultured_virus(100.0%)	1	NA	NA
WP_044802395.1|1109471_1110608_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.8	1.6e-89
>prophage 83
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1113624	1132761	4100473		Tupanvirus(25.0%)	15	NA	NA
WP_014419237.1|1113624_1114641_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	50.2	2.0e-94
WP_119834765.1|1114687_1115227_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_003150818.1|1115739_1116576_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	34.3	2.3e-40
WP_094032018.1|1116742_1117636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061581619.1|1117752_1118853_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.2	1.6e-20
WP_012118785.1|1118952_1119795_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_160223351.1|1119829_1121173_-	malate permease	NA	A0A140XAH4	Dickeya_phage	32.9	5.0e-05
WP_007614697.1|1121675_1123082_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_014722010.1|1123065_1124082_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052827999.1|1124081_1125785_+	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	31.9	2.5e-17
WP_012118781.1|1125781_1127512_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	22.3	1.6e-16
WP_052827997.1|1127603_1128434_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_160223350.1|1128447_1129806_-	cytosine permease	NA	NA	NA	NA	NA
WP_039063822.1|1130122_1131109_+	choloylglycine hydrolase family protein	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	30.3	6.7e-31
WP_160223349.1|1131147_1132761_-	catalase	NA	A0A2K9L572	Tupanvirus	45.4	3.0e-97
>prophage 84
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1135782	1141008	4100473		Pandoravirus(33.33%)	6	NA	NA
WP_025285483.1|1135782_1137183_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.3	4.7e-46
WP_012118772.1|1137212_1138532_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_122504263.1|1138550_1138868_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_094031394.1|1138882_1139194_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_061581630.1|1139346_1140645_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	65.6	6.7e-156
WP_108654954.1|1140657_1141008_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.4	1.4e-12
>prophage 85
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1153362	1213470	4100473	holin,transposase,coat,lysis	Bacillus_phage(23.08%)	65	NA	NA
WP_015240830.1|1153362_1154544_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	25.4	1.2e-18
WP_015240829.1|1154540_1156052_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2H4PQU7	Staphylococcus_phage	24.2	5.5e-16
WP_003150882.1|1156067_1156217_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003150884.1|1156660_1157596_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_007407732.1|1157727_1158360_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_007407730.1|1158619_1159480_+	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.5	1.4e-05
WP_160223345.1|1159534_1161280_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	43.6	1.8e-42
WP_007407728.1|1161441_1162776_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_012118757.1|1162804_1163188_-	VOC family protein	NA	NA	NA	NA	NA
WP_007407727.1|1163282_1164470_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	43.7	6.3e-76
WP_132106632.1|1164552_1165455_-	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_132106644.1|1165441_1166203_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003150901.1|1166358_1166553_-	YwbE family protein	NA	NA	NA	NA	NA
WP_015240826.1|1166681_1167362_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_007407725.1|1167343_1167730_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003150908.1|1167836_1168745_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160223344.1|1168747_1169587_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_160223343.1|1169562_1170237_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_025285468.1|1170437_1170632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223342.1|1170650_1171907_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_012118748.1|1171992_1172595_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_020958014.1|1172615_1173290_-	Streptomycin biosynthesis protein	NA	NA	NA	NA	NA
WP_007407718.1|1173289_1173970_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003150917.1|1174186_1174348_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
WP_059367558.1|1174683_1175307_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032869853.1|1175386_1175773_+	GtrA family protein	NA	NA	NA	NA	NA
WP_063093947.1|1175824_1177009_+	galactokinase	NA	NA	NA	NA	NA
WP_160223341.1|1176998_1178540_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_160223007.1|1178581_1179732_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
WP_003150926.1|1179847_1180093_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_087920812.1|1180595_1181561_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_012118743.1|1181588_1183538_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003150930.1|1183552_1184167_+	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_007407711.1|1184168_1184537_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003150937.1|1184580_1184841_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_042635595.1|1185134_1185593_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007407709.1|1185794_1186982_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_007407708.1|1187084_1187834_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_059367565.1|1187995_1188997_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_160223340.1|1189042_1191451_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.8	3.8e-19
WP_025285458.1|1191976_1192291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407705.1|1192314_1193145_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_020958006.1|1193363_1194746_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_098081874.1|1194742_1196182_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.5	6.3e-22
WP_007407702.1|1196281_1196521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099567183.1|1196552_1197365_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003150960.1|1197514_1197853_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160223339.1|1197845_1198481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223338.1|1198525_1199053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407698.1|1199137_1199944_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015240810.1|1199958_1200642_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	5.4e-48
WP_015387535.1|1200701_1201124_+	YwdI family protein	NA	NA	NA	NA	NA
WP_015240808.1|1201142_1202462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150969.1|1202525_1202897_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_007614539.1|1202944_1203490_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_015240806.1|1203770_1204541_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	25.4	5.8e-06
WP_114354765.1|1204545_1205970_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_160223337.1|1205992_1207162_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_059367570.1|1207162_1208026_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012118725.1|1208025_1209147_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_160223336.1|1209136_1209880_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_160223335.1|1209881_1210886_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_031378582.1|1210913_1211651_+	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_007407684.1|1211653_1212601_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	5.9e-69
WP_012118721.1|1212621_1213470_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	3.1e-37
>prophage 86
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1221054	1225951	4100473		Salmonella_phage(50.0%)	5	NA	NA
WP_015240794.1|1221054_1222257_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.4	1.1e-27
WP_132105635.1|1222479_1223718_+	MFS transporter	NA	NA	NA	NA	NA
WP_015418458.1|1223878_1224493_+	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_003151000.1|1224482_1225193_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_007407673.1|1225189_1225951_+	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	4.8e-21
>prophage 87
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1233819	1234719	4100473		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_039253434.1|1233819_1234719_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
>prophage 88
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1239464	1244274	4100473		Staphylococcus_phage(50.0%)	6	NA	NA
WP_020957981.1|1239464_1240385_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	1.7e-36
WP_053573954.1|1240482_1241037_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_015240785.1|1241037_1241313_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012118695.1|1241612_1242386_-	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151034.1|1242588_1242813_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_136396689.1|1242972_1244274_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
>prophage 89
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1256157	1257303	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_015240777.1|1256157_1257303_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	42.6	1.6e-76
>prophage 90
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1270435	1271899	4100473		Escherichia_phage(100.0%)	1	NA	NA
WP_076424664.1|1270435_1271899_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	43.6	4.2e-21
>prophage 91
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1275597	1278695	4100473		Bacillus_phage(100.0%)	3	NA	NA
WP_069006841.1|1275597_1277322_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.7	6.6e-58
WP_003151087.1|1277391_1277664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025285415.1|1277732_1278695_-	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	34.9	3.4e-40
>prophage 92
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1283149	1287655	4100473		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_007407615.1|1283149_1284757_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	2.8e-151
WP_160223328.1|1284804_1285326_-	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_012118670.1|1285490_1285865_+	sporulation initiation phosphotransferase Spo0F	NA	W8CYM9	Bacillus_phage	36.5	1.3e-11
WP_003151102.1|1286040_1286898_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_007407613.1|1287016_1287655_+	fructose-6-phosphate aldolase	NA	A0A1D7SX77	Cyanophage	50.0	4.3e-47
>prophage 93
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1292352	1292937	4100473		Mycoplasma_phage(100.0%)	1	NA	NA
WP_015240762.1|1292352_1292937_+	thymidine kinase	NA	Q6GYZ9	Mycoplasma_phage	39.1	3.7e-29
>prophage 94
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1297161	1298232	4100473		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003151139.1|1297161_1298232_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	3.1e-05
>prophage 95
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1301315	1306045	4100473		Pandoravirus(50.0%)	6	NA	NA
WP_007407602.1|1301315_1302356_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	42.7	1.2e-59
WP_015418417.1|1302424_1302982_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_007407600.1|1303055_1303511_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_003151149.1|1303644_1304094_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_007407598.1|1304107_1304650_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_015418416.1|1304797_1306045_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.4	1.5e-99
>prophage 96
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1317487	1318519	4100473		Pseudomonas_phage(100.0%)	1	NA	NA
WP_082998278.1|1317487_1318519_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	41.1	1.9e-44
>prophage 97
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1322826	1323957	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_007407584.1|1322826_1323957_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	41.7	1.2e-79
>prophage 98
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1333300	1334170	4100473		Clostridium_phage(100.0%)	1	NA	NA
WP_007407571.1|1333300_1334170_+	M23 family metallopeptidase	NA	I3PV24	Clostridium_phage	38.3	1.1e-05
>prophage 99
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1344028	1344310	4100473		Clostridium_phage(100.0%)	1	NA	NA
WP_003151236.1|1344028_1344310_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	50.7	9.4e-15
>prophage 100
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1350529	1361520	4100473		Listeria_phage(25.0%)	10	NA	NA
WP_003151249.1|1350529_1350871_+	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	63.2	3.2e-33
WP_015418394.1|1351079_1351862_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_132105688.1|1351858_1352716_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_059367658.1|1352828_1355603_-	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	26.3	4.6e-37
WP_015240739.1|1355589_1357200_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_003151259.1|1357403_1357547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407552.1|1357762_1358509_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_007614272.1|1358495_1359185_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	35.9	7.0e-27
WP_160223325.1|1359230_1359995_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_012118631.1|1360194_1361520_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.4	1.4e-87
>prophage 101
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1366864	1367581	4100473		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_160223323.1|1366864_1367581_+	endonuclease V	NA	A0A167R397	Powai_lake_megavirus	29.0	7.7e-21
>prophage 102
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1375967	1378403	4100473		Staphylococcus_phage(50.0%)	2	NA	NA
WP_025285383.1|1375967_1377299_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	30.6	3.1e-55
WP_007407528.1|1377494_1378403_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	1.2e-10
>prophage 103
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1384336	1385830	4100473		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_043021862.1|1384336_1385830_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.8	4.3e-13
>prophage 104
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1395727	1396963	4100473		Clostridioides_phage(100.0%)	1	NA	NA
WP_015240713.1|1395727_1396963_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.7	1.4e-17
>prophage 105
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1400136	1401513	4100473		Aichi_virus(100.0%)	1	NA	NA
WP_025285372.1|1400136_1401513_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	30.5	9.6e-36
>prophage 106
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1408022	1415120	4100473		Staphylococcus_virus(33.33%)	5	NA	NA
WP_160223315.1|1408022_1410668_+	SH3 domain-containing protein	NA	Q4ZC50	Staphylococcus_virus	44.8	1.3e-36
WP_160223314.1|1410729_1411896_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_012118587.1|1411928_1412699_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_003151361.1|1413054_1413444_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	43.4	1.1e-18
WP_160223313.1|1413581_1415120_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.7	7.8e-10
>prophage 107
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1419961	1427326	4100473		Bacillus_phage(50.0%)	6	NA	NA
WP_020956427.1|1419961_1420846_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.7	3.9e-83
WP_059367692.1|1421074_1422214_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.4	3.1e-24
WP_003151369.1|1422245_1423163_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160223311.1|1423343_1423661_+	LytA	NA	NA	NA	NA	NA
WP_160223310.1|1423693_1425814_+	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	29.8	2.6e-16
WP_160223309.1|1425835_1427326_+	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	31.3	4.6e-15
>prophage 108
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1430884	1432225	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_160223305.1|1430884_1432225_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.0	3.6e-88
>prophage 109
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1438986	1444226	4100473		Streptococcus_phage(66.67%)	5	NA	NA
WP_061581228.1|1438986_1439634_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	42.6	1.7e-38
WP_007407484.1|1439856_1441020_+	two-component sensor histidine kinase DegS	NA	NA	NA	NA	NA
WP_003219701.1|1441096_1441786_+	two-component system response regulator DegU	NA	NA	NA	NA	NA
WP_003151387.1|1441883_1442732_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.6	7.5e-15
WP_160223300.1|1442840_1444226_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.2	1.6e-59
>prophage 110
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1450165	1450390	4100473		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003151402.1|1450165_1450390_+	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	49.0	6.4e-06
>prophage 111
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1460853	1465444	4100473		Planktothrix_phage(50.0%)	4	NA	NA
WP_007407465.1|1460853_1461540_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.8	3.8e-25
WP_007407464.1|1461532_1462423_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_160223298.1|1462469_1463876_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_160223297.1|1464043_1465444_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.8	1.5e-23
>prophage 112
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1469670	1477752	4100473		Hokovirus(50.0%)	4	NA	NA
WP_160223295.1|1469670_1472172_-	phosphotransferase	NA	A0A1V0SGR7	Hokovirus	30.7	4.8e-33
WP_003151438.1|1472473_1472710_+	CsbA family protein	NA	NA	NA	NA	NA
WP_003151439.1|1472885_1474871_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_020954334.1|1474878_1477752_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	0.0e+00
>prophage 113
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1498487	1510299	4100473		Bacillus_phage(50.0%)	10	NA	NA
WP_015240668.1|1498487_1500257_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	60.0	4.1e-164
WP_012118540.1|1500452_1501130_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	56.6	9.8e-66
WP_007614006.1|1501126_1502188_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	38.8	1.2e-62
WP_015240667.1|1502303_1503758_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015240666.1|1504154_1505561_+	cell wall DL-endopeptidase	NA	A0A0A0RVE6	Bacillus_phage	52.6	2.4e-26
WP_007407423.1|1505767_1506718_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.9	3.7e-87
WP_003151491.1|1506991_1507459_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_012118535.1|1507484_1508372_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.8	5.1e-06
WP_007407422.1|1508368_1509322_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	39.9	2.6e-64
WP_007407421.1|1509348_1510299_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	6.6e-52
>prophage 114
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1515459	1518105	4100473		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_015240658.1|1515459_1517049_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.8	6.5e-44
WP_003151506.1|1517093_1517414_-	hypothetical protein	NA	G3MBI9	Bacillus_virus	43.3	2.3e-17
WP_015240657.1|1517529_1518105_+	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	26.4	2.0e-11
>prophage 115
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1521975	1522572	4100473		Agrobacterium_phage(100.0%)	1	NA	NA
WP_003151513.1|1521975_1522572_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	7.5e-54
>prophage 116
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1534181	1545129	4100473		Mollivirus(25.0%)	10	NA	NA
WP_160223287.1|1534181_1535630_-	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	34.4	1.0e-35
WP_003151541.1|1535710_1536166_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_031378299.1|1536410_1537118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407393.1|1537123_1537804_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_039063749.1|1538049_1539843_+	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	29.4	2.0e-25
WP_122504210.1|1539858_1540998_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_160223286.1|1540994_1541837_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	25.9	9.2e-05
WP_160223285.1|1541829_1542966_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_032867035.1|1542969_1544073_+	EpsG family protein	NA	NA	NA	NA	NA
WP_136396632.1|1544091_1545129_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	43.5	6.0e-14
>prophage 117
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1550008	1551181	4100473		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_007407381.1|1550008_1551181_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.6	2.0e-10
>prophage 118
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1583969	1585262	4100473		Streptococcus_phage(100.0%)	1	NA	NA
WP_007409956.1|1583969_1585262_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	71.0	1.9e-174
>prophage 119
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1588359	1593902	4100473		Tupanvirus(33.33%)	6	NA	NA
WP_025285296.1|1588359_1589490_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	31.0	8.4e-38
WP_160223278.1|1589486_1590416_+	NAD(P)-dependent oxidoreductase	NA	M1I3H4	Acanthocystis_turfacea_Chlorella_virus	28.0	5.5e-19
WP_160223277.1|1590381_1591638_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_015240612.1|1591649_1592531_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007409964.1|1592503_1593262_+	WbqC family protein	NA	NA	NA	NA	NA
WP_053574060.1|1593224_1593902_+	PIG-L family deacetylase	NA	A0A2D2W2P2	Stenotrophomonas_phage	28.3	1.1e-13
>prophage 120
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1601127	1602267	4100473	holin	Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003151651.1|1601127_1602267_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	7.3e-13
>prophage 121
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1605418	1609687	4100473	holin	Anomala_cuprea_entomopoxvirus(50.0%)	5	NA	NA
WP_014418902.1|1605418_1606564_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	4.3e-13
WP_007409977.1|1606580_1607234_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015240602.1|1607248_1608166_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_040238875.1|1608184_1608862_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007613824.1|1608973_1609687_+	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	46.6	5.7e-56
>prophage 122
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1613749	1619172	4100473		Thermus_phage(50.0%)	7	NA	NA
WP_069007388.1|1613749_1614181_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	64.2	6.5e-15
WP_003151677.1|1614205_1614616_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.0	7.8e-18
WP_087920807.1|1614811_1614997_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003151681.1|1615120_1615351_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_007409986.1|1615469_1616210_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_025285276.1|1616228_1618562_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.4	1.2e-86
WP_003151688.1|1618701_1619172_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.3	7.0e-47
>prophage 123
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1625726	1626506	4100473		Planktothrix_phage(100.0%)	1	NA	NA
WP_080130081.1|1625726_1626506_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	1.9e-36
>prophage 124
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1635597	1640288	4100473		uncultured_virus(50.0%)	2	NA	NA
WP_160223272.1|1635597_1638027_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.8	1.3e-115
WP_160223271.1|1638176_1640288_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.0	7.7e-117
>prophage 125
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1643322	1645638	4100473		Saudi_moumouvirus(100.0%)	1	NA	NA
WP_025285261.1|1643322_1645638_+	ATP-binding domain-containing protein	NA	A0A1S5V1I8	Saudi_moumouvirus	26.9	1.0e-05
>prophage 126
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1652474	1656538	4100473		Staphylococcus_phage(100.0%)	4	NA	NA
WP_007410023.1|1652474_1653305_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	54.9	2.7e-78
WP_160223270.1|1653337_1654483_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_094031275.1|1654484_1655579_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025285256.1|1655602_1656538_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	9.8e-24
>prophage 127
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1661044	1663425	4100473		Streptococcus_phage(50.0%)	2	NA	NA
WP_132105859.1|1661044_1662901_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	35.7	5.9e-89
WP_003151759.1|1662942_1663425_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.3	2.4e-10
>prophage 128
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1669000	1669804	4100473		Indivirus(100.0%)	1	NA	NA
WP_007613715.1|1669000_1669804_+	ABC transporter ATP-binding protein	NA	A0A1V0SD74	Indivirus	27.5	1.3e-08
>prophage 129
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1672951	1675410	4100473		Bacillus_phage(50.0%)	2	NA	NA
WP_003151779.1|1672951_1673671_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	2.3e-33
WP_015240563.1|1673667_1675410_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.7	9.7e-17
>prophage 130
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1679332	1680559	4100473		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160223266.1|1679332_1680559_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.2	1.7e-12
>prophage 131
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1695277	1698104	4100473		Bacillus_phage(33.33%)	3	NA	NA
WP_007410069.1|1695277_1695955_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	8.1e-28
WP_063094410.1|1696231_1697593_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.1	5.6e-20
WP_041482217.1|1697639_1698104_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	48.6	5.3e-31
>prophage 132
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1701658	1702483	4100473		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_012118397.1|1701658_1702483_+	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	28.6	3.2e-10
>prophage 133
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1715518	1727704	4100473		Streptococcus_phage(16.67%)	17	NA	NA
WP_003151843.1|1715518_1715875_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	51.9	2.9e-21
WP_003151844.1|1715934_1716318_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003151845.1|1716372_1716609_+	YusG family protein	NA	NA	NA	NA	NA
WP_032869737.1|1716678_1717044_+	TOPRIM domain-containing protein	NA	NA	NA	NA	NA
WP_003151847.1|1717046_1717367_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_007410085.1|1717463_1717814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223261.1|1718137_1719163_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	2.2e-32
WP_012118383.1|1719155_1719824_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012118382.1|1719837_1720653_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_088056427.1|1720737_1721124_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003151857.1|1721316_1721469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003327022.1|1721645_1722431_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	23.6	6.5e-05
WP_015240539.1|1722448_1723762_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_007410089.1|1723761_1724982_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.6	6.8e-118
WP_003151877.1|1724971_1725415_+	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	39.4	1.8e-15
WP_007410090.1|1725434_1726832_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_015240537.1|1726867_1727704_-	chitosanase	NA	A0A223LHY0	Streptomyces_phage	31.4	2.6e-20
>prophage 134
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1734318	1735305	4100473		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_032867108.1|1734318_1735305_+	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	25.7	7.7e-11
>prophage 135
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1740223	1741330	4100473		Mycoplasma_phage(100.0%)	1	NA	NA
WP_122504183.1|1740223_1741330_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	47.3	2.8e-17
>prophage 136
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1745083	1750322	4100473	transposase	Bodo_saltans_virus(33.33%)	4	NA	NA
WP_160223257.1|1745083_1746280_+	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	20.5	2.0e-05
WP_160223256.1|1746337_1747471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223255.1|1747809_1748960_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
WP_160223254.1|1749194_1750322_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.8	1.0e-88
>prophage 137
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1758249	1762610	4100473		Staphylococcus_phage(50.0%)	6	NA	NA
WP_160223252.1|1758249_1759227_-	M23 family metallopeptidase	NA	A0A1J0MFP9	Staphylococcus_phage	36.2	4.6e-08
WP_003151923.1|1759429_1760326_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003151928.1|1760542_1760818_+	YutD family protein	NA	NA	NA	NA	NA
WP_007408729.1|1760843_1761278_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_007408728.1|1761311_1762082_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_003151934.1|1762109_1762610_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.4	6.8e-40
>prophage 138
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1769387	1774507	4100473		Prochlorococcus_phage(33.33%)	7	NA	NA
WP_003151955.1|1769387_1769624_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	44.3	2.9e-09
WP_015418136.1|1769802_1770129_+	YuzD family protein	NA	NA	NA	NA	NA
WP_007613539.1|1770166_1771234_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007408721.1|1771500_1771737_+	YuzB family protein	NA	NA	NA	NA	NA
WP_012118346.1|1771870_1773088_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	23.5	7.0e-14
WP_043020740.1|1773211_1774066_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003151967.1|1774144_1774507_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	44.9	1.4e-18
>prophage 139
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1779291	1788301	4100473		Staphylococcus_phage(20.0%)	11	NA	NA
WP_015240505.1|1779291_1779996_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.7	9.9e-29
WP_025285208.1|1779992_1780520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003151978.1|1780536_1780758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015240502.1|1780818_1781799_-	GMP reductase	NA	G3MBI2	Bacillus_virus	82.8	1.7e-156
WP_003151984.1|1782199_1783195_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	51.6	2.3e-31
WP_041482027.1|1783506_1784727_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007408708.1|1784900_1785026_+	YuiA family protein	NA	NA	NA	NA	NA
WP_025285206.1|1785094_1785415_+	membrane protein	NA	NA	NA	NA	NA
WP_015240498.1|1785515_1786157_+	3D domain-containing protein	NA	A0A127AW72	Bacillus_phage	43.2	2.8e-14
WP_025285204.1|1786186_1786663_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_007613484.1|1786810_1788301_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.0	3.7e-57
>prophage 140
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1796886	1804014	4100473		Tupanvirus(100.0%)	1	NA	NA
WP_160223250.1|1796886_1804014_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.0	7.8e-97
>prophage 141
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1809831	1814307	4100473		Mycobacterium_phage(100.0%)	1	NA	NA
WP_160223248.1|1809831_1814307_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.3	2.2e-33
>prophage 142
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1822746	1824213	4100473		Bacillus_virus(100.0%)	1	NA	NA
WP_020954301.1|1822746_1824213_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.9	1.1e-117
>prophage 143
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1839492	1841025	4100473		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_160223243.1|1839492_1841025_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.5	6.3e-12
>prophage 144
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1872075	1881059	4100473		uncultured_Caudovirales_phage(80.0%)	5	NA	NA
WP_160223233.1|1872075_1874061_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.7	9.4e-16
WP_032867208.1|1874245_1876234_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.2	5.5e-16
WP_099567041.1|1876361_1878347_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.9	1.4e-14
WP_012118283.1|1878462_1880469_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.0	2.1e-15
WP_003152143.1|1880534_1881059_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	35.4	2.6e-18
>prophage 145
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1887193	1888039	4100473		Brevibacillus_phage(100.0%)	1	NA	NA
WP_007410172.1|1887193_1888039_+	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	1.1e-26
>prophage 146
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1894924	1896454	4100473		Orpheovirus(100.0%)	1	NA	NA
WP_160223232.1|1894924_1896454_+	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	2.1e-07
>prophage 147
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1911023	1913599	4100473		Staphylococcus_phage(50.0%)	2	NA	NA
WP_015240439.1|1911023_1912487_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	34.9	1.0e-75
WP_038459593.1|1912483_1913599_+	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	22.2	1.9e-13
>prophage 148
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1917722	1930192	4100473	holin	Staphylococcus_phage(57.14%)	15	NA	NA
WP_003152235.1|1917722_1917950_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	66.2	6.9e-24
WP_003152237.1|1918075_1918549_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_100001563.1|1918663_1919107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007408836.1|1919103_1919253_-	YtzI protein	NA	NA	NA	NA	NA
WP_007408835.1|1919377_1919815_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	2.2e-47
WP_007408834.1|1919966_1920371_+|holin	holin family protein	holin	NA	NA	NA	NA
WP_003152244.1|1920503_1920983_+	nucleoside triphosphatase YtkD	NA	NA	NA	NA	NA
WP_012118258.1|1921018_1921831_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003152246.1|1921805_1922588_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.0	1.6e-32
WP_007408830.1|1922599_1923604_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015240429.1|1923741_1924515_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	39.0	4.9e-37
WP_003152249.1|1924572_1924815_+	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_007408828.1|1924857_1926441_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.4	2.8e-196
WP_003152253.1|1926947_1928150_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	74.4	9.6e-165
WP_160223231.1|1928293_1930192_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	28.3	1.3e-30
>prophage 149
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1934785	1936332	4100473		Staphylococcus_phage(100.0%)	2	NA	NA
WP_003152267.1|1934785_1935367_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	53.7	8.1e-45
WP_007408822.1|1935363_1936332_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	74.5	3.2e-54
>prophage 150
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1941037	1941916	4100473		Staphylococcus_phage(100.0%)	1	NA	NA
WP_007613240.1|1941037_1941916_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	1.4e-19
>prophage 151
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1944924	1945620	4100473		Planktothrix_phage(100.0%)	1	NA	NA
WP_032871660.1|1944924_1945620_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	1.0e-38
>prophage 152
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1948778	1958068	4100473	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
WP_015240420.1|1948778_1949534_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	35.8	1.3e-18
WP_160223225.1|1949530_1951471_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038459565.1|1951578_1952298_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_160223224.1|1952493_1953678_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	52.3	1.3e-100
WP_007408808.1|1953720_1954506_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_015418038.1|1954893_1955229_+	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_038459560.1|1955653_1958068_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.6	0.0e+00
>prophage 153
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1964905	1967886	4100473		Vibrio_phage(50.0%)	2	NA	NA
WP_007613202.1|1964905_1966441_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	4.7e-23
WP_007408798.1|1966620_1967886_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.0	3.4e-27
>prophage 154
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1971136	1976832	4100473		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_007408794.1|1971136_1971841_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.1	3.8e-20
WP_038459546.1|1971837_1972998_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014418668.1|1973031_1974336_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.4	1.2e-48
WP_038459543.1|1974431_1975823_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_020954278.1|1975860_1976832_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.1	1.2e-80
>prophage 155
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1986901	1991105	4100473		Staphylococcus_phage(50.0%)	3	NA	NA
WP_012118213.1|1986901_1987711_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	51.5	9.0e-34
WP_094031890.1|1987725_1988331_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_160223220.1|1988498_1991105_+	DUF87 domain-containing protein	NA	S5VNE3	Mycobacterium_phage	49.3	9.2e-88
>prophage 156
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	1994255	1995332	4100473		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_003152383.1|1994255_1995332_+	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	28.7	8.1e-14
>prophage 157
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2000811	2004132	4100473	tRNA	Staphylococcus_phage(50.0%)	2	NA	NA
WP_012118204.1|2000811_2002530_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	72.1	7.2e-206
WP_160223217.1|2002866_2004132_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.8	8.4e-79
>prophage 158
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2008144	2011846	4100473	integrase	Staphylococcus_phage(50.0%)	6	2008393:2008406	2019570:2019583
WP_082998837.1|2008144_2008897_+	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	46.3	7.3e-54
2008393:2008406	attL	CAGCGGCGTTAATA	NA	NA	NA	NA
WP_025285115.1|2009182_2009692_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_007408759.1|2009861_2010089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108725290.1|2010094_2010169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082998836.1|2010326_2011517_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_099320110.1|2011627_2011846_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	68.5	3.6e-14
2019570:2019583	attR	TATTAACGCCGCTG	NA	NA	NA	NA
>prophage 159
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2014854	2018901	4100473		Bacillus_phage(100.0%)	4	NA	NA
WP_059368222.1|2014854_2015967_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	97.3	5.1e-205
WP_003152406.1|2016259_2016862_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_015418007.1|2016890_2017115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007408036.1|2017152_2018901_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.5	1.5e-20
>prophage 160
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2026938	2032526	4100473		Bacillus_phage(33.33%)	5	NA	NA
WP_007408043.1|2026938_2027160_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	82.1	8.2e-22
WP_012118182.1|2027308_2028895_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.0	1.9e-75
WP_160223214.1|2028918_2030514_+	amidohydrolase	NA	NA	NA	NA	NA
WP_025285105.1|2030530_2031337_-	NAD kinase	NA	NA	NA	NA	NA
WP_003152419.1|2031518_2032526_+	signal peptide peptidase SppA	NA	Q6UAX7	Klebsiella_phage	27.8	1.2e-16
>prophage 161
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2046762	2050101	4100473		Saccharomonospora_phage(100.0%)	1	NA	NA
WP_160223212.1|2046762_2050101_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	34.7	5.0e-179
>prophage 162
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2063028	2073951	4100473		Bacillus_phage(50.0%)	9	NA	NA
WP_003152454.1|2063028_2064300_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	4.0e-12
WP_003152455.1|2064345_2065284_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003152457.1|2065499_2066219_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.3	5.0e-44
WP_124692782.1|2066211_2067951_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	42.4	2.0e-46
WP_082998824.1|2068197_2070837_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	29.2	5.4e-43
WP_025285093.1|2070861_2071692_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	31.2	2.5e-23
WP_003152461.1|2071828_2072461_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_082998823.1|2072476_2073070_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_007408081.1|2073108_2073951_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	51.5	5.1e-80
>prophage 163
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2077247	2090411	4100473	holin,tRNA	Synechococcus_phage(20.0%)	13	NA	NA
WP_003152471.1|2077247_2077628_+	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.8	2.1e-17
WP_003152473.1|2077876_2078335_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_082998822.1|2078446_2079856_+	Replication initiation and membrane attachment protein	NA	NA	NA	NA	NA
WP_020956184.1|2079880_2080816_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	30.4	4.4e-32
WP_007408086.1|2080847_2081489_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_032871714.1|2081554_2082385_+	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_007613029.1|2082794_2084726_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.5	1.3e-110
WP_015240354.1|2084780_2085575_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_082998821.1|2085761_2087543_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.8	1.6e-75
WP_007408091.1|2087520_2088255_+	response regulator	NA	NA	NA	NA	NA
WP_007408092.1|2088384_2088822_+|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_007408093.1|2088834_2089518_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_071543361.1|2089889_2090411_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.5	9.3e-16
>prophage 164
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2112208	2126094	4100473	tRNA,transposase	Staphylococcus_phage(40.0%)	11	NA	NA
WP_003152530.1|2112208_2113243_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	32.4	5.0e-29
WP_160223210.1|2113256_2115671_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_160223007.1|2115786_2116936_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
WP_012118136.1|2116996_2117938_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_007408114.1|2118071_2118329_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_025285079.1|2118336_2118870_+	CvpA family protein	NA	NA	NA	NA	NA
WP_160223209.1|2118975_2120688_+	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	23.6	3.2e-12
WP_025285077.1|2120708_2123066_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	42.5	1.1e-15
WP_003152541.1|2123082_2123487_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_160223208.1|2123625_2124300_-	DUF2711 family protein	NA	NA	NA	NA	NA
WP_160223207.1|2124405_2126094_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.6	6.9e-36
>prophage 165
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2131207	2131522	4100473		Indivirus(100.0%)	1	NA	NA
WP_003152560.1|2131207_2131522_+	thioredoxin	NA	A0A1V0SD63	Indivirus	43.0	3.5e-10
>prophage 166
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2139603	2139828	4100473		Caldibacillus_phage(100.0%)	1	NA	NA
WP_003152579.1|2139603_2139828_+	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	77.0	1.5e-15
>prophage 167
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2143331	2143928	4100473		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_087920775.1|2143331_2143928_+	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	31.7	1.1e-09
>prophage 168
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2152615	2157449	4100473		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_025285068.1|2152615_2154340_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	29.4	2.0e-59
WP_025285067.1|2154336_2154855_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003152600.1|2154877_2155906_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_160223203.1|2155892_2157449_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	34.1	1.0e-09
>prophage 169
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2163535	2169139	4100473	protease	Bacillus_virus(33.33%)	3	NA	NA
WP_007408149.1|2163535_2164798_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
WP_059368021.1|2164956_2166615_+|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	3.3e-14
WP_052827698.1|2166814_2169139_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	1.4e-183
>prophage 170
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2180465	2183108	4100473	tRNA	Catovirus(100.0%)	1	NA	NA
WP_044801613.1|2180465_2183108_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
>prophage 171
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2199002	2200154	4100473		Faustovirus(100.0%)	1	NA	NA
WP_025285057.1|2199002_2200154_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A141ZJV0	Faustovirus	29.9	1.7e-30
>prophage 172
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2207463	2211179	4100473	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_007408185.1|2207463_2208468_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	4.0e-07
WP_003152687.1|2208460_2208661_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003152692.1|2208686_2209715_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_007408186.1|2209742_2210888_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
WP_012118091.1|2210918_2211179_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	48.4	6.7e-07
>prophage 173
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2214451	2231230	4100473	tRNA	Bacillus_phage(25.0%)	13	NA	NA
WP_160223194.1|2214451_2216671_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.7	3.5e-27
WP_012118088.1|2216802_2217300_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_160223193.1|2217363_2217690_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_160223192.1|2217745_2220106_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	1.4e-90
WP_003152714.1|2220111_2220624_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_003152716.1|2220781_2222986_+	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_007408194.1|2222998_2223442_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_138092686.1|2223467_2225030_-	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	2.0e-13
WP_020956141.1|2225160_2225331_+	YrzK family protein	NA	NA	NA	NA	NA
WP_012118082.1|2225687_2226962_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_020956140.1|2226976_2228755_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.1	8.7e-13
WP_025285046.1|2229080_2229845_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	33.5	2.2e-21
WP_015240288.1|2229961_2231230_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.6	1.5e-112
>prophage 174
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2234877	2237256	4100473		Brevibacillus_phage(100.0%)	1	NA	NA
WP_017418224.1|2234877_2237256_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.6	2.6e-81
>prophage 175
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2240455	2245433	4100473	tRNA	Planktothrix_phage(50.0%)	3	NA	NA
WP_007408209.1|2240455_2241184_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	1.5e-35
WP_007612803.1|2241403_2242465_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_132105431.1|2242796_2245433_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.1	3.1e-67
>prophage 176
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2249463	2251374	4100473		Phage_TP(50.0%)	2	NA	NA
WP_003152759.1|2249463_2250732_+	U32 family peptidase	NA	Q6DW11	Phage_TP	32.1	7.3e-38
WP_003152763.1|2250738_2251374_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	4.1e-34
>prophage 177
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2256519	2258587	4100473		Lactococcus_phage(50.0%)	2	NA	NA
WP_160223191.1|2256519_2257443_+	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	43.4	8.4e-60
WP_160223190.1|2257444_2258587_+	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	28.8	3.6e-20
>prophage 178
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2266508	2269670	4100473		Mycobacterium_phage(100.0%)	1	NA	NA
WP_082998779.1|2266508_2269670_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.3	6.4e-75
>prophage 179
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2282879	2283389	4100473		Streptococcus_phage(100.0%)	1	NA	NA
WP_160223188.1|2282879_2283389_+	streptothricin N-acetyltransferase SatA	NA	A0A1B0RXL7	Streptococcus_phage	50.0	6.0e-44
>prophage 180
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2289654	2290377	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_003152837.1|2289654_2290377_-	RNA polymerase sporulation sigma factor SigK	NA	A0A0A0RV91	Bacillus_phage	27.1	7.3e-11
>prophage 181
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2298447	2299017	4100473		Bacillus_virus(100.0%)	1	NA	NA
WP_007408258.1|2298447_2299017_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	30.2	3.6e-21
>prophage 182
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2302304	2305226	4100473		Bacillus_phage(50.0%)	2	NA	NA
WP_094031848.1|2302304_2302874_+	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	56.3	3.7e-34
WP_094031847.1|2302874_2305226_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	33.9	1.6e-38
>prophage 183
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2309989	2317947	4100473		Streptococcus_phage(33.33%)	6	NA	NA
WP_015240241.1|2309989_2311825_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.2	7.6e-20
WP_059368095.1|2311884_2313024_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_003152889.1|2313104_2314136_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003152892.1|2314195_2314771_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_007408273.1|2314795_2316634_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.5	4.0e-138
WP_003152895.1|2316819_2317947_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.7	6.7e-27
>prophage 184
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2322377	2322824	4100473		Bacillus_virus(100.0%)	1	NA	NA
WP_007408278.1|2322377_2322824_+	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	41.2	2.9e-18
>prophage 185
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2327285	2328245	4100473		Rhizobium_phage(100.0%)	1	NA	NA
WP_007408283.1|2327285_2328245_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	44.7	1.8e-52
>prophage 186
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2339391	2349343	4100473	tRNA	Caulobacter_phage(20.0%)	9	NA	NA
WP_007408290.1|2339391_2341203_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	30.8	3.1e-50
WP_003152998.1|2341395_2342517_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.1	5.8e-39
WP_003152999.1|2342867_2343230_+	cytochrome c	NA	NA	NA	NA	NA
WP_012118009.1|2343355_2344060_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_015240228.1|2344052_2345174_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	48.0	6.4e-22
WP_029326068.1|2345194_2346139_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_012118006.1|2346261_2346957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160223185.1|2347122_2348439_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	7.5e-54
WP_012118004.1|2348449_2349343_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	31.5	1.9e-24
>prophage 187
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2355534	2356140	4100473		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_160223182.1|2355534_2356140_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.6	1.6e-67
>prophage 188
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2359956	2364340	4100473		Bacillus_virus(66.67%)	5	NA	NA
WP_007408304.1|2359956_2360859_+	phosphate ABC transporter substrate-binding protein	NA	R9S7J3	Prochlorococcus_phage	29.1	1.7e-12
WP_012117997.1|2360907_2361837_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_160223181.1|2361836_2362721_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_160223180.1|2362739_2363546_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	1.6e-14
WP_003153040.1|2363557_2364340_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.1	2.4e-15
>prophage 189
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2386120	2395126	4100473		Prochlorococcus_phage(50.0%)	8	NA	NA
WP_124934996.1|2386120_2387791_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	31.5	2.8e-61
WP_032866432.1|2388214_2389315_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_059368121.1|2389329_2390676_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.7	3.9e-58
WP_160223171.1|2390668_2392144_+	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	42.5	1.1e-85
WP_007408335.1|2392197_2392578_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_094031831.1|2392771_2393608_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_007408338.1|2393707_2394136_+	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_094031830.1|2394250_2395126_+	patatin-like phospholipase family protein	NA	A0A1V0SFX9	Hokovirus	27.4	2.7e-15
>prophage 190
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2407912	2410231	4100473		Enterococcus_phage(50.0%)	2	NA	NA
WP_007408350.1|2407912_2408764_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	43.9	1.7e-43
WP_007408351.1|2408887_2410231_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	39.1	2.3e-42
>prophage 191
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2418284	2420415	4100473		Bacillus_phage(50.0%)	2	NA	NA
WP_003153177.1|2418284_2419085_+	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	35.3	4.2e-07
WP_094031829.1|2419233_2420415_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.2	1.7e-28
>prophage 192
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2424962	2426414	4100473		Bacillus_phage(50.0%)	2	NA	NA
WP_160223168.1|2424962_2425589_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1S5QTQ1	Bacillus_phage	38.8	7.7e-17
WP_015240188.1|2425676_2426414_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	30.1	3.7e-18
>prophage 193
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2443770	2447731	4100473		Catovirus(50.0%)	5	NA	NA
WP_160223165.1|2443770_2444667_-	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	23.9	9.4e-16
WP_003153223.1|2444845_2445283_+	bacilliredoxin BrxB	NA	NA	NA	NA	NA
WP_015240174.1|2445527_2446295_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003153227.1|2446356_2447016_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_064115739.1|2447008_2447731_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.5e-37
>prophage 194
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2455327	2458296	4100473		Synechococcus_phage(50.0%)	2	NA	NA
WP_007408395.1|2455327_2456737_+	NADP-dependent phosphogluconate dehydrogenase	NA	V5UT40	Synechococcus_phage	34.2	7.5e-36
WP_012117935.1|2456826_2458296_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	38.8	1.6e-81
>prophage 195
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2469635	2489324	4100473		Paenibacillus_phage(66.67%)	3	NA	NA
WP_025284970.1|2469635_2470373_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	1.7e-15
WP_160223161.1|2470412_2483009_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.2	5.2e-35
WP_160223160.1|2483027_2489324_+	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	27.7	3.0e-31
>prophage 196
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2510763	2530869	4100473		Paenibacillus_phage(100.0%)	3	NA	NA
WP_160223157.1|2510763_2518482_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	28.3	4.6e-34
WP_160223156.1|2518504_2524657_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	28.6	1.3e-34
WP_160223155.1|2524653_2530869_+	zinc-binding dehydrogenase	NA	D0R7J2	Paenibacillus_phage	29.2	5.7e-35
>prophage 197
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2534251	2535091	4100473		Streptococcus_phage(100.0%)	1	NA	NA
WP_012117916.1|2534251_2535091_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.7	5.9e-28
>prophage 198
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2538670	2550595	4100473		uncultured_Mediterranean_phage(16.67%)	19	NA	NA
WP_003153290.1|2538670_2539630_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	36.1	2.6e-32
WP_154019859.1|2539654_2540044_+	hypothetical protein	NA	V5UQY3	Oenococcus_phage	52.4	2.4e-32
WP_122504109.1|2540045_2540213_-	DUF4083 domain-containing protein	NA	NA	NA	NA	NA
WP_160223153.1|2540304_2541375_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003153294.1|2541448_2541655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409390.1|2541753_2542098_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_015240144.1|2542113_2543340_-	DNA polymerase IV	NA	O64031	Bacillus_phage	44.6	1.1e-78
WP_012117908.1|2543555_2544026_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007409393.1|2544038_2544383_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_033574750.1|2544379_2545348_+	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	42.3	3.1e-33
WP_014305346.1|2545419_2545782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153307.1|2545756_2545996_+	DUF2552 domain-containing protein	NA	NA	NA	NA	NA
WP_025284954.1|2546035_2546950_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_094031820.1|2547069_2547297_+	YqkE family protein	NA	NA	NA	NA	NA
WP_012117903.1|2547329_2548250_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.7	1.3e-07
WP_003153315.1|2548312_2548435_-	Z-ring formation inhibitor MciZ	NA	NA	NA	NA	NA
WP_003153317.1|2548513_2549068_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_132105309.1|2549067_2550231_+	TIGR00375 family protein	NA	NA	NA	NA	NA
WP_007409399.1|2550241_2550595_-	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	36.7	4.1e-07
>prophage 199
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2558420	2564464	4100473		Brevibacillus_phage(25.0%)	7	NA	NA
WP_007612347.1|2558420_2559311_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.7	1.3e-41
WP_015240135.1|2559478_2560663_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_007409407.1|2560674_2561493_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	48.0	9.7e-68
WP_094031818.1|2561629_2562799_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.6	4.3e-37
WP_007409411.1|2562894_2563248_+	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_003153347.1|2563244_2563685_+	anti-sigma F factor	NA	NA	NA	NA	NA
WP_015240133.1|2563696_2564464_+	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	60.9	1.3e-71
>prophage 200
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2572189	2582998	4100473		Staphylococcus_phage(50.0%)	15	NA	NA
WP_003153363.1|2572189_2572621_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	36.6	9.4e-14
WP_015240128.1|2572769_2573261_+	DUF1453 family protein	NA	NA	NA	NA	NA
WP_032861567.1|2573341_2573917_+	signal peptidase I	NA	NA	NA	NA	NA
WP_007409423.1|2574164_2574509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223151.1|2574906_2576022_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	9.8e-55
WP_007409425.1|2576002_2576650_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_003153371.1|2576664_2577861_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_003153372.1|2577893_2578358_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153373.1|2578474_2578849_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153375.1|2578914_2579436_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153376.1|2579523_2579613_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_160223150.1|2579820_2580576_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.2e-10
WP_160223149.1|2580565_2581159_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.0	9.9e-14
WP_076425394.1|2581248_2581734_+	DUF3907 family protein	NA	NA	NA	NA	NA
WP_160223148.1|2581846_2582998_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.6	6.0e-07
>prophage 201
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2588469	2598665	4100473		Bacillus_phage(60.0%)	9	NA	NA
WP_003153397.1|2588469_2589192_+	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	42.6	2.9e-44
WP_025284944.1|2589188_2590970_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	38.1	3.0e-37
WP_003153399.1|2591160_2591745_+	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_072589347.1|2591719_2592781_+	sugar dehydratase	NA	NA	NA	NA	NA
WP_007409437.1|2592827_2594405_-	phosphoglycerate dehydrogenase	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	32.8	1.1e-27
WP_076982870.1|2594833_2595466_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003153403.1|2595606_2595855_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	56.8	1.6e-18
WP_160223147.1|2596123_2597182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223146.1|2597174_2598665_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	37.9	9.7e-58
>prophage 202
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2605572	2606442	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_025284936.1|2605572_2606442_+	spore cortex-lytic enzyme	NA	A0A172JHR8	Bacillus_phage	40.0	1.5e-21
>prophage 203
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2618692	2625359	4100473		Bacillus_phage(25.0%)	9	NA	NA
WP_003153447.1|2618692_2618971_+	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	75.3	1.1e-28
WP_003153448.1|2619157_2619730_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.7	1.3e-50
WP_003153449.1|2619750_2619978_+	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_015240105.1|2620134_2620890_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003153453.1|2620895_2621597_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_095532168.1|2621538_2622588_+	heptaprenyl diphosphate synthase component II	NA	NA	NA	NA	NA
WP_012117865.1|2622708_2623155_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.0	8.2e-29
WP_132105285.1|2623344_2624115_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_003153459.1|2624186_2625359_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.5	5.0e-41
>prophage 204
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2628569	2634056	4100473		Acinetobacter_phage(66.67%)	6	NA	NA
WP_160223144.1|2628569_2629586_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.5	2.2e-53
WP_012117859.1|2629578_2630331_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	41.3	1.5e-43
WP_160223143.1|2630335_2630989_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_015417720.1|2630969_2632172_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_160223142.1|2632164_2632962_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_007409465.1|2632973_2634056_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.5	9.0e-21
>prophage 205
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2639469	2640009	4100473		Bacillus_virus(100.0%)	1	NA	NA
WP_003153482.1|2639469_2640009_+	YpiB family protein	NA	G3MAV7	Bacillus_virus	48.6	1.6e-42
>prophage 206
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2645406	2646279	4100473		Streptococcus_phage(100.0%)	1	NA	NA
WP_003153493.1|2645406_2646279_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.5	2.4e-72
>prophage 207
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2649846	2809035	4100473	terminase,integrase,tail,tRNA,coat,holin	Bacillus_phage(83.93%)	196	2739935:2739958	2780404:2780427
WP_059368453.1|2649846_2651037_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	31.7	3.6e-39
WP_059368452.1|2651021_2651999_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_094031800.1|2652243_2653077_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	38.3	1.3e-51
WP_012117844.1|2653080_2653941_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_094031799.1|2653942_2654326_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_160223141.1|2654447_2657234_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	29.0	8.7e-60
WP_003153512.1|2657381_2657552_+	YpmA family protein	NA	NA	NA	NA	NA
WP_007409483.1|2657561_2658047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007612190.1|2658069_2659251_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_060562796.1|2659385_2660678_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.5	6.0e-56
WP_003153516.1|2660773_2661472_+	DnaD domain-containing protein	NA	NA	NA	NA	NA
WP_076425357.1|2661490_2662150_+	endonuclease III	NA	NA	NA	NA	NA
WP_032870046.1|2662146_2662638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025284919.1|2662715_2665499_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_094031925.1|2665537_2666146_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	34.9	2.0e-22
WP_014418234.1|2666187_2667150_+	DUF2515 domain-containing protein	NA	NA	NA	NA	NA
WP_003153525.1|2667193_2667298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015240083.1|2667503_2667749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007409492.1|2667794_2668163_+	YppE family protein	NA	NA	NA	NA	NA
WP_003153532.1|2668201_2668384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409493.1|2668570_2669005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017418017.1|2669034_2669448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012117833.1|2669586_2670093_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_012117832.1|2670191_2672438_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.3	9.6e-09
WP_025284914.1|2672457_2673696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007409498.1|2673829_2673925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153539.1|2674008_2674245_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007409499.1|2674333_2674882_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_003153541.1|2674961_2675261_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_160223140.1|2675794_2676961_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003153548.1|2677001_2677154_-	YpzG family protein	NA	NA	NA	NA	NA
WP_003153550.1|2677319_2677511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012117827.1|2677614_2679534_+	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.8	1.4e-11
WP_094031794.1|2679645_2681148_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_007409503.1|2681480_2682065_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_160229000.1|2682479_2684021_-	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	31.4	3.5e-34
WP_160228998.1|2684269_2685232_-	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.9	2.9e-79
WP_160229023.1|2685503_2685938_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014470068.1|2685981_2686752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228996.1|2687260_2688976_+	ribonuclease YeeF family protein	NA	O64023	Bacillus_phage	74.4	3.9e-244
WP_064778459.1|2688984_2689473_+	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	90.7	9.4e-87
WP_082921264.1|2689759_2690242_+	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	66.2	9.7e-60
WP_076982784.1|2690547_2690637_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_064778345.1|2690839_2691181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076982785.1|2691309_2692068_+	sporulation protein YunB	NA	NA	NA	NA	NA
WP_064778347.1|2692284_2692617_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	73.6	6.9e-41
WP_046559826.1|2692609_2693860_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	92.1	2.1e-223
WP_020954197.1|2694023_2695184_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.5	1.3e-33
WP_099762739.1|2695335_2695641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470077.1|2695979_2696231_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	85.5	6.9e-33
WP_014472511.1|2696243_2696615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005041.1|2696721_2697768_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	54.7	1.1e-87
WP_160229021.1|2697940_2700493_-	hypothetical protein	NA	D6R401	Bacillus_phage	37.4	2.6e-135
WP_079005043.1|2700536_2701352_-	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	63.2	2.1e-94
WP_160228994.1|2704683_2705445_-|tail	phage tail protein	tail	A0A1P8CWP8	Bacillus_phage	79.7	4.3e-110
WP_160228992.1|2705489_2712374_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	77.1	0.0e+00
WP_014417859.1|2712438_2713065_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	28.9	3.1e-18
WP_071181782.1|2713221_2713653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071181783.1|2713654_2713921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071181784.1|2713877_2714468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160229019.1|2714683_2715667_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2FM05	Brevibacillus_phage	59.4	1.8e-108
WP_160228990.1|2715674_2716091_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	66.9	9.0e-46
WP_020954185.1|2716090_2716576_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	65.2	1.8e-53
WP_160229017.1|2716656_2716851_-	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	63.0	2.0e-11
WP_160228988.1|2717184_2718519_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	33.9	1.9e-25
WP_022553073.1|2718518_2718875_-	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
WP_014470099.1|2718946_2719414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228986.1|2719434_2720232_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	36.8	2.0e-17
WP_160228984.1|2720270_2720996_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	31.8	4.7e-26
WP_160228983.1|2720992_2721499_-	hypothetical protein	NA	O64060	Bacillus_phage	67.3	4.4e-63
WP_160228981.1|2721495_2722161_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	53.6	3.1e-48
WP_029974497.1|2722157_2722478_-	hypothetical protein	NA	U5J9I5	Bacillus_phage	37.9	9.7e-16
WP_041481804.1|2722474_2722783_-	hypothetical protein	NA	A0A0H3UZ42	Geobacillus_virus	42.9	4.3e-13
WP_022553077.1|2722918_2723452_-	hypothetical protein	NA	A0A0K2FLE1	Brevibacillus_phage	40.8	3.9e-25
WP_014417872.1|2723504_2724497_-	hypothetical protein	NA	E0YJ30	Lactococcus_phage	31.6	2.0e-35
WP_014417873.1|2724521_2725064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102421760.1|2725088_2726525_-	hypothetical protein	NA	A0A0K2FMA5	Brevibacillus_phage	32.9	6.2e-62
WP_160228979.1|2726599_2728042_-	hypothetical protein	NA	U5J9V5	Bacillus_phage	39.7	2.7e-89
WP_102421749.1|2728068_2729883_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_160228977.1|2729875_2730925_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	47.3	3.1e-26
WP_160228975.1|2731136_2731334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029974508.1|2731779_2732154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228973.1|2732186_2733386_-	metallophosphoesterase	NA	A0A0N9SK37	Staphylococcus_phage	37.5	3.7e-68
WP_069007089.1|2733397_2733598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228972.1|2733845_2734076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228970.1|2735453_2735729_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	82.4	3.7e-32
WP_160228968.1|2735846_2736644_-	hypothetical protein	NA	Q331U9	Clostridium_botulinum_C_phage	25.7	4.6e-06
WP_160228966.1|2736643_2739418_-	hypothetical protein	NA	H7BV05	unidentified_phage	28.4	9.5e-99
WP_160228964.1|2739431_2739668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228962.1|2739741_2739921_-	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	69.5	5.8e-18
2739935:2739958	attL	ACTATTTTATTTTTATTCTTAAAA	NA	NA	NA	NA
WP_038458718.1|2740040_2740277_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038458716.1|2740455_2740740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228960.1|2740739_2741852_+	cell division protein FtsZ	NA	G3MBK4	Bacillus_virus	29.8	1.1e-29
WP_041482523.1|2742833_2743013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228958.1|2743314_2743554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228956.1|2743634_2744852_+	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	82.7	1.0e-198
WP_077722267.1|2745157_2745691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228954.1|2745815_2746067_+	hypothetical protein	NA	F8WPK6	Bacillus_phage	66.3	7.1e-30
WP_160228953.1|2746080_2746353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228951.1|2746408_2746558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228949.1|2746603_2746834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228947.1|2747040_2747223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228945.1|2747439_2748531_-	acyltransferase	NA	A9YX16	Burkholderia_phage	25.0	6.5e-11
WP_160228943.1|2748835_2749273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470137.1|2749366_2749570_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	80.3	4.0e-23
WP_014470138.1|2749686_2749878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470139.1|2749909_2750287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246775.1|2750324_2750639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079005072.1|2750698_2751088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246776.1|2751117_2751393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228941.1|2751438_2751702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079005075.1|2751817_2752450_+	hypothetical protein	NA	A0A1P8CWV5	Bacillus_phage	52.4	2.2e-51
WP_104679114.1|2752495_2752720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417903.1|2752734_2752917_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	87.9	1.7e-25
WP_160228939.1|2752987_2753239_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	62.7	1.9e-22
WP_160228937.1|2753241_2753457_+	hypothetical protein	NA	A0A1P8CWW0	Bacillus_phage	54.9	3.0e-13
WP_154066722.1|2753468_2753600_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	87.8	2.3e-16
WP_077722283.1|2753630_2754167_+	hypothetical protein	NA	O64091	Bacillus_phage	87.6	1.7e-84
WP_077722284.1|2754229_2754655_+	hypothetical protein	NA	O64093	Bacillus_phage	73.2	4.3e-51
WP_160228935.1|2754852_2756007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142295830.1|2756035_2756161_+	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_014472000.1|2756591_2756804_+	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	1.6e-22
WP_014471999.1|2756818_2757049_+	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	5.5e-21
WP_160228934.1|2757261_2758320_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	76.3	2.1e-155
WP_014471996.1|2758396_2759746_+	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	75.7	2.5e-190
WP_160228932.1|2759766_2760750_+|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	77.7	9.6e-139
WP_021493552.1|2760970_2761192_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	79.5	2.2e-27
WP_064778402.1|2761357_2761657_+	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	50.0	7.9e-20
WP_020954128.1|2761731_2761977_+	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
WP_102422308.1|2762423_2762624_+	hypothetical protein	NA	M4ZRU5	Bacillus_phage	85.9	5.5e-25
WP_061573808.1|2762620_2763031_+	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	60.9	3.4e-37
WP_041352901.1|2763027_2763231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041352899.1|2763394_2763586_+	hypothetical protein	NA	R4JF30	Bacillus_phage	77.8	1.1e-22
WP_041352897.1|2763582_2763888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041352893.1|2764230_2764638_+	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	96.3	9.3e-72
WP_160228930.1|2764688_2765423_+	hypothetical protein	NA	A0A0A8WIT2	Clostridium_phage	58.8	1.6e-66
WP_160228928.1|2765762_2766440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228926.1|2766478_2767246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048406322.1|2767421_2767625_+	hypothetical protein	NA	O64115	Bacillus_phage	94.0	1.2e-32
WP_160228924.1|2767752_2767950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559768.1|2768003_2768342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104843454.1|2768457_2768700_+	hypothetical protein	NA	A0A1P8CWY6	Bacillus_phage	90.0	4.1e-35
WP_104843455.1|2768711_2768957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104843456.1|2769153_2769369_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	94.4	7.9e-30
WP_104843457.1|2769382_2769757_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	64.2	1.4e-37
WP_038458648.1|2770420_2770783_+	hypothetical protein	NA	A0A140HLN5	Bacillus_phage	48.4	4.9e-32
WP_160229015.1|2771130_2771967_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	64.8	8.6e-88
WP_160228922.1|2771963_2772500_+|terminase	terminase small subunit	terminase	M4ZS05	Bacillus_phage	44.0	3.6e-07
WP_014470184.1|2772542_2772740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228920.1|2772957_2773770_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	88.5	9.4e-140
WP_160228918.1|2773839_2774514_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	97.9	1.9e-77
WP_160228916.1|2774585_2774828_+	hypothetical protein	NA	O64132	Bacillus_phage	82.2	9.9e-29
WP_014470191.1|2774808_2775696_+	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	93.9	3.6e-161
WP_014470192.1|2775685_2775958_+	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	80.0	2.1e-35
WP_160229013.1|2776141_2776540_+	hypothetical protein	NA	O64133	Bacillus_phage	62.9	2.0e-42
WP_160228914.1|2776640_2777462_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	65.8	2.0e-97
WP_160228912.1|2777458_2779201_+	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	63.1	2.3e-215
WP_160228910.1|2779239_2779626_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	2.7e-52
WP_160228908.1|2779687_2780359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228906.1|2780491_2780866_+	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	77.4	1.5e-52
2780404:2780427	attR	TTTTAAGAATAAAAATAAAATAGT	NA	NA	NA	NA
WP_160228904.1|2780894_2781809_+	hypothetical protein	NA	O64140	Bacillus_phage	89.1	1.3e-153
WP_160228902.1|2781897_2782869_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	95.4	2.9e-172
WP_077722312.1|2782909_2783380_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	46.8	2.1e-38
WP_160228900.1|2783394_2784912_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	71.9	4.5e-212
WP_160228899.1|2784927_2786064_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	89.4	1.2e-204
WP_160228897.1|2786063_2787794_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	90.6	1.5e-307
WP_160228895.1|2787806_2791736_+	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	81.5	0.0e+00
WP_160228893.1|2791762_2792470_+	hypothetical protein	NA	O64147	Bacillus_phage	34.9	1.1e-24
WP_014417936.1|2792481_2792685_+	YorP family protein	NA	O64150	Bacillus_phage	80.6	1.0e-26
WP_053574338.1|2792844_2793342_+	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	78.8	5.3e-69
WP_053574337.1|2793380_2793728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160229011.1|2793869_2794085_+	hypothetical protein	NA	O64155	Bacillus_phage	58.6	3.2e-15
WP_160228891.1|2794122_2794350_+	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	78.7	1.7e-27
WP_021493499.1|2794364_2794562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228889.1|2794749_2795508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228887.1|2796301_2796529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228885.1|2796555_2796732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228883.1|2796764_2797235_+	hypothetical protein	NA	O64162	Bacillus_phage	87.2	1.6e-75
WP_020954083.1|2797266_2797446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228881.1|2797478_2797874_+	hypothetical protein	NA	O64163	Bacillus_phage	85.5	1.9e-61
WP_160228879.1|2797888_2798236_+	hypothetical protein	NA	O64164	Bacillus_phage	91.3	7.0e-52
WP_160228878.1|2798632_2798986_+	hypothetical protein	NA	O64166	Bacillus_phage	84.3	8.1e-48
WP_160228876.1|2799287_2799518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160228874.1|2799538_2799730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160229009.1|2799744_2799957_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	75.4	2.8e-27
WP_160228872.1|2799971_2800439_+	hypothetical protein	NA	O64167	Bacillus_phage	77.6	4.5e-62
WP_077722329.1|2800470_2800803_+	hypothetical protein	NA	O64168	Bacillus_phage	90.7	2.9e-15
WP_096034949.1|2801005_2801356_+	hypothetical protein	NA	O64171	Bacillus_phage	45.8	1.4e-20
WP_145979853.1|2801352_2801748_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	85.5	1.3e-57
WP_160229007.1|2801755_2802433_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	92.4	1.8e-115
WP_072589213.1|2805265_2805787_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	92.5	5.7e-90
WP_104843482.1|2806367_2806616_+	thiol reductase thioredoxin	NA	A0A1P8CX24	Bacillus_phage	76.2	1.2e-29
WP_160228870.1|2806615_2807125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160229005.1|2807390_2807819_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	89.4	7.5e-72
WP_046559728.1|2808434_2808743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559727.1|2808735_2809035_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	54.7	3.0e-19
>prophage 208
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2812126	2818942	4100473		Bacillus_phage(85.71%)	13	NA	NA
WP_046559723.1|2812126_2812633_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	38.0	2.2e-30
WP_046559722.1|2812762_2813128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559721.1|2813187_2813544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559720.1|2814127_2814421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559719.1|2814781_2814970_+	hypothetical protein	NA	A0A1P8CX75	Bacillus_phage	98.4	2.7e-26
WP_042976081.1|2815051_2815264_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	100.0	4.1e-31
WP_046559718.1|2815423_2816251_+	metallophosphoesterase	NA	O64184	Bacillus_phage	89.1	7.5e-153
WP_046559717.1|2816260_2816482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947579.1|2816529_2816751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160229003.1|2816774_2817110_+	hypothetical protein	NA	F8WPK8	Bacillus_phage	66.0	3.5e-40
WP_052749755.1|2817145_2817820_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_014470254.1|2818050_2818290_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_102422238.1|2818387_2818942_+	hypothetical protein	NA	O64195	Bacillus_phage	93.3	3.8e-92
>prophage 209
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2830627	2834599	4100473		Bacillus_phage(33.33%)	9	NA	NA
WP_025284902.1|2830627_2831515_+	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	30.6	1.3e-20
WP_003153575.1|2831520_2831649_-	small, acid-soluble spore protein L	NA	NA	NA	NA	NA
WP_015240064.1|2831700_2832093_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_012117815.1|2832099_2832780_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.1	1.6e-12
WP_076425341.1|2832861_2833533_+	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_015240062.1|2833535_2833718_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_007409519.1|2833744_2834002_-	DUF2564 family protein	NA	NA	NA	NA	NA
WP_012117812.1|2834164_2834347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153604.1|2834398_2834599_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.9	5.5e-17
>prophage 210
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2843906	2847039	4100473	transposase	Geobacillus_virus(33.33%)	4	NA	NA
WP_025284896.1|2843906_2844701_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	67.4	4.6e-107
WP_032870014.1|2844697_2845183_+	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	45.9	3.2e-34
WP_043021188.1|2845204_2845828_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_094031235.1|2845888_2847039_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
>prophage 211
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2854301	2866699	4100473	holin	Bacillus_phage(88.89%)	13	NA	NA
WP_032868763.1|2854301_2854892_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	31.1	1.7e-13
WP_160223133.1|2854914_2856579_-	recombinase family protein	NA	O64015	Bacillus_phage	91.2	9.2e-275
WP_160223132.1|2856794_2857760_-	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.0	5.5e-78
WP_076982865.1|2858024_2858459_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_160223131.1|2858495_2860211_+	ribonuclease YeeF family protein	NA	O64023	Bacillus_phage	76.4	1.1e-249
WP_032870144.1|2860219_2860717_+	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	90.9	2.1e-89
WP_032870004.1|2860778_2861375_+	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	81.4	6.3e-85
WP_160223130.1|2862134_2862473_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	60.2	9.3e-25
WP_082786706.1|2862728_2862812_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_045926142.1|2863498_2863858_+	hypothetical protein	NA	O64028	Bacillus_phage	60.5	2.9e-32
WP_080130243.1|2863921_2864938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016936664.1|2865464_2865587_-	phosphatase RapK inhibitor	NA	NA	NA	NA	NA
WP_064115743.1|2865583_2866699_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	48.4	8.2e-94
>prophage 212
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2870653	2873848	4100473		Bacillus_phage(66.67%)	3	NA	NA
WP_122504079.1|2870653_2870869_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	79.4	1.4e-21
WP_122504075.1|2872458_2872665_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	51.2	6.5e-13
WP_099566853.1|2873068_2873848_+	DUF4236 domain-containing protein	NA	F6K8R9	Clostridium_phage	50.0	3.4e-14
>prophage 213
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2880098	2884830	4100473		Bacillus_phage(80.0%)	7	NA	NA
WP_124692988.1|2880098_2881235_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	75.9	6.5e-163
WP_160223129.1|2881602_2882055_+	hypothetical protein	NA	O64117	Bacillus_phage	78.0	4.4e-62
WP_015240044.1|2882290_2882665_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.0	9.0e-29
WP_015240043.1|2882790_2883027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160223128.1|2883496_2883832_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_139134430.1|2884194_2884371_+	hypothetical protein	NA	O64196	Bacillus_phage	91.4	2.5e-21
WP_003153663.1|2884404_2884830_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	35.6	2.7e-13
>prophage 214
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2890767	2891214	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_160223123.1|2890767_2891214_+	DNA gyrase inhibitor	NA	A0A1P8CX48	Bacillus_phage	71.1	1.7e-58
>prophage 215
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2921842	2926256	4100473		Phthorimaea_operculella_granulovirus(33.33%)	4	NA	NA
WP_007611974.1|2921842_2923054_+	glycosyl transferase family 1	NA	G4WEM5	Phthorimaea_operculella_granulovirus	27.4	1.8e-06
WP_032869970.1|2923373_2924615_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.2	3.4e-16
WP_012117752.1|2924697_2925288_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_003153758.1|2925365_2926256_+	MoxR family ATPase	NA	R4TG24	Halovirus	26.7	4.6e-07
>prophage 216
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2935912	2936758	4100473		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_007611962.1|2935912_2936758_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	41.3	3.8e-35
>prophage 217
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2945099	2947983	4100473		Moumouvirus(50.0%)	2	NA	NA
WP_015240002.1|2945099_2946878_+	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.9	2.0e-81
WP_007407985.1|2947113_2947983_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217EQJ4	Bacillus_phage	70.8	3.9e-27
>prophage 218
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2951832	2952498	4100473		Streptococcus_phage(100.0%)	1	NA	NA
WP_003153802.1|2951832_2952498_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	32.6	3.3e-18
>prophage 219
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2956578	2958381	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_160223112.1|2956578_2958381_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	67.6	8.7e-178
>prophage 220
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2963006	2964023	4100473		Streptococcus_phage(100.0%)	1	NA	NA
WP_015239990.1|2963006_2964023_+	2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	31.6	4.8e-24
>prophage 221
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2968070	2972711	4100473		Streptococcus_phage(50.0%)	5	NA	NA
WP_007407344.1|2968070_2968787_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	77.2	2.8e-47
WP_000640391.1|2969312_2969741_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003153833.1|2970172_2970541_+	replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.0	9.2e-18
WP_069007403.1|2970719_2971568_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	30.2	5.2e-24
WP_015239987.1|2971592_2972711_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.2	3.1e-69
>prophage 222
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2982807	2984727	4100473	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_122504061.1|2982807_2984727_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.8	9.3e-138
>prophage 223
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2989006	2989552	4100473	integrase	Bacillus_phage(100.0%)	1	2986036:2986051	3002062:3002077
2986036:2986051	attL	GGAATGGCGCTTCATG	NA	NA	NA	NA
WP_007407359.1|2989006_2989552_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	49.2	5.5e-43
WP_007407359.1|2989006_2989552_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	49.2	5.5e-43
3002062:3002077	attR	GGAATGGCGCTTCATG	NA	NA	NA	NA
>prophage 224
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	2995029	3032699	4100473		Tupanvirus(100.0%)	5	NA	NA
WP_160223105.1|2995029_3002688_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	23.4	1.5e-77
WP_160223104.1|3002713_3010411_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.8	7.5e-162
WP_160223103.1|3010426_3018076_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	26.2	2.4e-75
WP_160223102.1|3018101_3028877_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.5	1.9e-158
WP_038463981.1|3028895_3032699_+	non-ribosomal peptide synthase	NA	A0A2K9KZV5	Tupanvirus	26.7	1.4e-84
>prophage 225
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3036139	3037780	4100473		Hepacivirus(100.0%)	1	NA	NA
WP_038463976.1|3036139_3037780_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	26.9	5.9e-48
>prophage 226
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3043334	3048169	4100473		Bacillus_phage(33.33%)	5	NA	NA
WP_160223101.1|3043334_3044225_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.9	5.2e-83
WP_014418060.1|3044231_3044639_-	GtrA family protein	NA	NA	NA	NA	NA
WP_160223100.1|3044905_3045673_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_160223099.1|3045672_3047019_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.2	3.8e-13
WP_012117686.1|3047008_3048169_+	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	27.1	1.6e-31
>prophage 227
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3056822	3092849	4100473		Tupanvirus(100.0%)	3	NA	NA
WP_160228868.1|3056822_3068771_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.1	2.5e-116
WP_160228866.1|3068815_3084904_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.0	1.2e-89
WP_160223096.1|3084992_3092849_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	22.6	8.3e-124
>prophage 228
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3096188	3098661	4100473		Bacillus_phage(66.67%)	3	NA	NA
WP_015239948.1|3096188_3096896_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.0	4.0e-38
WP_160223093.1|3096898_3098296_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.8	4.0e-29
WP_017417895.1|3098349_3098661_-	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	41.7	4.5e-10
>prophage 229
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3103087	3103708	4100473		Planktothrix_phage(100.0%)	1	NA	NA
WP_059367392.1|3103087_3103708_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	3.7e-27
>prophage 230
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3110548	3111550	4100473		Enterobacteria_phage(100.0%)	1	NA	NA
WP_160223086.1|3110548_3111550_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.6	8.9e-23
>prophage 231
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3118754	3123148	4100473		Bacillus_phage(50.0%)	2	NA	NA
WP_160223082.1|3118754_3121178_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	33.2	8.8e-101
WP_007611767.1|3121180_3123148_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	1.4e-125
>prophage 232
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3138307	3148677	4100473		Bacillus_phage(66.67%)	10	NA	NA
WP_007611720.1|3138307_3138928_+	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
WP_094031735.1|3139267_3139696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052827479.1|3139849_3140299_+	YndM family protein	NA	NA	NA	NA	NA
WP_007410333.1|3140328_3141159_-	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	73.1	2.2e-104
WP_076424209.1|3141403_3142225_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	42.6	4.1e-50
WP_025284785.1|3142631_3143066_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	86.6	6.0e-69
WP_160223080.1|3143444_3145862_+	peptidase G2	NA	D6R401	Bacillus_phage	50.3	9.4e-220
WP_160223079.1|3146477_3147014_+	stress protein	NA	NA	NA	NA	NA
WP_003154022.1|3147793_3147892_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_015239922.1|3148056_3148677_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	36.9	2.2e-19
>prophage 233
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3154205	3154622	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_094031732.1|3154205_3154622_-	hypothetical protein	NA	O64087	Bacillus_phage	72.3	1.3e-23
>prophage 234
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3158340	3159357	4100473		Tupanvirus(100.0%)	1	NA	NA
WP_160223075.1|3158340_3159357_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	28.4	3.1e-31
>prophage 235
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3162582	3165180	4100473		Hokovirus(100.0%)	1	NA	NA
WP_160223073.1|3162582_3165180_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.1e-44
>prophage 236
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3175319	3176425	4100473		Bacillus_phage(100.0%)	2	NA	NA
WP_160223070.1|3175319_3175922_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	54.8	4.0e-55
WP_160223069.1|3176233_3176425_-	hypothetical protein	NA	D6R410	Bacillus_phage	93.7	1.2e-24
>prophage 237
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3184516	3190730	4100473		Bacillus_phage(50.0%)	7	NA	NA
WP_015417523.1|3184516_3185485_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
WP_007410369.1|3185533_3185758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223066.1|3185791_3186550_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	8.1e-53
WP_012117609.1|3186599_3187220_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
WP_012117608.1|3187268_3188258_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
WP_007611605.1|3188275_3190378_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
WP_003154061.1|3190337_3190730_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
>prophage 238
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3195158	3264028	4100473		Paenibacillus_phage(62.5%)	12	NA	NA
WP_007410381.1|3195158_3195866_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	54.1	2.7e-50
WP_015239897.1|3196121_3196355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012117603.1|3196533_3197862_+	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	34.6	2.2e-29
WP_007410383.1|3198054_3198417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223064.1|3198450_3199206_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_160223063.1|3199265_3199700_-	sporulation protein	NA	F8WPS9	Bacillus_phage	53.5	4.2e-38
WP_160223062.1|3199988_3201200_+	cytochrome P450	NA	NA	NA	NA	NA
WP_160223061.1|3201335_3208793_-	methyltransferase	NA	D0R7J2	Paenibacillus_phage	30.1	1.5e-37
WP_160223060.1|3208806_3225108_-	amino acid adenylation domain-containing protein	NA	D0R7J2	Paenibacillus_phage	57.5	2.7e-121
WP_160223059.1|3225097_3235633_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.3	1.3e-39
WP_160223058.1|3235650_3249075_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	30.0	9.1e-38
WP_160223057.1|3249076_3264028_-	amino acid adenylation domain-containing protein	NA	D0R7J2	Paenibacillus_phage	59.8	3.1e-127
>prophage 239
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3271761	3278444	4100473		Streptococcus_phage(33.33%)	4	NA	NA
WP_160223054.1|3271761_3272439_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	27.1	4.0e-11
WP_094031716.1|3273371_3273581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025284750.1|3273968_3275843_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.0	1.7e-67
WP_094031921.1|3275858_3278444_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.2	5.1e-38
>prophage 240
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3281466	3289521	4100473		Bacillus_phage(40.0%)	7	NA	NA
WP_098081411.1|3281466_3282645_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	32.8	2.7e-47
WP_160223052.1|3282657_3283704_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	62.0	2.4e-10
WP_003154135.1|3283961_3284222_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	42.5	1.2e-08
WP_003154137.1|3284421_3285216_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_003154140.1|3285276_3286836_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_059366981.1|3287128_3288310_-	serine hydrolase	NA	A0A076YK70	Mycobacterium_phage	27.7	2.4e-11
WP_003154145.1|3288477_3289521_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	72.9	6.0e-139
>prophage 241
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3294571	3297135	4100473		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_160223051.1|3294571_3295858_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	26.8	6.7e-07
WP_015239875.1|3295854_3297135_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	27.8	2.8e-45
>prophage 242
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3303160	3305515	4100473		Mycobacterium_phage(100.0%)	1	NA	NA
WP_160223049.1|3303160_3305515_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	50.0	7.0e-87
>prophage 243
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3313914	3315150	4100473		Bacillus_virus(100.0%)	1	NA	NA
WP_012117570.1|3313914_3315150_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	31.4	5.2e-49
>prophage 244
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3318994	3330559	4100473	tRNA	Indivirus(33.33%)	10	NA	NA
WP_064107826.1|3318994_3319936_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	29.8	8.9e-09
WP_160223048.1|3319955_3320885_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003154185.1|3320969_3321323_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_052827431.1|3321339_3321618_-	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_053573443.1|3321614_3323762_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.7	4.5e-24
WP_003154192.1|3323781_3324084_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_003154193.1|3324085_3324361_-	glucose-induced regulator RulR	NA	NA	NA	NA	NA
WP_003154195.1|3324374_3325496_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_007409801.1|3325535_3326006_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_160223047.1|3326245_3330559_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	31.5	1.8e-24
>prophage 245
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3335679	3336462	4100473		Flavobacterium_phage(100.0%)	1	NA	NA
WP_007611457.1|3335679_3336462_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	40.7	4.3e-25
>prophage 246
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3340375	3341140	4100473		Salisaeta_icosahedral_phage(100.0%)	1	NA	NA
WP_003154217.1|3340375_3341140_-	RNA polymerase sigma-28 factor SigD	NA	I1ZBD5	Salisaeta_icosahedral_phage	27.4	1.0e-07
>prophage 247
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3367389	3374886	4100473	protease,tRNA	Erwinia_phage(25.0%)	6	NA	NA
WP_007611413.1|3367389_3368793_-	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	27.5	4.1e-42
WP_014417767.1|3368809_3369355_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032871470.1|3369370_3370288_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.7	6.9e-30
WP_094031705.1|3370357_3371665_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_007409771.1|3371729_3373805_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.6	1.1e-104
WP_160223044.1|3373986_3374886_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	38.0	5.1e-30
>prophage 248
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3379212	3379980	4100473		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_007611398.1|3379212_3379980_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.6	6.1e-24
>prophage 249
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3391221	3393168	4100473		Micromonas_pusilla_virus(33.33%)	3	NA	NA
WP_012117543.1|3391221_3391971_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.9	5.4e-25
WP_003154310.1|3392109_3392343_-	acyl carrier protein	NA	M4M9G2	Vibrio_phage	44.9	7.1e-08
WP_003154312.1|3392427_3393168_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	2.0e-19
>prophage 250
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3404578	3406522	4100473		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_012117534.1|3404578_3406522_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	35.6	5.9e-23
>prophage 251
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3409707	3419696	4100473	tRNA	Prochlorococcus_phage(20.0%)	9	NA	NA
WP_076424120.1|3409707_3410661_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.8	1.1e-09
WP_012117530.1|3410665_3411148_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	45.0	6.4e-19
WP_160223041.1|3411172_3413584_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_136396354.1|3413580_3414801_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.7	3.0e-41
WP_003154346.1|3414891_3415095_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003154347.1|3415098_3415713_-	guanylate kinase	NA	S4W1R9	Pandoravirus	33.1	6.2e-11
WP_003154355.1|3415720_3415990_-	extracellular matrix/biofilm regulator RemA	NA	NA	NA	NA	NA
WP_160223040.1|3416066_3416942_-	YicC family protein	NA	NA	NA	NA	NA
WP_160223039.1|3417023_3419696_-	calcium-translocating P-type ATPase, SERCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	30.1	1.0e-89
>prophage 252
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3424123	3425879	4100473		Tupanvirus(100.0%)	2	NA	NA
WP_007611313.1|3424123_3424717_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	42.0	2.3e-26
WP_061581574.1|3424730_3425879_-	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	30.4	5.7e-42
>prophage 253
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3434258	3444639	4100473	tRNA	Halovirus(25.0%)	9	NA	NA
WP_007409730.1|3434258_3435353_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	38.7	1.8e-61
WP_052827404.1|3435349_3436636_-	dihydroorotase	NA	NA	NA	NA	NA
WP_072589082.1|3436619_3437534_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	37.9	2.4e-35
WP_025284702.1|3437675_3438986_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.2	6.5e-58
WP_003154392.1|3439139_3439685_-	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_007409726.1|3439873_3440788_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003154398.1|3440789_3441251_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_007409725.1|3441352_3441724_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_012117512.1|3441873_3444639_-|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	27.0	3.3e-83
>prophage 254
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3450607	3458674	4100473		Bacillus_phage(50.0%)	5	NA	NA
WP_160223036.1|3450607_3451405_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	2.5e-12
WP_003154420.1|3451533_3452316_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.1	2.2e-45
WP_007409714.1|3452456_3453176_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	41.4	8.1e-18
WP_025284698.1|3453233_3454163_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_160223035.1|3454378_3458674_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	33.6	5.9e-23
>prophage 255
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3479730	3480306	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_012117496.1|3479730_3480306_-	sporulation-specific transcriptional regulator GerR	NA	A0A1D6X8E5	Bacillus_phage	29.5	4.8e-05
>prophage 256
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3483686	3490481	4100473		Catovirus(25.0%)	10	NA	NA
WP_014304961.1|3483686_3484466_-	patatin family protein	NA	A0A1V0SCG0	Catovirus	26.9	9.7e-09
WP_160223032.1|3484645_3485872_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
WP_007409694.1|3485890_3486373_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.9	1.6e-25
WP_025284692.1|3486377_3486932_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003154470.1|3487231_3487504_-	YlbG family protein	NA	NA	NA	NA	NA
WP_003154472.1|3487562_3488012_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_003154475.1|3488082_3488322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409691.1|3488337_3488748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409690.1|3488912_3489953_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.0	3.4e-17
WP_017417724.1|3490037_3490481_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	34.7	1.8e-12
>prophage 257
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3505185	3509860	4100473		Vibrio_phage(50.0%)	5	NA	NA
WP_015239795.1|3505185_3506514_-	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	33.7	4.4e-54
WP_012117484.1|3506668_3507292_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_007409677.1|3507393_3507603_+	YlaI family protein	NA	NA	NA	NA	NA
WP_015239793.1|3507644_3507965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409675.1|3508021_3509860_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	38.8	3.8e-19
>prophage 258
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3519665	3521078	4100473		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_007409663.1|3519665_3521078_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.6	9.8e-44
>prophage 259
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3525101	3526193	4100473		Mycobacterium_phage(100.0%)	1	NA	NA
WP_007409662.1|3525101_3526193_-	serine hydrolase	NA	G1BNF7	Mycobacterium_phage	25.9	3.9e-08
>prophage 260
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3530127	3537510	4100473		Paenibacillus_phage(100.0%)	1	NA	NA
WP_160223029.1|3530127_3537510_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	33.2	1.3e-41
>prophage 261
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3543244	3558950	4100473		Paenibacillus_phage(100.0%)	2	NA	NA
WP_160223027.1|3543244_3550249_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	30.2	3.6e-38
WP_160223026.1|3550241_3558950_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.5	1.6e-35
>prophage 262
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3563769	3576033	4100473		Paenibacillus_phage(100.0%)	1	NA	NA
WP_160223025.1|3563769_3576033_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.6	1.2e-33
>prophage 263
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3579996	3580551	4100473		Synechococcus_phage(100.0%)	1	NA	NA
WP_082997953.1|3579996_3580551_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.0	1.6e-13
>prophage 264
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3588521	3588806	4100473		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003154557.1|3588521_3588806_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	50.0	2.6e-12
>prophage 265
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3592675	3594295	4100473		Tupanvirus(100.0%)	1	NA	NA
WP_007409642.1|3592675_3594295_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.5	8.4e-47
>prophage 266
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3600531	3601224	4100473		Planktothrix_phage(100.0%)	1	NA	NA
WP_007409637.1|3600531_3601224_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	1.0e-33
>prophage 267
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3609760	3610219	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_038463805.1|3609760_3610219_-	TlpA family protein disulfide reductase	NA	A0A127AW88	Bacillus_phage	48.6	6.0e-35
>prophage 268
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3613639	3615478	4100473		Bacillus_phage(100.0%)	3	NA	NA
WP_007409622.1|3613639_3614095_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	31.9	5.3e-15
WP_160223021.1|3614121_3615015_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_012117440.1|3615004_3615478_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	35.7	1.8e-13
>prophage 269
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3620877	3621642	4100473		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003154618.1|3620877_3621642_-	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	39.4	6.7e-39
>prophage 270
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3625217	3636078	4100473		Bacillus_thuringiensis_phage(25.0%)	7	NA	NA
WP_007409609.1|3625217_3626129_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.8	1.8e-46
WP_082997935.1|3626679_3627849_+	aminotransferase A	NA	NA	NA	NA	NA
WP_160223020.1|3627873_3629694_-	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.6	1.0e-08
WP_138092220.1|3629871_3632004_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_160223019.1|3632344_3633130_+	hypothetical protein	NA	U5Q0C0	Bacillus_phage	63.8	2.4e-39
WP_160223018.1|3633163_3634030_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_160223017.1|3634110_3636078_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.6	3.1e-11
>prophage 271
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3639723	3641820	4100473		Vibrio_phage(100.0%)	1	NA	NA
WP_003154656.1|3639723_3641820_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	45.8	3.4e-08
>prophage 272
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3645421	3661152	4100473		Pneumococcus_phage(28.57%)	16	NA	NA
WP_072589032.1|3645421_3647335_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.8	2.2e-110
WP_160223016.1|3647576_3648071_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_007409593.1|3648133_3649474_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_025284651.1|3649589_3650213_-	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	55.4	4.4e-28
WP_059367104.1|3650487_3650682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154669.1|3650845_3651031_+	YkvS family protein	NA	NA	NA	NA	NA
WP_059367106.1|3651103_3651379_-	DUF3219 family protein	NA	NA	NA	NA	NA
WP_160223015.1|3652062_3652809_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	2.3e-15
WP_160223014.1|3652977_3653346_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003154673.1|3653808_3654303_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	73.2	1.1e-55
WP_003154676.1|3654320_3655052_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.6	2.6e-56
WP_007408455.1|3655044_3655488_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_003154679.1|3655488_3656148_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.4	6.6e-67
WP_160223013.1|3656397_3657519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160223012.1|3657616_3658654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160223011.1|3659055_3661152_+	AAA domain-containing protein	NA	H6X3M6	Enterobacteria_phage	42.6	6.6e-129
>prophage 273
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3670404	3674532	4100473		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_015239733.1|3670404_3671184_+	carbon-nitrogen family hydrolase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	27.2	1.3e-10
WP_124934915.1|3671540_3672725_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_160223009.1|3672731_3673793_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_160223008.1|3674034_3674532_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.5	1.1e-18
>prophage 274
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3680594	3689165	4100473	protease,transposase	Bacillus_phage(50.0%)	9	NA	NA
WP_160223007.1|3680594_3681744_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
WP_025284642.1|3681808_3682702_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_007407208.1|3682850_3683552_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003154717.1|3683687_3683882_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	65.5	3.6e-13
WP_007407209.1|3683888_3685058_-	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_003154719.1|3685054_3685810_-	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_015239726.1|3686086_3686869_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	43.1	4.1e-31
WP_007407212.1|3687114_3687684_-	DedA family protein	NA	NA	NA	NA	NA
WP_015239724.1|3688283_3689165_+	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	36.8	3.0e-43
>prophage 275
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3697719	3702151	4100473		Planktothrix_phage(50.0%)	4	NA	NA
WP_160223004.1|3697719_3699357_+	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	4.5e-16
WP_022553447.1|3699331_3700093_+	HMP/thiamine permease ykoC	NA	NA	NA	NA	NA
WP_025284633.1|3700138_3700972_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_007407222.1|3701191_3702151_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	51.2	1.5e-72
>prophage 276
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3712361	3715990	4100473		Streptococcus_phage(66.67%)	3	NA	NA
WP_025284624.1|3712361_3713609_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.1	1.8e-97
WP_136396308.1|3713605_3714718_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.2	3.2e-74
WP_007407234.1|3715087_3715990_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	36.2	1.2e-15
>prophage 277
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3720265	3722140	4100473		Bacillus_virus(50.0%)	2	NA	NA
WP_007610864.1|3720265_3721237_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.6	5.2e-20
WP_015239704.1|3721240_3722140_-	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	43.0	4.5e-18
>prophage 278
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3725879	3726908	4100473		Planktothrix_phage(100.0%)	1	NA	NA
WP_012117374.1|3725879_3726908_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	7.5e-17
>prophage 279
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3731634	3734318	4100473		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_157696431.1|3731634_3732984_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	33.3	2.0e-22
WP_007610846.1|3733346_3734318_-	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.6	3.8e-63
>prophage 280
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3742441	3778454	4100473	plate,terminase,portal,tail,holin	Bacillus_phage(36.36%)	48	NA	NA
WP_007407257.1|3742441_3743320_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
WP_003154813.1|3743333_3743597_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_003154815.1|3743610_3743874_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_160222996.1|3743925_3744687_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_007610833.1|3744743_3744941_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	7.3e-14
WP_043021266.1|3744945_3745317_-	YomQ/XkdW protein, phage-like element PBSX	NA	NA	NA	NA	NA
WP_052827325.1|3745329_3746961_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	33.5	1.6e-53
WP_060674884.1|3746963_3747236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015239689.1|3747232_3747811_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.9	3.1e-12
WP_076423970.1|3747794_3748841_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	1.3e-69
WP_003154825.1|3748833_3749259_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_007610818.1|3749362_3749629_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_044802866.1|3749628_3750606_-	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.9	2.9e-34
WP_160222995.1|3750619_3751279_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.4e-08
WP_160222994.1|3751271_3756317_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.0	8.7e-42
WP_015239684.1|3756304_3756457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154836.1|3756498_3756945_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_003154837.1|3757020_3757464_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_007610810.1|3757465_3758863_-|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
WP_160222993.1|3758862_3759072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222992.1|3759068_3759515_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_042635121.1|3759511_3760015_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.1	2.7e-36
WP_007407272.1|3760011_3760368_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_015239680.1|3760364_3760748_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007407274.1|3760764_3761700_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_160222991.1|3761726_3762572_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.1	2.5e-55
WP_160223388.1|3762591_3763983_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.8e-138
WP_025284605.1|3764031_3765330_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	9.4e-150
WP_100001390.1|3765326_3766124_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.8	1.6e-59
WP_007407279.1|3766236_3766749_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	3.8e-22
WP_100001388.1|3766862_3767066_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	51.5	1.4e-12
WP_100001386.1|3767055_3767397_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_014417520.1|3767661_3768462_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	3.0e-58
WP_025284603.1|3768361_3769189_-	hypothetical protein	NA	S6BFM4	Thermus_phage	49.0	2.2e-19
WP_007407285.1|3769178_3769358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154871.1|3769548_3769887_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_007610775.1|3770035_3770626_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_047935636.1|3770744_3771350_-	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	1.0e-42
WP_007610770.1|3771459_3771837_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_015417280.1|3771874_3772828_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_003154881.1|3772970_3773105_-	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_087920760.1|3773094_3774231_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_025284602.1|3774436_3774904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025284601.1|3775048_3775813_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_025284599.1|3775886_3776078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082187759.1|3776219_3776318_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_025284598.1|3776427_3777786_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.1	2.7e-14
WP_015417275.1|3777782_3778454_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.1	2.4e-24
>prophage 281
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3789373	3793306	4100473		Bacillus_phage(66.67%)	5	NA	NA
WP_160222988.1|3789373_3790111_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.1	1.2e-16
WP_015239663.1|3790112_3790874_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_032871243.1|3790899_3791718_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003154919.1|3791893_3792079_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	75.9	2.6e-21
WP_160222987.1|3792121_3793306_-	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	30.2	7.3e-08
>prophage 282
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3799972	3800608	4100473		Bacillus_virus(100.0%)	1	NA	NA
WP_007407316.1|3799972_3800608_-	methyltransferase	NA	G3MA03	Bacillus_virus	50.4	6.2e-22
>prophage 283
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3808312	3809305	4100473		Tupanvirus(100.0%)	1	NA	NA
WP_012117333.1|3808312_3809305_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.3	1.1e-46
>prophage 284
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3814786	3853705	4100473	integrase,tail,tRNA,coat	Paenibacillus_phage(33.33%)	50	3821459:3821505	3838798:3838844
WP_132106234.1|3814786_3815707_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.9	3.2e-59
WP_136396273.1|3816055_3816442_-	VOC family protein	NA	NA	NA	NA	NA
WP_038457666.1|3816732_3817095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222982.1|3817615_3819394_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	52.2	3.9e-106
WP_021494070.1|3819405_3819798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095352238.1|3820193_3820493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160222981.1|3820858_3821215_+|tRNA	tRNA-Val4	tRNA	NA	NA	NA	NA
3821459:3821505	attL	ATGATTCCGACTGGGCTCGAACCAGCGACCTCTACCCTGTCAAGGTA	NA	NA	NA	NA
WP_024085162.1|3821909_3822116_+	KTSC domain-containing protein	NA	D2IZW7	Enterococcus_phage	48.3	5.1e-10
WP_160222980.1|3822485_3824732_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	38.1	6.3e-61
WP_039063547.1|3824980_3825589_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	42.0	1.8e-31
WP_160222979.1|3825585_3825807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222978.1|3825883_3826591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222977.1|3826627_3827281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222976.1|3827291_3827774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222975.1|3827770_3828139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222974.1|3828827_3829058_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_160222973.1|3829120_3829933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222972.1|3830183_3830672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125122413.1|3831561_3831762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222971.1|3831762_3832083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125122412.1|3832082_3832430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222970.1|3832540_3832774_+	helix-turn-helix transcriptional regulator	NA	A0A0A0RMC4	Bacillus_phage	36.5	1.9e-05
WP_160222969.1|3832763_3832955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160222968.1|3832972_3833572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160222967.1|3833713_3834289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222966.1|3834531_3834756_+	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	71.8	6.2e-09
WP_160222965.1|3835423_3836500_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	25.1	6.4e-11
WP_160222964.1|3836669_3837419_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024085137.1|3837585_3838635_-|integrase	tyrosine-type recombinase/integrase	integrase	Q938N9	Temperate_phage	27.9	1.3e-08
WP_052827270.1|3839009_3840185_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
3838798:3838844	attR	ATGATTCCGACTGGGCTCGAACCAGCGACCTCTACCCTGTCAAGGTA	NA	NA	NA	NA
WP_012117314.1|3840177_3841299_-	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	26.7	3.3e-18
WP_012117313.1|3841667_3842390_+	esterase family protein	NA	NA	NA	NA	NA
WP_007610690.1|3842415_3842931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012117312.1|3842935_3843367_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007409078.1|3843527_3843761_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_007409079.1|3843761_3844499_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.8	2.6e-27
WP_015239588.1|3844491_3845214_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_136396270.1|3845255_3846005_-	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_007409082.1|3846073_3846328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032874483.1|3846446_3848732_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.3	1.9e-84
WP_003154986.1|3848800_3849055_-	sporulation protein	NA	NA	NA	NA	NA
WP_007610678.1|3849221_3849383_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_012117306.1|3849474_3849672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015239585.1|3849958_3850315_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_003154992.1|3850485_3850872_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239584.1|3850909_3851224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239583.1|3851316_3851817_+|coat	spore coat protein X	coat	NA	NA	NA	NA
WP_003154995.1|3851967_3852450_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239582.1|3852595_3853039_+|coat	Spore coat protein Z	coat	NA	NA	NA	NA
WP_160222963.1|3853096_3853705_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 285
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3862235	3867161	4100473		Klosneuvirus(33.33%)	7	NA	NA
WP_007409101.1|3862235_3862985_+	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.4	9.9e-11
WP_150941121.1|3863018_3863912_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.8e-06
WP_003155018.1|3863926_3864727_-	NAD kinase	NA	NA	NA	NA	NA
WP_007610625.1|3864744_3865380_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155020.1|3865407_3865773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014417426.1|3865897_3866470_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_007409105.1|3866474_3867161_+	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	71.2	7.9e-39
>prophage 286
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3873477	3878742	4100473		Pseudomonas_phage(33.33%)	6	NA	NA
WP_007409109.1|3873477_3874134_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	9.9e-31
WP_003155034.1|3874191_3874587_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_007409110.1|3874765_3875344_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160222960.1|3875461_3876649_-	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_015239568.1|3876755_3877673_-	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_003155039.1|3877665_3878742_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
>prophage 287
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3884120	3884873	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_007409116.1|3884120_3884873_-	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	1.9e-49
>prophage 288
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3888679	3890652	4100473		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_003155053.1|3888679_3889669_-	dipeptide ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	24.6	5.7e-06
WP_029325950.1|3889665_3890652_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	6.0e-24
>prophage 289
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3897675	3898647	4100473		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_094031642.1|3897675_3898647_-	ornithine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	27.3	2.6e-19
>prophage 290
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3901722	3904008	4100473		Halovirus(50.0%)	2	NA	NA
WP_012117273.1|3901722_3902781_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.6	4.0e-58
WP_007409133.1|3902850_3904008_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.4	4.8e-28
>prophage 291
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3907776	3909978	4100473		Tupanvirus(50.0%)	2	NA	NA
WP_012117270.1|3907776_3909213_-	FAD-binding oxidoreductase	NA	A0A2K9KZR0	Tupanvirus	29.9	2.1e-49
WP_160222957.1|3909534_3909978_+	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	65.1	4.2e-41
>prophage 292
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3913101	3919145	4100473		Streptococcus_phage(25.0%)	6	NA	NA
WP_007409143.1|3913101_3913944_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	26.7	2.9e-27
WP_032871166.1|3914069_3914921_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.9	2.1e-12
WP_003155105.1|3914969_3915092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080130443.1|3915140_3916391_-	cytochrome P450	NA	NA	NA	NA	NA
WP_160222955.1|3916521_3918171_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.1	1.1e-14
WP_160222954.1|3918167_3919145_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	29.6	1.6e-32
>prophage 293
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3930393	3932235	4100473		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_025284535.1|3930393_3932235_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	28.0	1.2e-33
>prophage 294
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3937498	3945829	4100473		Bacillus_virus(100.0%)	3	NA	NA
WP_160222947.1|3937498_3940891_-	SMC family ATPase	NA	G3MAB6	Bacillus_virus	23.8	1.5e-05
WP_032866159.1|3940887_3942060_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_160223387.1|3942124_3945829_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	26.3	1.3e-15
>prophage 295
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3964362	3970418	4100473		Trichoplusia_ni_ascovirus(33.33%)	5	NA	NA
WP_007610477.1|3964362_3965220_-	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.2	1.4e-53
WP_160222942.1|3965344_3966868_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007409192.1|3966989_3968282_+	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.2	1.5e-09
WP_043021331.1|3968412_3968970_+	biotin biosynthesis protein BioY	NA	NA	NA	NA	NA
WP_160222941.1|3968981_3970418_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.2	1.8e-24
>prophage 296
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3973506	3978090	4100473		Bacillus_phage(50.0%)	4	NA	NA
WP_007409199.1|3973506_3974655_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	46.0	1.5e-50
WP_012117226.1|3974700_3975951_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_012117225.1|3976105_3976501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012117224.1|3976548_3978090_-	fatty acid--CoA ligase family protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.7	1.8e-43
>prophage 297
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	3999406	4002293	4100473		Staphylococcus_phage(33.33%)	3	NA	NA
WP_025284506.1|3999406_4000150_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	2.7e-24
WP_007409220.1|4000640_4001078_+	HIT family protein	NA	X4YER2	Lactococcus_phage	33.0	6.2e-05
WP_160222937.1|4001213_4002293_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.3	4.1e-82
>prophage 298
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	4014030	4014927	4100473		Staphylococcus_phage(100.0%)	1	NA	NA
WP_007409231.1|4014030_4014927_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	2.6e-26
>prophage 299
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	4028523	4033420	4100473		Bacillus_phage(100.0%)	4	NA	NA
WP_007610368.1|4028523_4028730_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	79.0	1.0e-18
WP_076423810.1|4028985_4029606_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_160222935.1|4029644_4031666_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	1.4e-43
WP_063095824.1|4031662_4033420_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	4.4e-49
>prophage 300
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	4037656	4041118	4100473		Staphylococcus_phage(66.67%)	5	NA	NA
WP_012117183.1|4037656_4038400_-	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	30.9	1.6e-21
WP_007409256.1|4038451_4039567_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_003155299.1|4039730_4039835_-	YhdX family protein	NA	NA	NA	NA	NA
WP_015417128.1|4040004_4040721_+	glycerophosphodiester phosphodiesterase	NA	A0A220BY94	Staphylococcus_phage	34.7	3.7e-31
WP_032866192.1|4040722_4041118_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	39.7	1.7e-09
>prophage 301
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	4053534	4057465	4100473		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_007610321.1|4053534_4054404_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.5	1.9e-50
WP_025284485.1|4054483_4055587_-	citrate synthase/methylcitrate synthase	NA	NA	NA	NA	NA
WP_007409271.1|4055696_4056572_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007409272.1|4056640_4057465_-	C40 family peptidase	NA	U5PW24	Bacillus_virus	43.9	3.0e-16
>prophage 302
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	4063177	4064632	4100473		Bacillus_virus(100.0%)	1	NA	NA
WP_082997766.1|4063177_4064632_+	peptidoglycan endopeptidase	NA	M1HNA7	Bacillus_virus	34.0	1.3e-11
>prophage 303
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	4067896	4069639	4100473		Streptococcus_phage(100.0%)	1	NA	NA
WP_007409283.1|4067896_4069639_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	50.9	4.5e-163
>prophage 304
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	4073090	4073918	4100473		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_015239469.1|4073090_4073918_-	aquaporin family protein	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	34.9	5.6e-31
>prophage 305
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	4077810	4080594	4100473		Synechococcus_phage(33.33%)	4	NA	NA
WP_003155347.1|4077810_4078500_-	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	5.2e-06
WP_007408449.1|4078627_4079050_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	34.2	2.3e-12
WP_007408448.1|4079180_4079576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076423787.1|4079685_4080594_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.7	7.3e-08
>prophage 306
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	4088026	4093202	4100473		Staphylococcus_phage(50.0%)	6	NA	NA
WP_012117154.1|4088026_4089106_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.5	4.6e-17
WP_076423773.1|4089122_4089953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155376.1|4090335_4090536_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	62.1	3.2e-17
WP_025284471.1|4090627_4091575_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012117151.1|4091567_4092485_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.0	6.2e-39
WP_025284469.1|4092485_4093202_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	2.8e-18
>prophage 307
NZ_CP028211	Bacillus velezensis strain SRCM102747 chromosome, complete genome	4100473	4098383	4099568	4100473		Bacillus_phage(100.0%)	1	NA	NA
WP_082997757.1|4098383_4099568_-	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	44.0	1.7e-25
