The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	0	13160	3963851		Synechococcus_phage(33.33%)	13	NA	NA
WP_007408898.1|763_1447_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003155758.1|1443_1698_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_025284370.1|1697_2417_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	2.6e-48
WP_082999062.1|2492_3785_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.0	7.7e-19
WP_012116995.1|3784_4966_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_007609846.1|4919_5408_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.6	5.6e-23
WP_007609843.1|5720_5918_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_014469850.1|5914_6469_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_003155777.1|6591_6765_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_025284368.1|6903_7686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007408891.1|7883_9206_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.0	4.1e-36
WP_007408889.1|10982_11516_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_007408887.1|11618_13160_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.0	1.2e-21
>prophage 2
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	27532	29464	3963851		Pseudomonas_phage(100.0%)	1	NA	NA
WP_160222896.1|27532_29464_+	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	33.4	1.9e-42
>prophage 3
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	42020	43981	3963851		uncultured_virus(100.0%)	2	NA	NA
WP_003155941.1|42020_43655_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
WP_003155970.1|43696_43981_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
>prophage 4
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	47428	50621	3963851	tRNA	Tupanvirus(50.0%)	2	NA	NA
WP_015239290.1|47428_49357_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	2.1e-60
WP_020955419.1|49580_50621_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	4.1e-63
>prophage 5
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	71908	75409	3963851		Mycobacterium_phage(50.0%)	4	NA	NA
WP_160222889.1|71908_73267_-	beta-lactamase family protein	NA	A0A2D1G9Q2	Mycobacterium_phage	24.5	6.9e-10
WP_007409303.1|73403_73673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409304.1|73903_74158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160222888.1|74215_75409_-	UDP-glucosyltransferase	NA	O89808	Epiphyas_postvittana_nucleopolyhedrovirus	27.9	2.3e-09
>prophage 6
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	87564	90975	3963851		Streptococcus_phage(100.0%)	3	NA	NA
WP_160222885.1|87564_88422_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	35.3	7.1e-37
WP_160222884.1|88538_89066_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160222883.1|89343_90975_+	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	27.4	1.7e-47
>prophage 7
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	94122	96660	3963851		Bacillus_phage(50.0%)	3	NA	NA
WP_160222881.1|94122_94758_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.3	3.2e-10
WP_160222880.1|94750_95968_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_060563176.1|96123_96660_-	sugar O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	33.8	9.3e-11
>prophage 8
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	99837	100974	3963851		Synechococcus_phage(100.0%)	1	NA	NA
WP_069006886.1|99837_100974_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.7	1.3e-14
>prophage 9
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	106920	108677	3963851		Bacillus_phage(100.0%)	2	NA	NA
WP_160222875.1|106920_107994_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.2	2.5e-23
WP_012116926.1|107990_108677_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.5	9.6e-45
>prophage 10
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	114101	115151	3963851		Tupanvirus(100.0%)	1	NA	NA
WP_032866822.1|114101_115151_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	41.2	1.6e-67
>prophage 11
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	120114	122688	3963851		Bacillus_phage(50.0%)	3	NA	NA
WP_043021449.1|120114_120648_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	66.9	4.0e-54
WP_069006874.1|120919_121552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012116910.1|121650_122688_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	25.5	8.3e-16
>prophage 12
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	132861	136844	3963851		Lactococcus_phage(50.0%)	4	NA	NA
WP_003156143.1|132861_133065_-	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	75.4	2.2e-21
WP_132106879.1|133511_133673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012116888.1|135356_135692_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012116887.1|135869_136844_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	26.9	4.6e-08
>prophage 13
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	143689	145093	3963851		Burkholderia_virus(100.0%)	1	NA	NA
WP_160222865.1|143689_145093_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	2.4e-58
>prophage 14
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	156502	156952	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_060563118.1|156502_156952_-	SprT family protein	NA	U5J9G1	Bacillus_phage	25.7	4.4e-06
>prophage 15
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	160008	160797	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_003156171.1|160008_160797_-	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	35.1	2.6e-25
>prophage 16
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	164366	164717	3963851		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003156187.1|164366_164717_-	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	5.8e-14
>prophage 17
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	170687	172172	3963851		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_015239193.1|170687_172172_-	ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.8	1.4e-61
>prophage 18
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	175188	175506	3963851		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003156200.1|175188_175506_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	32.0	1.8e-06
>prophage 19
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	179398	180325	3963851		Staphylococcus_phage(100.0%)	1	NA	NA
WP_012116860.1|179398_180325_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.0	3.4e-37
>prophage 20
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	195637	197863	3963851		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_014416943.1|195637_197359_-	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	26.0	1.2e-35
WP_150940997.1|197416_197863_-	NUDIX domain-containing protein	NA	Q56BL2	Escherichia_virus	44.6	9.8e-06
>prophage 21
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	207403	209590	3963851		Streptococcus_phage(100.0%)	1	NA	NA
WP_025284251.1|207403_209590_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.3	3.5e-40
>prophage 22
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	213553	219596	3963851		Diadromus_pulchellus_ascovirus(33.33%)	4	NA	NA
WP_007410307.1|213553_214414_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	38.1	2.0e-47
WP_025284249.1|214572_216087_-	acyl--CoA ligase	NA	Q75ZG1	Hepacivirus	26.3	6.6e-38
WP_160222851.1|216309_218394_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_014416927.1|218693_219596_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	2.3e-09
>prophage 23
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	236981	243124	3963851		Trichoplusia_ni_ascovirus(33.33%)	5	NA	NA
WP_076425704.1|236981_237767_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	3.1e-23
WP_003156317.1|237787_238651_-	glucose transporter GlcU	NA	NA	NA	NA	NA
WP_007410282.1|238805_240194_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023356706.1|240299_241607_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	1.4e-23
WP_043021405.1|241714_243124_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.3	5.2e-21
>prophage 24
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	248143	256411	3963851		Bacillus_phage(60.0%)	9	NA	NA
WP_003156330.1|248143_248902_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	29.8	5.9e-19
WP_160222847.1|248895_249843_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_059366593.1|249832_250786_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	53.4	2.7e-93
WP_059366589.1|251200_252565_+	aspartate kinase	NA	NA	NA	NA	NA
WP_012116800.1|252659_252755_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_033575081.1|252903_253023_-	phosphatase	NA	NA	NA	NA	NA
WP_007410270.1|253006_254155_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	44.6	1.2e-84
WP_076425708.1|254307_255738_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.6	1.6e-38
WP_007410267.1|255727_256411_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.2	1.9e-45
>prophage 25
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	261373	262123	3963851		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003156349.1|261373_262123_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	4.3e-14
>prophage 26
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	270083	273586	3963851		Bacillus_phage(50.0%)	2	NA	NA
WP_160222841.1|270083_271829_-	hypothetical protein	NA	U5PSS0	Bacillus_phage	40.8	4.5e-107
WP_012116786.1|272107_273586_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	39.4	4.3e-82
>prophage 27
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	278972	282514	3963851		Planktothrix_phage(50.0%)	4	NA	NA
WP_012116781.1|278972_279716_+	cystine ABC transporter ATP-binding protein TcyC	NA	G9BWD6	Planktothrix_phage	38.1	3.1e-33
WP_077392018.1|279788_280436_+	YitT family protein	NA	NA	NA	NA	NA
WP_024084876.1|280534_281209_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_160222840.1|281203_282514_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	41.6	3.2e-73
>prophage 28
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	286347	316822	3963851		Tupanvirus(60.0%)	9	NA	NA
WP_160222839.1|286347_290184_-	surfactin non-ribosomal peptide synthetase SrfAC	NA	A0A2K9KZV5	Tupanvirus	26.1	1.7e-85
WP_160222838.1|290218_300979_-	surfactin non-ribosomal peptide synthetase SrfAB	NA	A0A2K9KZV5	Tupanvirus	27.3	1.4e-166
WP_160222837.1|301000_311755_-	surfactin non-ribosomal peptide synthetase SrfAA	NA	A0A2K9KZV5	Tupanvirus	27.4	2.1e-162
WP_007409352.1|312346_312709_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015239130.1|312940_313576_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_007409354.1|313572_314130_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_003156588.1|314488_314926_+	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	62.6	1.2e-37
WP_007609299.1|314946_315345_+	peptidase S24	NA	NA	NA	NA	NA
WP_160222836.1|315385_316822_-	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	30.2	4.5e-52
>prophage 29
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	330640	331651	3963851		Bacillus_virus(100.0%)	1	NA	NA
WP_082998947.1|330640_331651_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	27.7	1.7e-18
>prophage 30
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	336352	338237	3963851		Staphylococcus_phage(50.0%)	2	NA	NA
WP_087920787.1|336352_337264_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	40.9	6.1e-63
WP_011996301.1|337451_338237_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	43.1	5.1e-42
>prophage 31
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	343564	344383	3963851		Bacillus_virus(100.0%)	1	NA	NA
WP_007409061.1|343564_344383_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.7	2.9e-96
>prophage 32
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	358705	359962	3963851		Bacillus_virus(100.0%)	1	NA	NA
WP_003156640.1|358705_359962_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.3	1.1e-33
>prophage 33
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	364447	375470	3963851		Bacillus_phage(37.5%)	12	NA	NA
WP_003156644.1|364447_365221_-	TerC family protein	NA	S5MAL1	Bacillus_phage	63.9	9.4e-81
WP_003156645.1|365259_365838_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.1	1.1e-28
WP_007409047.1|365870_366452_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.9	1.9e-30
WP_011996286.1|366475_367072_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	32.4	1.1e-25
WP_069007160.1|367347_368343_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007409044.1|368386_369226_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003156655.1|369183_369879_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.2e-15
WP_015239100.1|369933_370893_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160222828.1|371078_372758_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_007409041.1|372841_373621_-	glucose 1-dehydrogenase	NA	A0A0G2Y8L6	Acanthamoeba_polyphaga_mimivirus	31.2	1.2e-06
WP_007409040.1|373735_374857_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	36.9	1.0e-64
WP_059366518.1|374966_375470_+	M15 family metallopeptidase	NA	A0A127AWA8	Bacillus_phage	58.6	8.6e-35
>prophage 34
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	384598	388642	3963851		Mycobacterium_phage(50.0%)	4	NA	NA
WP_038455963.1|384598_386038_+	lincomycin efflux MFS transporter Lmr(B)	NA	A0A0M3UL24	Mycobacterium_phage	23.6	1.2e-12
WP_025284180.1|386073_387201_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_160222822.1|387272_387920_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_160222821.1|387916_388642_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	26.6	1.5e-19
>prophage 35
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	421382	422270	3963851		Staphylococcus_phage(100.0%)	1	NA	NA
WP_007408993.1|421382_422270_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	40.5	2.2e-41
>prophage 36
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	443013	444816	3963851		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_007609074.1|443013_444816_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	40.2	2.4e-103
>prophage 37
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	454546	455830	3963851		Mycobacterium_phage(100.0%)	1	NA	NA
WP_160222807.1|454546_455830_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	22.1	8.2e-05
>prophage 38
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	465695	470597	3963851		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_014720647.1|465695_467129_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	2.0e-137
WP_003156784.1|467360_468407_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	27.0	8.7e-13
WP_160222803.1|468381_469332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007408029.1|469328_470597_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.5	2.1e-21
>prophage 39
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	491725	493416	3963851		Staphylococcus_phage(50.0%)	2	NA	NA
WP_014416754.1|491725_492595_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	3.6e-12
WP_007615256.1|492570_493416_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	1.0e-19
>prophage 40
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	511138	521972	3963851		Streptococcus_phage(33.33%)	6	NA	NA
WP_007410399.1|511138_513217_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	2.4e-62
WP_003156447.1|513269_513740_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003156445.1|513779_514196_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003156443.1|514311_514560_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_007410398.1|514728_518328_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.1	8.9e-65
WP_003156440.1|518390_521972_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.4	4.0e-49
>prophage 41
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	525467	526001	3963851		Bacillus_virus(100.0%)	1	NA	NA
WP_003156423.1|525467_526001_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.8	5.4e-11
>prophage 42
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	529022	530423	3963851	tRNA	Catovirus(100.0%)	1	NA	NA
WP_160222801.1|529022_530423_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.4	2.6e-60
>prophage 43
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	537879	540312	3963851	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_007410388.1|537879_540312_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	35.4	4.4e-132
>prophage 44
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	553753	555253	3963851	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_014416740.1|553753_555253_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.2	9.0e-96
>prophage 45
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	559100	567589	3963851	protease	Acinetobacter_phage(20.0%)	8	NA	NA
WP_011996185.1|559100_559688_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	57.0	1.1e-62
WP_025284092.1|559703_561116_-	aminodeoxychorismate synthase, component I	NA	A0A0B5J984	Pandoravirus	30.7	1.9e-34
WP_007615206.1|561283_562210_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.5	2.0e-109
WP_039062448.1|562285_563176_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_004264606.1|563221_564097_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_007409940.1|564107_564884_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_160222798.1|565032_566952_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.0	8.5e-115
WP_004264611.1|567049_567589_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	24.3	1.0e-04
>prophage 46
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	579246	579783	3963851		Paenibacillus_phage(100.0%)	1	NA	NA
WP_004264646.1|579246_579783_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 47
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	585158	587504	3963851		Hokovirus(50.0%)	2	NA	NA
WP_007409928.1|585158_586112_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.1	3.9e-44
WP_004264658.1|586133_587504_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	34.8	7.1e-31
>prophage 48
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	593927	607314	3963851	tRNA	Streptococcus_phage(37.5%)	15	NA	NA
WP_023356663.1|593927_595253_-	DUF348 domain-containing protein	NA	A0A0E3D983	Bacillus_phage	73.0	5.3e-23
WP_025284081.1|595387_596155_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011996169.1|596230_598222_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.4	8.0e-100
WP_004264711.1|598711_598996_+	transition state genes transcriptional regulator AbrB	NA	A0A2I7SC16	Paenibacillus_phage	71.4	1.0e-16
WP_160222794.1|599045_599927_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	48.4	4.0e-67
WP_007409921.1|599901_600201_-	GIY-YIG nuclease family protein	NA	A0A068LKN9	Peridroma_alphabaculovirus	40.3	9.4e-05
WP_004264717.1|600187_600931_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004264720.1|600991_601351_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_004264723.1|601365_602193_-	competence/sporulation regulator complex protein RicT	NA	NA	NA	NA	NA
WP_007409919.1|602195_603185_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	32.8	2.5e-33
WP_004264730.1|603196_603637_-	DUF327 family protein	NA	NA	NA	NA	NA
WP_004264734.1|603649_603979_-	cyclic di-AMP receptor DarA	NA	NA	NA	NA	NA
WP_007409918.1|604049_604688_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	55.9	4.1e-58
WP_160222793.1|604684_606118_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_015239016.1|606195_607314_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	29.6	1.1e-34
>prophage 49
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	615230	616922	3963851		Clostridium_phage(100.0%)	1	NA	NA
WP_011996162.1|615230_616922_-	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	35.1	9.6e-54
>prophage 50
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	619971	629083	3963851	tRNA	Lactobacillus_virus(16.67%)	8	NA	NA
WP_160222792.1|619971_620595_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	33.5	5.3e-18
WP_007615132.1|620591_621245_+	deoxynucleoside kinase	NA	A0A127AVX2	Bacillus_phage	35.7	1.2e-25
WP_124692622.1|621685_622831_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.7	5.7e-50
WP_007408744.1|622841_624119_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.5	1.3e-98
WP_007615126.1|624438_625029_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_003150714.1|625050_625935_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_015239011.1|626132_627464_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.3	1.1e-20
WP_007408741.1|627616_629083_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	5.5e-98
>prophage 51
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	635489	643015	3963851		Bacillus_virus(66.67%)	6	NA	NA
WP_015239009.1|635489_637949_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.9	2.1e-113
WP_011996153.1|638164_640081_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	48.0	2.7e-153
WP_004392908.1|640137_640383_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_007409910.1|640400_641513_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004392910.1|641528_641744_-	ribosome maturation protein RlbA	NA	NA	NA	NA	NA
WP_007409909.1|641878_643015_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	32.9	1.1e-16
>prophage 52
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	651774	655173	3963851	protease	Leptospira_phage(25.0%)	4	NA	NA
WP_007409900.1|651774_652626_+	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	35.7	2.8e-17
WP_007409899.1|652924_653686_+	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	30.6	5.0e-26
WP_012118944.1|653678_654530_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	38.2	2.3e-19
WP_004392969.1|654558_655173_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	42.3	2.4e-18
>prophage 53
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	661027	663912	3963851		Bacillus_phage(33.33%)	5	NA	NA
WP_004392979.1|661027_661546_+	single-stranded DNA-binding protein	NA	M5ABV5	Bacillus_phage	70.9	2.1e-52
WP_004392983.1|661589_661829_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_160222791.1|662021_662603_+	methylphosphotriester-DNA--protein-cysteine methyltransferase family protein	NA	NA	NA	NA	NA
WP_015240986.1|662599_663157_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	45.8	2.1e-18
WP_124692627.1|663153_663912_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	45.1	2.1e-61
>prophage 54
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	679370	681474	3963851		Streptococcus_phage(50.0%)	3	NA	NA
WP_012118921.1|679370_680249_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.6	1.3e-33
WP_007409877.1|680387_680822_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004393039.1|680835_681474_+	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	49.0	3.1e-05
>prophage 55
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	688493	690050	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_160222786.1|688493_690050_-	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	38.2	1.9e-88
>prophage 56
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	706543	719884	3963851	protease	Bacillus_phage(42.86%)	11	NA	NA
WP_004393100.1|706543_707908_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.1	3.6e-128
WP_041482233.1|708024_708438_+	VOC family protein	NA	NA	NA	NA	NA
WP_012118894.1|708676_709969_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	35.9	1.1e-68
WP_004393104.1|710934_711642_+	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	42.3	1.2e-45
WP_160222782.1|711648_713484_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.1	1.7e-35
WP_025285568.1|713473_714832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160222781.1|714818_715658_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_007407895.1|715672_716467_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	34.1	4.1e-39
WP_007614967.1|716553_717750_+|protease	serine protease	protease	W5SAB9	Pithovirus	32.1	1.4e-11
WP_042635664.1|718259_718469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069007590.1|718465_719884_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	35.9	1.3e-32
>prophage 57
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	723678	733857	3963851		Klosneuvirus(40.0%)	9	NA	NA
WP_059367460.1|723678_725304_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.6	1.2e-45
WP_007407887.1|725317_726037_+	cupin	NA	NA	NA	NA	NA
WP_099567296.1|726078_727464_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_015240946.1|727668_727956_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	2.8e-06
WP_099567232.1|727952_728588_+	SdpI family protein	NA	NA	NA	NA	NA
WP_004393130.1|728817_730023_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	3.4e-29
WP_020958097.1|730246_731647_+	amino acid permease	NA	NA	NA	NA	NA
WP_007407883.1|731720_732611_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	28.8	5.8e-26
WP_032868107.1|732741_733857_+	aspartate phosphatase	NA	D6R410	Bacillus_phage	30.4	6.4e-38
>prophage 58
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	744230	746117	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_152535318.1|744230_746117_+	UvrD-helicase domain-containing protein	NA	S5MMD7	Bacillus_phage	21.4	4.0e-16
>prophage 59
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	762620	765427	3963851		Lactococcus_phage(100.0%)	2	NA	NA
WP_012118862.1|762620_763853_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	32.6	5.0e-52
WP_150941535.1|763897_765427_-	alkyl hydroperoxide reductase subunit F	NA	V9VEY6	Lactococcus_phage	29.4	3.7e-20
>prophage 60
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	778268	783465	3963851		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_160223375.1|778268_780149_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	32.9	1.7e-83
WP_032869301.1|780191_781580_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_007407843.1|781699_782632_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_007614879.1|782709_783465_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.5	1.1e-20
>prophage 61
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	797102	797876	3963851		Planktothrix_phage(100.0%)	1	NA	NA
WP_007614823.1|797102_797876_+	ABC transporter ATP-binding protein YxdL	NA	G9BWD6	Planktothrix_phage	36.8	9.9e-30
>prophage 62
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	807560	808862	3963851		Geobacillus_virus(100.0%)	1	NA	NA
WP_160223365.1|807560_808862_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	60.7	7.2e-134
>prophage 63
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	814261	821696	3963851		Catovirus(50.0%)	5	NA	NA
WP_039063838.1|814261_815800_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.6	4.7e-92
WP_004393292.1|815912_816359_-	hut operon transcriptional regulator HutP	NA	NA	NA	NA	NA
WP_124692658.1|816600_818007_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_160223362.1|818186_818576_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_160223361.1|818564_821696_-	DUF3427 domain-containing protein	NA	A0A1B1IW48	uncultured_Mediterranean_phage	24.4	1.4e-26
>prophage 64
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	840881	842321	3963851		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_136396724.1|840881_842321_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	34.8	5.9e-60
>prophage 65
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	847090	849142	3963851		Tupanvirus(100.0%)	1	NA	NA
WP_136396722.1|847090_849142_+	catalase	NA	A0A2K9L0T1	Tupanvirus	52.5	4.9e-153
>prophage 66
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	853273	854410	3963851		uncultured_virus(100.0%)	1	NA	NA
WP_044802395.1|853273_854410_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.8	1.6e-89
>prophage 67
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	857426	876563	3963851		Tupanvirus(25.0%)	15	NA	NA
WP_014419237.1|857426_858443_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	50.2	2.0e-94
WP_119834765.1|858489_859029_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_003150818.1|859541_860378_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	34.3	2.3e-40
WP_094032018.1|860544_861438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061581619.1|861554_862655_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.2	1.6e-20
WP_012118785.1|862754_863597_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_160223351.1|863631_864975_-	malate permease	NA	A0A140XAH4	Dickeya_phage	32.9	5.0e-05
WP_007614697.1|865477_866884_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_014722010.1|866867_867884_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052827999.1|867883_869587_+	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	31.9	2.5e-17
WP_012118781.1|869583_871314_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	22.3	1.6e-16
WP_052827997.1|871405_872236_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_160223350.1|872249_873608_-	cytosine permease	NA	NA	NA	NA	NA
WP_039063822.1|873924_874911_+	choloylglycine hydrolase family protein	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	30.3	6.7e-31
WP_160223349.1|874949_876563_-	catalase	NA	A0A2K9L572	Tupanvirus	45.4	3.0e-97
>prophage 68
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	879584	884810	3963851		Pandoravirus(33.33%)	6	NA	NA
WP_025285483.1|879584_880985_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.3	4.7e-46
WP_012118772.1|881014_882334_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_122504263.1|882352_882670_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_094031394.1|882684_882996_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_061581630.1|883148_884447_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	65.6	6.7e-156
WP_108654954.1|884459_884810_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.4	1.4e-12
>prophage 69
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	897164	957272	3963851	lysis,holin,transposase,coat	Bacillus_phage(23.08%)	65	NA	NA
WP_015240830.1|897164_898346_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	25.4	1.2e-18
WP_015240829.1|898342_899854_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2H4PQU7	Staphylococcus_phage	24.2	5.5e-16
WP_003150882.1|899869_900019_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003150884.1|900462_901398_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_007407732.1|901529_902162_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_007407730.1|902421_903282_+	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.5	1.4e-05
WP_160223345.1|903336_905082_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	43.6	1.8e-42
WP_007407728.1|905243_906578_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_012118757.1|906606_906990_-	VOC family protein	NA	NA	NA	NA	NA
WP_007407727.1|907084_908272_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	43.7	6.3e-76
WP_132106632.1|908354_909257_-	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_132106644.1|909243_910005_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003150901.1|910160_910355_-	YwbE family protein	NA	NA	NA	NA	NA
WP_015240826.1|910483_911164_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_007407725.1|911145_911532_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003150908.1|911638_912547_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160223344.1|912549_913389_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_160223343.1|913364_914039_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_025285468.1|914239_914434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223342.1|914452_915709_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_012118748.1|915794_916397_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_020958014.1|916417_917092_-	Streptomycin biosynthesis protein	NA	NA	NA	NA	NA
WP_007407718.1|917091_917772_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003150917.1|917988_918150_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
WP_059367558.1|918485_919109_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032869853.1|919188_919575_+	GtrA family protein	NA	NA	NA	NA	NA
WP_063093947.1|919626_920811_+	galactokinase	NA	NA	NA	NA	NA
WP_160223341.1|920800_922342_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_160223007.1|922383_923534_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
WP_003150926.1|923649_923895_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_087920812.1|924397_925363_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_012118743.1|925390_927340_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003150930.1|927354_927969_+	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_007407711.1|927970_928339_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003150937.1|928382_928643_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_042635595.1|928936_929395_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007407709.1|929596_930784_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_007407708.1|930886_931636_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_059367565.1|931797_932799_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_160223340.1|932844_935253_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.8	3.8e-19
WP_025285458.1|935778_936093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407705.1|936116_936947_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_020958006.1|937165_938548_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_098081874.1|938544_939984_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.5	6.3e-22
WP_007407702.1|940083_940323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099567183.1|940354_941167_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003150960.1|941316_941655_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160223339.1|941647_942283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223338.1|942327_942855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407698.1|942939_943746_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015240810.1|943760_944444_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	5.4e-48
WP_015387535.1|944503_944926_+	YwdI family protein	NA	NA	NA	NA	NA
WP_015240808.1|944944_946264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150969.1|946327_946699_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_007614539.1|946746_947292_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_015240806.1|947572_948343_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	25.4	5.8e-06
WP_114354765.1|948347_949772_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_160223337.1|949794_950964_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_059367570.1|950964_951828_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012118725.1|951827_952949_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_160223336.1|952938_953682_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_160223335.1|953683_954688_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_031378582.1|954715_955453_+	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_007407684.1|955455_956403_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	5.9e-69
WP_012118721.1|956423_957272_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	3.1e-37
>prophage 70
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	964856	969753	3963851		Salmonella_phage(50.0%)	5	NA	NA
WP_015240794.1|964856_966059_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.4	1.1e-27
WP_132105635.1|966281_967520_+	MFS transporter	NA	NA	NA	NA	NA
WP_015418458.1|967680_968295_+	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_003151000.1|968284_968995_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_007407673.1|968991_969753_+	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	4.8e-21
>prophage 71
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	977621	978521	3963851		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_039253434.1|977621_978521_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
>prophage 72
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	983266	988076	3963851		Staphylococcus_phage(50.0%)	6	NA	NA
WP_020957981.1|983266_984187_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	1.7e-36
WP_053573954.1|984284_984839_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_015240785.1|984839_985115_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012118695.1|985414_986188_-	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151034.1|986390_986615_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_136396689.1|986774_988076_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
>prophage 73
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	999959	1001105	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_015240777.1|999959_1001105_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	42.6	1.6e-76
>prophage 74
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1014237	1015701	3963851		Escherichia_phage(100.0%)	1	NA	NA
WP_076424664.1|1014237_1015701_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	43.6	4.2e-21
>prophage 75
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1019399	1022497	3963851		Bacillus_phage(100.0%)	3	NA	NA
WP_069006841.1|1019399_1021124_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.7	6.6e-58
WP_003151087.1|1021193_1021466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025285415.1|1021534_1022497_-	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	34.9	3.4e-40
>prophage 76
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1026951	1031457	3963851		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_007407615.1|1026951_1028559_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	2.8e-151
WP_160223328.1|1028606_1029128_-	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_012118670.1|1029292_1029667_+	sporulation initiation phosphotransferase Spo0F	NA	W8CYM9	Bacillus_phage	36.5	1.3e-11
WP_003151102.1|1029842_1030700_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_007407613.1|1030818_1031457_+	fructose-6-phosphate aldolase	NA	A0A1D7SX77	Cyanophage	50.0	4.3e-47
>prophage 77
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1036154	1036739	3963851		Mycoplasma_phage(100.0%)	1	NA	NA
WP_015240762.1|1036154_1036739_+	thymidine kinase	NA	Q6GYZ9	Mycoplasma_phage	39.1	3.7e-29
>prophage 78
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1040963	1042034	3963851		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003151139.1|1040963_1042034_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	3.1e-05
>prophage 79
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1045117	1049847	3963851		Pandoravirus(50.0%)	6	NA	NA
WP_007407602.1|1045117_1046158_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	42.7	1.2e-59
WP_015418417.1|1046226_1046784_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_007407600.1|1046857_1047313_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_003151149.1|1047446_1047896_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_007407598.1|1047909_1048452_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_015418416.1|1048599_1049847_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.4	1.5e-99
>prophage 80
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1061289	1062321	3963851		Pseudomonas_phage(100.0%)	1	NA	NA
WP_082998278.1|1061289_1062321_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	41.1	1.9e-44
>prophage 81
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1066628	1067759	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_007407584.1|1066628_1067759_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	41.7	1.2e-79
>prophage 82
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1077102	1077972	3963851		Clostridium_phage(100.0%)	1	NA	NA
WP_007407571.1|1077102_1077972_+	M23 family metallopeptidase	NA	I3PV24	Clostridium_phage	38.3	1.1e-05
>prophage 83
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1087830	1088112	3963851		Clostridium_phage(100.0%)	1	NA	NA
WP_003151236.1|1087830_1088112_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	50.7	9.4e-15
>prophage 84
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1094331	1105322	3963851		Listeria_phage(25.0%)	10	NA	NA
WP_003151249.1|1094331_1094673_+	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	63.2	3.2e-33
WP_015418394.1|1094881_1095664_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_132105688.1|1095660_1096518_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_059367658.1|1096630_1099405_-	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	26.3	4.6e-37
WP_015240739.1|1099391_1101002_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_003151259.1|1101205_1101349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407552.1|1101564_1102311_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_007614272.1|1102297_1102987_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	35.9	7.0e-27
WP_160223325.1|1103032_1103797_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_012118631.1|1103996_1105322_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.4	1.4e-87
>prophage 85
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1110666	1111383	3963851		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_160223323.1|1110666_1111383_+	endonuclease V	NA	A0A167R397	Powai_lake_megavirus	29.0	7.7e-21
>prophage 86
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1119769	1122205	3963851		Staphylococcus_phage(50.0%)	2	NA	NA
WP_025285383.1|1119769_1121101_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	30.6	3.1e-55
WP_007407528.1|1121296_1122205_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	1.2e-10
>prophage 87
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1128138	1129632	3963851		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_043021862.1|1128138_1129632_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.8	4.3e-13
>prophage 88
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1139529	1140765	3963851		Clostridioides_phage(100.0%)	1	NA	NA
WP_015240713.1|1139529_1140765_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.7	1.4e-17
>prophage 89
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1143938	1145315	3963851		Aichi_virus(100.0%)	1	NA	NA
WP_025285372.1|1143938_1145315_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	30.5	9.6e-36
>prophage 90
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1151824	1158922	3963851		Staphylococcus_virus(33.33%)	5	NA	NA
WP_160223315.1|1151824_1154470_+	SH3 domain-containing protein	NA	Q4ZC50	Staphylococcus_virus	44.8	1.3e-36
WP_160223314.1|1154531_1155698_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_012118587.1|1155730_1156501_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_003151361.1|1156856_1157246_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	43.4	1.1e-18
WP_160223313.1|1157383_1158922_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.7	7.8e-10
>prophage 91
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1163763	1171128	3963851		Bacillus_phage(50.0%)	6	NA	NA
WP_020956427.1|1163763_1164648_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.7	3.9e-83
WP_059367692.1|1164876_1166016_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.4	3.1e-24
WP_003151369.1|1166047_1166965_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160223311.1|1167145_1167463_+	LytA	NA	NA	NA	NA	NA
WP_160223310.1|1167495_1169616_+	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	29.8	2.6e-16
WP_160223309.1|1169637_1171128_+	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	31.3	4.6e-15
>prophage 92
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1174686	1176027	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_160223305.1|1174686_1176027_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.0	3.6e-88
>prophage 93
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1182788	1188028	3963851		Streptococcus_phage(66.67%)	5	NA	NA
WP_061581228.1|1182788_1183436_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	42.6	1.7e-38
WP_007407484.1|1183658_1184822_+	two-component sensor histidine kinase DegS	NA	NA	NA	NA	NA
WP_003219701.1|1184898_1185588_+	two-component system response regulator DegU	NA	NA	NA	NA	NA
WP_003151387.1|1185685_1186534_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.6	7.5e-15
WP_160223300.1|1186642_1188028_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.2	1.6e-59
>prophage 94
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1193967	1194192	3963851		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003151402.1|1193967_1194192_+	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	49.0	6.4e-06
>prophage 95
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1204655	1209246	3963851		Planktothrix_phage(50.0%)	4	NA	NA
WP_007407465.1|1204655_1205342_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.8	3.8e-25
WP_007407464.1|1205334_1206225_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_160223298.1|1206271_1207678_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_160223297.1|1207845_1209246_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.8	1.5e-23
>prophage 96
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1213472	1221554	3963851		Hokovirus(50.0%)	4	NA	NA
WP_160223295.1|1213472_1215974_-	phosphotransferase	NA	A0A1V0SGR7	Hokovirus	30.7	4.8e-33
WP_003151438.1|1216275_1216512_+	CsbA family protein	NA	NA	NA	NA	NA
WP_003151439.1|1216687_1218673_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_020954334.1|1218680_1221554_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	0.0e+00
>prophage 97
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1242289	1254101	3963851		Bacillus_phage(50.0%)	10	NA	NA
WP_015240668.1|1242289_1244059_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	60.0	4.1e-164
WP_012118540.1|1244254_1244932_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	56.6	9.8e-66
WP_007614006.1|1244928_1245990_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	38.8	1.2e-62
WP_015240667.1|1246105_1247560_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015240666.1|1247956_1249363_+	cell wall DL-endopeptidase	NA	A0A0A0RVE6	Bacillus_phage	52.6	2.4e-26
WP_007407423.1|1249569_1250520_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.9	3.7e-87
WP_003151491.1|1250793_1251261_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_012118535.1|1251286_1252174_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.8	5.1e-06
WP_007407422.1|1252170_1253124_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	39.9	2.6e-64
WP_007407421.1|1253150_1254101_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	6.6e-52
>prophage 98
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1259261	1261907	3963851		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_015240658.1|1259261_1260851_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.8	6.5e-44
WP_003151506.1|1260895_1261216_-	hypothetical protein	NA	G3MBI9	Bacillus_virus	43.3	2.3e-17
WP_015240657.1|1261331_1261907_+	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	26.4	2.0e-11
>prophage 99
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1265777	1266374	3963851		Agrobacterium_phage(100.0%)	1	NA	NA
WP_003151513.1|1265777_1266374_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	7.5e-54
>prophage 100
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1277983	1288931	3963851		Mollivirus(25.0%)	10	NA	NA
WP_160223287.1|1277983_1279432_-	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	34.4	1.0e-35
WP_003151541.1|1279512_1279968_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_031378299.1|1280212_1280920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407393.1|1280925_1281606_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_039063749.1|1281851_1283645_+	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	29.4	2.0e-25
WP_122504210.1|1283660_1284800_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_160223286.1|1284796_1285639_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	25.9	9.2e-05
WP_160223285.1|1285631_1286768_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_032867035.1|1286771_1287875_+	EpsG family protein	NA	NA	NA	NA	NA
WP_136396632.1|1287893_1288931_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	43.5	6.0e-14
>prophage 101
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1293810	1294983	3963851		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_007407381.1|1293810_1294983_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.6	2.0e-10
>prophage 102
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1327771	1329064	3963851		Streptococcus_phage(100.0%)	1	NA	NA
WP_007409956.1|1327771_1329064_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	71.0	1.9e-174
>prophage 103
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1332161	1337704	3963851		Tupanvirus(33.33%)	6	NA	NA
WP_025285296.1|1332161_1333292_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	31.0	8.4e-38
WP_160223278.1|1333288_1334218_+	NAD(P)-dependent oxidoreductase	NA	M1I3H4	Acanthocystis_turfacea_Chlorella_virus	28.0	5.5e-19
WP_160223277.1|1334183_1335440_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_015240612.1|1335451_1336333_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007409964.1|1336305_1337064_+	WbqC family protein	NA	NA	NA	NA	NA
WP_053574060.1|1337026_1337704_+	PIG-L family deacetylase	NA	A0A2D2W2P2	Stenotrophomonas_phage	28.3	1.1e-13
>prophage 104
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1344929	1346069	3963851	holin	Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003151651.1|1344929_1346069_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	7.3e-13
>prophage 105
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1349220	1353489	3963851	holin	Anomala_cuprea_entomopoxvirus(50.0%)	5	NA	NA
WP_014418902.1|1349220_1350366_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	4.3e-13
WP_007409977.1|1350382_1351036_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015240602.1|1351050_1351968_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_040238875.1|1351986_1352664_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007613824.1|1352775_1353489_+	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	46.6	5.7e-56
>prophage 106
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1357551	1362974	3963851		Thermus_phage(50.0%)	7	NA	NA
WP_069007388.1|1357551_1357983_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	64.2	6.5e-15
WP_003151677.1|1358007_1358418_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.0	7.8e-18
WP_087920807.1|1358613_1358799_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003151681.1|1358922_1359153_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_007409986.1|1359271_1360012_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_025285276.1|1360030_1362364_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.4	1.2e-86
WP_003151688.1|1362503_1362974_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.3	7.0e-47
>prophage 107
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1369528	1370308	3963851		Planktothrix_phage(100.0%)	1	NA	NA
WP_080130081.1|1369528_1370308_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	1.9e-36
>prophage 108
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1379399	1384090	3963851		uncultured_virus(50.0%)	2	NA	NA
WP_160223272.1|1379399_1381829_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.8	1.3e-115
WP_160223271.1|1381978_1384090_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.0	7.7e-117
>prophage 109
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1387124	1389440	3963851		Saudi_moumouvirus(100.0%)	1	NA	NA
WP_025285261.1|1387124_1389440_+	ATP-binding domain-containing protein	NA	A0A1S5V1I8	Saudi_moumouvirus	26.9	1.0e-05
>prophage 110
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1396276	1400340	3963851		Staphylococcus_phage(100.0%)	4	NA	NA
WP_007410023.1|1396276_1397107_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	54.9	2.7e-78
WP_160223270.1|1397139_1398285_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_094031275.1|1398286_1399381_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025285256.1|1399404_1400340_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	9.8e-24
>prophage 111
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1404846	1407227	3963851		Streptococcus_phage(50.0%)	2	NA	NA
WP_132105859.1|1404846_1406703_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	35.7	5.9e-89
WP_003151759.1|1406744_1407227_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.3	2.4e-10
>prophage 112
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1412802	1413606	3963851		Indivirus(100.0%)	1	NA	NA
WP_007613715.1|1412802_1413606_+	ABC transporter ATP-binding protein	NA	A0A1V0SD74	Indivirus	27.5	1.3e-08
>prophage 113
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1416753	1419212	3963851		Bacillus_phage(50.0%)	2	NA	NA
WP_003151779.1|1416753_1417473_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	2.3e-33
WP_015240563.1|1417469_1419212_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.7	9.7e-17
>prophage 114
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1423134	1424361	3963851		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160223266.1|1423134_1424361_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.2	1.7e-12
>prophage 115
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1439079	1441906	3963851		Bacillus_phage(33.33%)	3	NA	NA
WP_007410069.1|1439079_1439757_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	8.1e-28
WP_063094410.1|1440033_1441395_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.1	5.6e-20
WP_041482217.1|1441441_1441906_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	48.6	5.3e-31
>prophage 116
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1445460	1446285	3963851		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_012118397.1|1445460_1446285_+	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	28.6	3.2e-10
>prophage 117
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1459320	1471506	3963851		Streptococcus_phage(16.67%)	17	NA	NA
WP_003151843.1|1459320_1459677_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	51.9	2.9e-21
WP_003151844.1|1459736_1460120_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003151845.1|1460174_1460411_+	YusG family protein	NA	NA	NA	NA	NA
WP_032869737.1|1460480_1460846_+	TOPRIM domain-containing protein	NA	NA	NA	NA	NA
WP_003151847.1|1460848_1461169_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_007410085.1|1461265_1461616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223261.1|1461939_1462965_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	2.2e-32
WP_012118383.1|1462957_1463626_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012118382.1|1463639_1464455_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_088056427.1|1464539_1464926_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003151857.1|1465118_1465271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003327022.1|1465447_1466233_+	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	22.7	3.5e-06
WP_015240539.1|1466250_1467564_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_007410089.1|1467563_1468784_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.6	6.8e-118
WP_003151877.1|1468773_1469217_+	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	39.4	1.8e-15
WP_007410090.1|1469236_1470634_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_015240537.1|1470669_1471506_-	chitosanase	NA	A0A223LHY0	Streptomyces_phage	31.4	2.6e-20
>prophage 118
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1478120	1479107	3963851		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_032867108.1|1478120_1479107_+	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	25.7	7.7e-11
>prophage 119
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1484025	1485132	3963851		Mycoplasma_phage(100.0%)	1	NA	NA
WP_122504183.1|1484025_1485132_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	47.3	2.8e-17
>prophage 120
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1488885	1494124	3963851	transposase	Bodo_saltans_virus(33.33%)	4	NA	NA
WP_160223257.1|1488885_1490082_+	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	20.5	2.0e-05
WP_160223256.1|1490139_1491273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223255.1|1491611_1492762_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
WP_160223254.1|1492996_1494124_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.8	1.0e-88
>prophage 121
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1502051	1506412	3963851		Staphylococcus_phage(50.0%)	6	NA	NA
WP_160223252.1|1502051_1503029_-	M23 family metallopeptidase	NA	A0A1J0MFP9	Staphylococcus_phage	36.2	4.6e-08
WP_003151923.1|1503231_1504128_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003151928.1|1504344_1504620_+	YutD family protein	NA	NA	NA	NA	NA
WP_007408729.1|1504645_1505080_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_007408728.1|1505113_1505884_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_003151934.1|1505911_1506412_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.4	6.8e-40
>prophage 122
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1513189	1518309	3963851		Prochlorococcus_phage(33.33%)	7	NA	NA
WP_003151955.1|1513189_1513426_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	44.3	2.9e-09
WP_015418136.1|1513604_1513931_+	YuzD family protein	NA	NA	NA	NA	NA
WP_007613539.1|1513968_1515036_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007408721.1|1515302_1515539_+	YuzB family protein	NA	NA	NA	NA	NA
WP_012118346.1|1515672_1516890_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	23.5	7.0e-14
WP_043020740.1|1517013_1517868_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003151967.1|1517946_1518309_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	44.9	1.4e-18
>prophage 123
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1523093	1532103	3963851		Staphylococcus_phage(20.0%)	11	NA	NA
WP_015240505.1|1523093_1523798_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.7	9.9e-29
WP_025285208.1|1523794_1524322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003151978.1|1524338_1524560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015240502.1|1524620_1525601_-	GMP reductase	NA	G3MBI2	Bacillus_virus	82.8	1.7e-156
WP_003151984.1|1526001_1526997_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	51.6	2.3e-31
WP_041482027.1|1527308_1528529_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007408708.1|1528702_1528828_+	YuiA family protein	NA	NA	NA	NA	NA
WP_025285206.1|1528896_1529217_+	membrane protein	NA	NA	NA	NA	NA
WP_015240498.1|1529317_1529959_+	3D domain-containing protein	NA	A0A127AW72	Bacillus_phage	43.2	2.8e-14
WP_025285204.1|1529988_1530465_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_007613484.1|1530612_1532103_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.0	3.7e-57
>prophage 124
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1540688	1547816	3963851		Tupanvirus(100.0%)	1	NA	NA
WP_160223250.1|1540688_1547816_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.0	7.8e-97
>prophage 125
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1553633	1558109	3963851		Mycobacterium_phage(100.0%)	1	NA	NA
WP_160223248.1|1553633_1558109_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.3	2.2e-33
>prophage 126
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1566548	1568015	3963851		Bacillus_virus(100.0%)	1	NA	NA
WP_020954301.1|1566548_1568015_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.9	1.1e-117
>prophage 127
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1583294	1584827	3963851		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_160223243.1|1583294_1584827_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.5	6.3e-12
>prophage 128
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1615877	1624861	3963851		uncultured_Caudovirales_phage(80.0%)	5	NA	NA
WP_160223233.1|1615877_1617863_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.7	9.4e-16
WP_032867208.1|1618047_1620036_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.2	5.5e-16
WP_099567041.1|1620163_1622149_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.9	1.4e-14
WP_012118283.1|1622264_1624271_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.0	2.1e-15
WP_003152143.1|1624336_1624861_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	35.4	2.6e-18
>prophage 129
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1630995	1631841	3963851		Brevibacillus_phage(100.0%)	1	NA	NA
WP_007410172.1|1630995_1631841_+	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	1.1e-26
>prophage 130
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1638726	1640256	3963851		Orpheovirus(100.0%)	1	NA	NA
WP_160223232.1|1638726_1640256_+	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	2.1e-07
>prophage 131
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1654825	1657401	3963851		Staphylococcus_phage(50.0%)	2	NA	NA
WP_015240439.1|1654825_1656289_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	34.9	1.0e-75
WP_038459593.1|1656285_1657401_+	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	22.2	1.9e-13
>prophage 132
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1661524	1673994	3963851	holin	Staphylococcus_phage(57.14%)	15	NA	NA
WP_003152235.1|1661524_1661752_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	66.2	6.9e-24
WP_003152237.1|1661877_1662351_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_100001563.1|1662465_1662909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007408836.1|1662905_1663055_-	YtzI protein	NA	NA	NA	NA	NA
WP_007408835.1|1663179_1663617_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	2.2e-47
WP_007408834.1|1663768_1664173_+|holin	holin family protein	holin	NA	NA	NA	NA
WP_003152244.1|1664305_1664785_+	nucleoside triphosphatase YtkD	NA	NA	NA	NA	NA
WP_012118258.1|1664820_1665633_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003152246.1|1665607_1666390_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.0	1.6e-32
WP_007408830.1|1666401_1667406_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015240429.1|1667543_1668317_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	39.0	4.9e-37
WP_003152249.1|1668374_1668617_+	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_007408828.1|1668659_1670243_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.4	2.8e-196
WP_003152253.1|1670749_1671952_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	74.4	9.6e-165
WP_160223231.1|1672095_1673994_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	28.3	1.3e-30
>prophage 133
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1678587	1680134	3963851		Staphylococcus_phage(100.0%)	2	NA	NA
WP_003152267.1|1678587_1679169_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	53.7	8.1e-45
WP_007408822.1|1679165_1680134_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	74.5	3.2e-54
>prophage 134
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1684839	1685718	3963851		Staphylococcus_phage(100.0%)	1	NA	NA
WP_007613240.1|1684839_1685718_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	1.4e-19
>prophage 135
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1688726	1689422	3963851		Planktothrix_phage(100.0%)	1	NA	NA
WP_032871660.1|1688726_1689422_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	1.0e-38
>prophage 136
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1692580	1701870	3963851	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
WP_015240420.1|1692580_1693336_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	35.8	1.3e-18
WP_160223225.1|1693332_1695273_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038459565.1|1695380_1696100_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_160223224.1|1696295_1697480_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	52.3	1.3e-100
WP_007408808.1|1697522_1698308_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_015418038.1|1698695_1699031_+	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_038459560.1|1699455_1701870_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.6	0.0e+00
>prophage 137
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1708707	1711688	3963851		Vibrio_phage(50.0%)	2	NA	NA
WP_007613202.1|1708707_1710243_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	4.7e-23
WP_007408798.1|1710422_1711688_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.0	3.4e-27
>prophage 138
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1714938	1720634	3963851		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_007408794.1|1714938_1715643_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.1	3.8e-20
WP_038459546.1|1715639_1716800_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014418668.1|1716833_1718138_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.4	1.2e-48
WP_038459543.1|1718233_1719625_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_020954278.1|1719662_1720634_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.1	1.2e-80
>prophage 139
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1730703	1734907	3963851		Staphylococcus_phage(50.0%)	3	NA	NA
WP_012118213.1|1730703_1731513_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	51.5	9.0e-34
WP_094031890.1|1731527_1732133_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_160223220.1|1732300_1734907_+	DUF87 domain-containing protein	NA	S5VNE3	Mycobacterium_phage	49.3	9.2e-88
>prophage 140
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1738057	1739134	3963851		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_003152383.1|1738057_1739134_+	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	28.7	8.1e-14
>prophage 141
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1744613	1747934	3963851	tRNA	Staphylococcus_phage(50.0%)	2	NA	NA
WP_012118204.1|1744613_1746332_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	72.1	7.2e-206
WP_160223217.1|1746668_1747934_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.8	8.4e-79
>prophage 142
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1751946	1755648	3963851	integrase	Staphylococcus_phage(50.0%)	6	1752195:1752208	1763372:1763385
WP_082998837.1|1751946_1752699_+	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	46.3	7.3e-54
1752195:1752208	attL	CAGCGGCGTTAATA	NA	NA	NA	NA
WP_025285115.1|1752984_1753494_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_007408759.1|1753663_1753891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108725290.1|1753896_1753971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082998836.1|1754128_1755319_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_099320110.1|1755429_1755648_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	68.5	3.6e-14
1763372:1763385	attR	TATTAACGCCGCTG	NA	NA	NA	NA
>prophage 143
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1758656	1762703	3963851		Bacillus_phage(100.0%)	4	NA	NA
WP_059368222.1|1758656_1759769_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	97.3	5.1e-205
WP_003152406.1|1760061_1760664_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_015418007.1|1760692_1760917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007408036.1|1760954_1762703_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.5	1.5e-20
>prophage 144
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1770740	1776328	3963851		Bacillus_phage(33.33%)	5	NA	NA
WP_007408043.1|1770740_1770962_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	82.1	8.2e-22
WP_012118182.1|1771110_1772697_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.0	1.9e-75
WP_160223214.1|1772720_1774316_+	amidohydrolase	NA	NA	NA	NA	NA
WP_025285105.1|1774332_1775139_-	NAD kinase	NA	NA	NA	NA	NA
WP_003152419.1|1775320_1776328_+	signal peptide peptidase SppA	NA	Q6UAX7	Klebsiella_phage	27.8	1.2e-16
>prophage 145
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1790564	1793903	3963851		Saccharomonospora_phage(100.0%)	1	NA	NA
WP_160223212.1|1790564_1793903_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	34.7	5.0e-179
>prophage 146
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1806830	1817753	3963851		Bacillus_phage(50.0%)	9	NA	NA
WP_003152454.1|1806830_1808102_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	4.0e-12
WP_003152455.1|1808147_1809086_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003152457.1|1809301_1810021_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.3	5.0e-44
WP_124692782.1|1810013_1811753_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	42.4	2.0e-46
WP_082998824.1|1811999_1814639_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	29.2	5.4e-43
WP_025285093.1|1814663_1815494_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	31.2	2.5e-23
WP_003152461.1|1815630_1816263_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_082998823.1|1816278_1816872_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_007408081.1|1816910_1817753_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	51.5	5.1e-80
>prophage 147
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1821049	1834213	3963851	tRNA,holin	Synechococcus_phage(20.0%)	13	NA	NA
WP_003152471.1|1821049_1821430_+	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.8	2.1e-17
WP_003152473.1|1821678_1822137_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_082998822.1|1822248_1823658_+	Replication initiation and membrane attachment protein	NA	NA	NA	NA	NA
WP_020956184.1|1823682_1824618_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	30.4	4.4e-32
WP_007408086.1|1824649_1825291_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_032871714.1|1825356_1826187_+	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_007613029.1|1826596_1828528_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.5	1.3e-110
WP_015240354.1|1828582_1829377_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_082998821.1|1829563_1831345_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.8	1.6e-75
WP_007408091.1|1831322_1832057_+	response regulator	NA	NA	NA	NA	NA
WP_007408092.1|1832186_1832624_+|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_007408093.1|1832636_1833320_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_071543361.1|1833691_1834213_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.5	9.3e-16
>prophage 148
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1856010	1869896	3963851	tRNA,transposase	Staphylococcus_phage(40.0%)	11	NA	NA
WP_003152530.1|1856010_1857045_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	32.4	5.0e-29
WP_160223210.1|1857058_1859473_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_160223007.1|1859588_1860738_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
WP_012118136.1|1860798_1861740_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_007408114.1|1861873_1862131_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_025285079.1|1862138_1862672_+	CvpA family protein	NA	NA	NA	NA	NA
WP_160223209.1|1862777_1864490_+	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	23.6	3.2e-12
WP_025285077.1|1864510_1866868_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	42.5	1.1e-15
WP_003152541.1|1866884_1867289_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_160223208.1|1867427_1868102_-	DUF2711 family protein	NA	NA	NA	NA	NA
WP_160223207.1|1868207_1869896_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.6	6.9e-36
>prophage 149
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1875009	1875324	3963851		Indivirus(100.0%)	1	NA	NA
WP_003152560.1|1875009_1875324_+	thioredoxin	NA	A0A1V0SD63	Indivirus	43.0	3.5e-10
>prophage 150
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1883405	1883630	3963851		Caldibacillus_phage(100.0%)	1	NA	NA
WP_003152579.1|1883405_1883630_+	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	77.0	1.5e-15
>prophage 151
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1887133	1887730	3963851		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_087920775.1|1887133_1887730_+	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	31.7	1.1e-09
>prophage 152
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1896417	1901251	3963851		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_025285068.1|1896417_1898142_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	29.4	2.0e-59
WP_025285067.1|1898138_1898657_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003152600.1|1898679_1899708_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_160223203.1|1899694_1901251_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	34.1	1.0e-09
>prophage 153
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1907337	1912941	3963851	protease	Bacillus_virus(33.33%)	3	NA	NA
WP_007408149.1|1907337_1908600_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
WP_059368021.1|1908758_1910417_+|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	3.3e-14
WP_052827698.1|1910616_1912941_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	1.4e-183
>prophage 154
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1924267	1926910	3963851	tRNA	Catovirus(100.0%)	1	NA	NA
WP_044801613.1|1924267_1926910_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
>prophage 155
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1942804	1943956	3963851		Faustovirus(100.0%)	1	NA	NA
WP_025285057.1|1942804_1943956_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A141ZJV0	Faustovirus	29.9	1.7e-30
>prophage 156
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1951265	1954981	3963851	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_007408185.1|1951265_1952270_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	4.0e-07
WP_003152687.1|1952262_1952463_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003152692.1|1952488_1953517_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_007408186.1|1953544_1954690_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
WP_012118091.1|1954720_1954981_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	48.4	6.7e-07
>prophage 157
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1958253	1975032	3963851	tRNA	Bacillus_phage(25.0%)	13	NA	NA
WP_160223194.1|1958253_1960473_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.7	3.5e-27
WP_012118088.1|1960604_1961102_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_160223193.1|1961165_1961492_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_160223192.1|1961547_1963908_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	1.4e-90
WP_003152714.1|1963913_1964426_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_003152716.1|1964583_1966788_+	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_007408194.1|1966800_1967244_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_138092686.1|1967269_1968832_-	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	2.0e-13
WP_020956141.1|1968962_1969133_+	YrzK family protein	NA	NA	NA	NA	NA
WP_012118082.1|1969489_1970764_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_020956140.1|1970778_1972557_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.1	8.7e-13
WP_025285046.1|1972882_1973647_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	33.5	2.2e-21
WP_015240288.1|1973763_1975032_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.6	1.5e-112
>prophage 158
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1978679	1981058	3963851		Brevibacillus_phage(100.0%)	1	NA	NA
WP_017418224.1|1978679_1981058_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.6	2.6e-81
>prophage 159
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1984257	1989235	3963851	tRNA	Planktothrix_phage(50.0%)	3	NA	NA
WP_007408209.1|1984257_1984986_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	1.5e-35
WP_007612803.1|1985205_1986267_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_132105431.1|1986598_1989235_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.1	3.1e-67
>prophage 160
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	1993265	1995176	3963851		Phage_TP(50.0%)	2	NA	NA
WP_003152759.1|1993265_1994534_+	U32 family peptidase	NA	Q6DW11	Phage_TP	32.1	7.3e-38
WP_003152763.1|1994540_1995176_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	4.1e-34
>prophage 161
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2000321	2002389	3963851		Lactococcus_phage(50.0%)	2	NA	NA
WP_160223191.1|2000321_2001245_+	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	43.4	8.4e-60
WP_160223190.1|2001246_2002389_+	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	28.8	3.6e-20
>prophage 162
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2010310	2013472	3963851		Mycobacterium_phage(100.0%)	1	NA	NA
WP_082998779.1|2010310_2013472_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.3	6.4e-75
>prophage 163
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2026681	2027191	3963851		Streptococcus_phage(100.0%)	1	NA	NA
WP_160223188.1|2026681_2027191_+	streptothricin N-acetyltransferase SatA	NA	A0A1B0RXL7	Streptococcus_phage	50.0	6.0e-44
>prophage 164
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2033456	2034179	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_003152837.1|2033456_2034179_-	RNA polymerase sporulation sigma factor SigK	NA	A0A0A0RV91	Bacillus_phage	27.1	7.3e-11
>prophage 165
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2042249	2042819	3963851		Bacillus_virus(100.0%)	1	NA	NA
WP_007408258.1|2042249_2042819_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	30.2	3.6e-21
>prophage 166
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2046106	2049028	3963851		Bacillus_phage(50.0%)	2	NA	NA
WP_094031848.1|2046106_2046676_+	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	56.3	3.7e-34
WP_094031847.1|2046676_2049028_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	33.9	1.6e-38
>prophage 167
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2053791	2061749	3963851		Streptococcus_phage(33.33%)	6	NA	NA
WP_015240241.1|2053791_2055627_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.2	7.6e-20
WP_059368095.1|2055686_2056826_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_003152889.1|2056906_2057938_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003152892.1|2057997_2058573_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_007408273.1|2058597_2060436_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.5	4.0e-138
WP_003152895.1|2060621_2061749_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.7	6.7e-27
>prophage 168
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2066179	2066626	3963851		Bacillus_virus(100.0%)	1	NA	NA
WP_007408278.1|2066179_2066626_+	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	41.2	2.9e-18
>prophage 169
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2071087	2072047	3963851		Rhizobium_phage(100.0%)	1	NA	NA
WP_007408283.1|2071087_2072047_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	44.7	1.8e-52
>prophage 170
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2083193	2093145	3963851	tRNA	Caulobacter_phage(20.0%)	9	NA	NA
WP_007408290.1|2083193_2085005_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	30.8	3.1e-50
WP_003152998.1|2085197_2086319_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.1	5.8e-39
WP_003152999.1|2086669_2087032_+	cytochrome c	NA	NA	NA	NA	NA
WP_012118009.1|2087157_2087862_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_015240228.1|2087854_2088976_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	48.0	6.4e-22
WP_029326068.1|2088996_2089941_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_012118006.1|2090063_2090759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160223185.1|2090924_2092241_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	7.5e-54
WP_012118004.1|2092251_2093145_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	31.5	1.9e-24
>prophage 171
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2099336	2099942	3963851		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_160223182.1|2099336_2099942_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.6	1.6e-67
>prophage 172
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2103758	2108142	3963851		Bacillus_virus(66.67%)	5	NA	NA
WP_007408304.1|2103758_2104661_+	phosphate ABC transporter substrate-binding protein	NA	R9S7J3	Prochlorococcus_phage	29.1	1.7e-12
WP_012117997.1|2104709_2105639_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_160223181.1|2105638_2106523_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_160223180.1|2106541_2107348_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	1.6e-14
WP_003153040.1|2107359_2108142_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.1	2.4e-15
>prophage 173
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2129922	2138928	3963851		Prochlorococcus_phage(50.0%)	8	NA	NA
WP_124934996.1|2129922_2131593_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	31.5	2.8e-61
WP_032866432.1|2132016_2133117_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_059368121.1|2133131_2134478_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.7	3.9e-58
WP_160223171.1|2134470_2135946_+	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	42.5	1.1e-85
WP_007408335.1|2135999_2136380_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_094031831.1|2136573_2137410_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_007408338.1|2137509_2137938_+	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_094031830.1|2138052_2138928_+	patatin-like phospholipase family protein	NA	A0A1V0SFX9	Hokovirus	27.4	2.7e-15
>prophage 174
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2151714	2154033	3963851		Enterococcus_phage(50.0%)	2	NA	NA
WP_007408350.1|2151714_2152566_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	43.9	1.7e-43
WP_007408351.1|2152689_2154033_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	39.1	2.3e-42
>prophage 175
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2162086	2164217	3963851		Bacillus_phage(50.0%)	2	NA	NA
WP_003153177.1|2162086_2162887_+	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	35.3	4.2e-07
WP_094031829.1|2163035_2164217_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.2	1.7e-28
>prophage 176
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2168764	2170216	3963851		Bacillus_phage(50.0%)	2	NA	NA
WP_160223168.1|2168764_2169391_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1S5QTQ1	Bacillus_phage	38.8	7.7e-17
WP_015240188.1|2169478_2170216_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	30.1	3.7e-18
>prophage 177
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2187572	2191533	3963851		Catovirus(50.0%)	5	NA	NA
WP_160223165.1|2187572_2188469_-	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	23.9	9.4e-16
WP_003153223.1|2188647_2189085_+	bacilliredoxin BrxB	NA	NA	NA	NA	NA
WP_015240174.1|2189329_2190097_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003153227.1|2190158_2190818_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_064115739.1|2190810_2191533_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.5e-37
>prophage 178
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2199129	2202098	3963851		Synechococcus_phage(50.0%)	2	NA	NA
WP_007408395.1|2199129_2200539_+	NADP-dependent phosphogluconate dehydrogenase	NA	V5UT40	Synechococcus_phage	34.2	7.5e-36
WP_012117935.1|2200628_2202098_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	38.8	1.6e-81
>prophage 179
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2213437	2233126	3963851		Paenibacillus_phage(66.67%)	3	NA	NA
WP_025284970.1|2213437_2214175_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	1.7e-15
WP_160223161.1|2214214_2226811_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.2	5.2e-35
WP_160223160.1|2226829_2233126_+	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	27.7	3.0e-31
>prophage 180
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2254565	2274671	3963851		Paenibacillus_phage(100.0%)	3	NA	NA
WP_160223157.1|2254565_2262284_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	28.3	4.6e-34
WP_160223156.1|2262306_2268459_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	28.6	1.3e-34
WP_160223155.1|2268455_2274671_+	zinc-binding dehydrogenase	NA	D0R7J2	Paenibacillus_phage	29.2	5.7e-35
>prophage 181
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2278053	2278893	3963851		Streptococcus_phage(100.0%)	1	NA	NA
WP_012117916.1|2278053_2278893_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.7	5.9e-28
>prophage 182
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2282472	2294397	3963851		uncultured_Mediterranean_phage(16.67%)	19	NA	NA
WP_003153290.1|2282472_2283432_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	36.1	2.6e-32
WP_154019859.1|2283456_2283846_+	hypothetical protein	NA	V5UQY3	Oenococcus_phage	52.4	2.4e-32
WP_122504109.1|2283847_2284015_-	DUF4083 domain-containing protein	NA	NA	NA	NA	NA
WP_160223153.1|2284106_2285177_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003153294.1|2285250_2285457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409390.1|2285555_2285900_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_015240144.1|2285915_2287142_-	DNA polymerase IV	NA	O64031	Bacillus_phage	44.6	1.1e-78
WP_012117908.1|2287357_2287828_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007409393.1|2287840_2288185_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_033574750.1|2288181_2289150_+	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	42.3	3.1e-33
WP_014305346.1|2289221_2289584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153307.1|2289558_2289798_+	DUF2552 domain-containing protein	NA	NA	NA	NA	NA
WP_025284954.1|2289837_2290752_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_094031820.1|2290871_2291099_+	YqkE family protein	NA	NA	NA	NA	NA
WP_012117903.1|2291131_2292052_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.7	1.3e-07
WP_003153315.1|2292114_2292237_-	Z-ring formation inhibitor MciZ	NA	NA	NA	NA	NA
WP_003153317.1|2292315_2292870_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_132105309.1|2292869_2294033_+	TIGR00375 family protein	NA	NA	NA	NA	NA
WP_007409399.1|2294043_2294397_-	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	36.7	4.1e-07
>prophage 183
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2302222	2308266	3963851		Brevibacillus_phage(25.0%)	7	NA	NA
WP_007612347.1|2302222_2303113_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.7	1.3e-41
WP_015240135.1|2303280_2304465_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_007409407.1|2304476_2305295_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	48.0	9.7e-68
WP_094031818.1|2305431_2306601_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.6	4.3e-37
WP_007409411.1|2306696_2307050_+	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_003153347.1|2307046_2307487_+	anti-sigma F factor	NA	NA	NA	NA	NA
WP_015240133.1|2307498_2308266_+	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	60.9	1.3e-71
>prophage 184
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2315991	2326800	3963851		Staphylococcus_phage(50.0%)	15	NA	NA
WP_003153363.1|2315991_2316423_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	36.6	9.4e-14
WP_015240128.1|2316571_2317063_+	DUF1453 family protein	NA	NA	NA	NA	NA
WP_032861567.1|2317143_2317719_+	signal peptidase I	NA	NA	NA	NA	NA
WP_007409423.1|2317966_2318311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223151.1|2318708_2319824_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	9.8e-55
WP_007409425.1|2319804_2320452_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_003153371.1|2320466_2321663_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_003153372.1|2321695_2322160_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153373.1|2322276_2322651_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153375.1|2322716_2323238_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153376.1|2323325_2323415_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_160223150.1|2323622_2324378_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.2e-10
WP_160223149.1|2324367_2324961_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.0	9.9e-14
WP_076425394.1|2325050_2325536_+	DUF3907 family protein	NA	NA	NA	NA	NA
WP_160223148.1|2325648_2326800_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.6	6.0e-07
>prophage 185
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2332271	2342467	3963851		Bacillus_phage(60.0%)	9	NA	NA
WP_003153397.1|2332271_2332994_+	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	42.6	2.9e-44
WP_025284944.1|2332990_2334772_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	38.1	3.0e-37
WP_003153399.1|2334962_2335547_+	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_072589347.1|2335521_2336583_+	sugar dehydratase	NA	NA	NA	NA	NA
WP_007409437.1|2336629_2338207_-	phosphoglycerate dehydrogenase	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	32.8	1.1e-27
WP_076982870.1|2338635_2339268_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003153403.1|2339408_2339657_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	56.8	1.6e-18
WP_160223147.1|2339925_2340984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223146.1|2340976_2342467_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	37.9	9.7e-58
>prophage 186
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2349374	2350244	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_025284936.1|2349374_2350244_+	spore cortex-lytic enzyme	NA	A0A172JHR8	Bacillus_phage	40.0	1.5e-21
>prophage 187
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2362494	2369161	3963851		Bacillus_phage(25.0%)	9	NA	NA
WP_003153447.1|2362494_2362773_+	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	75.3	1.1e-28
WP_003153448.1|2362959_2363532_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.7	1.3e-50
WP_003153449.1|2363552_2363780_+	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_015240105.1|2363936_2364692_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003153453.1|2364697_2365399_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_095532168.1|2365340_2366390_+	heptaprenyl diphosphate synthase component II	NA	NA	NA	NA	NA
WP_012117865.1|2366510_2366957_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.0	8.2e-29
WP_132105285.1|2367146_2367917_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_003153459.1|2367988_2369161_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.5	5.0e-41
>prophage 188
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2372371	2377858	3963851		Acinetobacter_phage(66.67%)	6	NA	NA
WP_160223144.1|2372371_2373388_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.5	2.2e-53
WP_012117859.1|2373380_2374133_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	41.3	1.5e-43
WP_160223143.1|2374137_2374791_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_015417720.1|2374771_2375974_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_160223142.1|2375966_2376764_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_007409465.1|2376775_2377858_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.5	9.0e-21
>prophage 189
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2383271	2383811	3963851		Bacillus_virus(100.0%)	1	NA	NA
WP_003153482.1|2383271_2383811_+	YpiB family protein	NA	G3MAV7	Bacillus_virus	48.6	1.6e-42
>prophage 190
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2389208	2390081	3963851		Streptococcus_phage(100.0%)	1	NA	NA
WP_003153493.1|2389208_2390081_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.5	2.4e-72
>prophage 191
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2393648	2404480	3963851	tRNA	unidentified_phage(25.0%)	10	NA	NA
WP_059368453.1|2393648_2394839_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	31.7	3.6e-39
WP_059368452.1|2394823_2395801_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_094031800.1|2396045_2396879_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	38.3	1.3e-51
WP_012117844.1|2396882_2397743_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_094031799.1|2397744_2398128_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_160223141.1|2398249_2401036_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	29.0	8.7e-60
WP_003153512.1|2401183_2401354_+	YpmA family protein	NA	NA	NA	NA	NA
WP_007409483.1|2401363_2401849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007612190.1|2401871_2403053_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_060562796.1|2403187_2404480_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.5	6.0e-56
>prophage 192
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2409339	2409948	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_094031925.1|2409339_2409948_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	34.9	2.0e-22
>prophage 193
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2413993	2416240	3963851		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_012117832.1|2413993_2416240_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.3	9.6e-09
>prophage 194
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2421416	2423336	3963851		Streptomyces_phage(100.0%)	1	NA	NA
WP_012117827.1|2421416_2423336_+	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.8	1.4e-11
>prophage 195
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2437736	2441708	3963851		Bacillus_phage(33.33%)	9	NA	NA
WP_025284902.1|2437736_2438624_+	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	30.6	1.3e-20
WP_003153575.1|2438629_2438758_-	small, acid-soluble spore protein L	NA	NA	NA	NA	NA
WP_015240064.1|2438809_2439202_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_012117815.1|2439208_2439889_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.1	1.6e-12
WP_076425341.1|2439970_2440642_+	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_015240062.1|2440644_2440827_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_007409519.1|2440853_2441111_-	DUF2564 family protein	NA	NA	NA	NA	NA
WP_012117812.1|2441273_2441456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153604.1|2441507_2441708_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.9	5.5e-17
>prophage 196
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2451015	2454148	3963851	transposase	Geobacillus_virus(33.33%)	4	NA	NA
WP_025284896.1|2451015_2451810_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	67.4	4.6e-107
WP_032870014.1|2451806_2452292_+	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	45.9	3.2e-34
WP_043021188.1|2452313_2452937_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_094031235.1|2452997_2454148_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
>prophage 197
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2461410	2473808	3963851	holin	Bacillus_phage(88.89%)	13	NA	NA
WP_032868763.1|2461410_2462001_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	31.1	1.7e-13
WP_160223133.1|2462023_2463688_-	recombinase family protein	NA	O64015	Bacillus_phage	91.2	9.2e-275
WP_160223132.1|2463903_2464869_-	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.0	5.5e-78
WP_076982865.1|2465133_2465568_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_160223131.1|2465604_2467320_+	ribonuclease YeeF family protein	NA	O64023	Bacillus_phage	76.4	1.1e-249
WP_032870144.1|2467328_2467826_+	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	90.9	2.1e-89
WP_032870004.1|2467887_2468484_+	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	81.4	6.3e-85
WP_160223130.1|2469243_2469582_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	60.2	9.3e-25
WP_082786706.1|2469837_2469921_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_045926142.1|2470607_2470967_+	hypothetical protein	NA	O64028	Bacillus_phage	60.5	2.9e-32
WP_080130243.1|2471030_2472047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016936664.1|2472573_2472696_-	phosphatase RapK inhibitor	NA	NA	NA	NA	NA
WP_064115743.1|2472692_2473808_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	48.4	8.2e-94
>prophage 198
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2477762	2480957	3963851		Bacillus_phage(66.67%)	3	NA	NA
WP_122504079.1|2477762_2477978_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	79.4	1.4e-21
WP_122504075.1|2479567_2479774_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	51.2	6.5e-13
WP_099566853.1|2480177_2480957_+	DUF4236 domain-containing protein	NA	F6K8R9	Clostridium_phage	50.0	3.4e-14
>prophage 199
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2487207	2491939	3963851		Bacillus_phage(80.0%)	7	NA	NA
WP_124692988.1|2487207_2488344_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	75.9	6.5e-163
WP_160223129.1|2488711_2489164_+	hypothetical protein	NA	O64117	Bacillus_phage	78.0	4.4e-62
WP_015240044.1|2489399_2489774_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.0	9.0e-29
WP_015240043.1|2489899_2490136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160223128.1|2490605_2490941_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_139134430.1|2491303_2491480_+	hypothetical protein	NA	O64196	Bacillus_phage	91.4	2.5e-21
WP_003153663.1|2491513_2491939_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	35.6	2.7e-13
>prophage 200
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2497876	2498323	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_160223123.1|2497876_2498323_+	DNA gyrase inhibitor	NA	A0A1P8CX48	Bacillus_phage	71.1	1.7e-58
>prophage 201
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2528951	2533365	3963851		Phthorimaea_operculella_granulovirus(33.33%)	4	NA	NA
WP_007611974.1|2528951_2530163_+	glycosyl transferase family 1	NA	G4WEM5	Phthorimaea_operculella_granulovirus	27.4	1.8e-06
WP_032869970.1|2530482_2531724_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.2	3.4e-16
WP_012117752.1|2531806_2532397_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_003153758.1|2532474_2533365_+	MoxR family ATPase	NA	R4TG24	Halovirus	26.7	4.6e-07
>prophage 202
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2543021	2543867	3963851		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_007611962.1|2543021_2543867_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	41.3	3.8e-35
>prophage 203
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2552208	2555092	3963851		Moumouvirus(50.0%)	2	NA	NA
WP_015240002.1|2552208_2553987_+	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.9	2.0e-81
WP_007407985.1|2554222_2555092_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217EQJ4	Bacillus_phage	70.8	3.9e-27
>prophage 204
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2558941	2559607	3963851		Streptococcus_phage(100.0%)	1	NA	NA
WP_003153802.1|2558941_2559607_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	32.6	3.3e-18
>prophage 205
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2563687	2565490	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_160223112.1|2563687_2565490_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	67.6	8.7e-178
>prophage 206
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2570115	2571132	3963851		Streptococcus_phage(100.0%)	1	NA	NA
WP_015239990.1|2570115_2571132_+	2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	31.6	4.8e-24
>prophage 207
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2575179	2579820	3963851		Streptococcus_phage(50.0%)	5	NA	NA
WP_007407344.1|2575179_2575896_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	77.2	2.8e-47
WP_000640391.1|2576421_2576850_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003153833.1|2577281_2577650_+	replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.0	9.2e-18
WP_069007403.1|2577828_2578677_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	30.2	5.2e-24
WP_015239987.1|2578701_2579820_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.2	3.1e-69
>prophage 208
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2589916	2591836	3963851	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_122504061.1|2589916_2591836_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.8	9.3e-138
>prophage 209
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2596115	2596661	3963851	integrase	Bacillus_phage(100.0%)	1	2593145:2593160	2609171:2609186
2593145:2593160	attL	GGAATGGCGCTTCATG	NA	NA	NA	NA
WP_007407359.1|2596115_2596661_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	49.2	5.5e-43
WP_007407359.1|2596115_2596661_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	49.2	5.5e-43
2609171:2609186	attR	GGAATGGCGCTTCATG	NA	NA	NA	NA
>prophage 210
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2602138	2639808	3963851		Tupanvirus(100.0%)	5	NA	NA
WP_160223105.1|2602138_2609797_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	23.4	1.5e-77
WP_160223104.1|2609822_2617520_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.8	7.5e-162
WP_160223103.1|2617535_2625185_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	26.2	2.4e-75
WP_160223102.1|2625210_2635986_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.5	1.9e-158
WP_038463981.1|2636004_2639808_+	non-ribosomal peptide synthase	NA	A0A2K9KZV5	Tupanvirus	26.7	1.4e-84
>prophage 211
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2643248	2644889	3963851		Hepacivirus(100.0%)	1	NA	NA
WP_038463976.1|2643248_2644889_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	26.9	5.9e-48
>prophage 212
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2650443	2655278	3963851		Bacillus_phage(33.33%)	5	NA	NA
WP_160223101.1|2650443_2651334_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.9	5.2e-83
WP_014418060.1|2651340_2651748_-	GtrA family protein	NA	NA	NA	NA	NA
WP_160223100.1|2652014_2652782_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_160223099.1|2652781_2654128_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.2	3.8e-13
WP_012117686.1|2654117_2655278_+	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	27.1	1.6e-31
>prophage 213
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2663931	2675880	3963851		Tupanvirus(100.0%)	1	NA	NA
WP_160223097.1|2663931_2675880_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.1	2.5e-116
>prophage 214
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2692128	2699985	3963851		Tupanvirus(100.0%)	1	NA	NA
WP_160223096.1|2692128_2699985_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.4	5.3e-78
>prophage 215
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2703324	2705797	3963851		Bacillus_phage(66.67%)	3	NA	NA
WP_015239948.1|2703324_2704032_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.0	4.0e-38
WP_160223093.1|2704034_2705432_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.8	4.0e-29
WP_017417895.1|2705485_2705797_-	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	41.7	4.5e-10
>prophage 216
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2710223	2710844	3963851		Planktothrix_phage(100.0%)	1	NA	NA
WP_059367392.1|2710223_2710844_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	3.7e-27
>prophage 217
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2717684	2718686	3963851		Enterobacteria_phage(100.0%)	1	NA	NA
WP_160223086.1|2717684_2718686_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.6	8.9e-23
>prophage 218
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2725890	2730284	3963851		Bacillus_phage(50.0%)	2	NA	NA
WP_160223082.1|2725890_2728314_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	33.2	8.8e-101
WP_007611767.1|2728316_2730284_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	1.4e-125
>prophage 219
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2745443	2755813	3963851		Bacillus_phage(66.67%)	10	NA	NA
WP_007611720.1|2745443_2746064_+	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
WP_094031735.1|2746403_2746832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052827479.1|2746985_2747435_+	YndM family protein	NA	NA	NA	NA	NA
WP_007410333.1|2747464_2748295_-	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	73.1	2.2e-104
WP_076424209.1|2748539_2749361_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	42.6	4.1e-50
WP_025284785.1|2749767_2750202_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	86.6	6.0e-69
WP_160223080.1|2750580_2752998_+	peptidase G2	NA	D6R401	Bacillus_phage	50.3	9.4e-220
WP_160223079.1|2753613_2754150_+	stress protein	NA	NA	NA	NA	NA
WP_003154022.1|2754929_2755028_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_015239922.1|2755192_2755813_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	36.9	2.2e-19
>prophage 220
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2761341	2761758	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_094031732.1|2761341_2761758_-	hypothetical protein	NA	O64087	Bacillus_phage	72.3	1.3e-23
>prophage 221
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2765476	2766493	3963851		Tupanvirus(100.0%)	1	NA	NA
WP_160223075.1|2765476_2766493_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	28.4	3.1e-31
>prophage 222
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2769718	2772316	3963851		Hokovirus(100.0%)	1	NA	NA
WP_160223073.1|2769718_2772316_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.1e-44
>prophage 223
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2782455	2783561	3963851		Bacillus_phage(100.0%)	2	NA	NA
WP_160223070.1|2782455_2783058_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	54.8	4.0e-55
WP_160223069.1|2783369_2783561_-	hypothetical protein	NA	D6R410	Bacillus_phage	93.7	1.2e-24
>prophage 224
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2791652	2797866	3963851		Bacillus_phage(50.0%)	7	NA	NA
WP_015417523.1|2791652_2792621_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
WP_007410369.1|2792669_2792894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223066.1|2792927_2793686_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	8.1e-53
WP_012117609.1|2793735_2794356_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
WP_012117608.1|2794404_2795394_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
WP_007611605.1|2795411_2797514_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
WP_003154061.1|2797473_2797866_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
>prophage 225
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2802294	2871164	3963851		Paenibacillus_phage(62.5%)	12	NA	NA
WP_007410381.1|2802294_2803002_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	54.1	2.7e-50
WP_015239897.1|2803257_2803491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012117603.1|2803669_2804998_+	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	34.6	2.2e-29
WP_007410383.1|2805190_2805553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160223064.1|2805586_2806342_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_160223063.1|2806401_2806836_-	sporulation protein	NA	F8WPS9	Bacillus_phage	53.5	4.2e-38
WP_160223062.1|2807124_2808336_+	cytochrome P450	NA	NA	NA	NA	NA
WP_160223061.1|2808471_2815929_-	methyltransferase	NA	D0R7J2	Paenibacillus_phage	30.1	1.5e-37
WP_160223060.1|2815942_2832244_-	amino acid adenylation domain-containing protein	NA	D0R7J2	Paenibacillus_phage	57.5	2.7e-121
WP_160223059.1|2832233_2842769_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.3	1.3e-39
WP_160223058.1|2842786_2856211_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	30.0	9.1e-38
WP_160223057.1|2856212_2871164_-	amino acid adenylation domain-containing protein	NA	D0R7J2	Paenibacillus_phage	59.8	3.1e-127
>prophage 226
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2878897	2885580	3963851		Streptococcus_phage(33.33%)	4	NA	NA
WP_160223054.1|2878897_2879575_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	27.1	4.0e-11
WP_094031716.1|2880507_2880717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025284750.1|2881104_2882979_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.0	1.7e-67
WP_094031921.1|2882994_2885580_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.2	5.1e-38
>prophage 227
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2888602	2896657	3963851		Bacillus_phage(40.0%)	7	NA	NA
WP_098081411.1|2888602_2889781_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	32.8	2.7e-47
WP_160223052.1|2889793_2890840_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	62.0	2.4e-10
WP_003154135.1|2891097_2891358_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	42.5	1.2e-08
WP_003154137.1|2891557_2892352_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_003154140.1|2892412_2893972_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_059366981.1|2894264_2895446_-	serine hydrolase	NA	A0A076YK70	Mycobacterium_phage	27.7	2.4e-11
WP_003154145.1|2895613_2896657_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	72.9	6.0e-139
>prophage 228
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2901707	2904271	3963851		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_160223051.1|2901707_2902994_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	26.8	6.7e-07
WP_015239875.1|2902990_2904271_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	27.8	2.8e-45
>prophage 229
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2910296	2912651	3963851		Mycobacterium_phage(100.0%)	1	NA	NA
WP_160223049.1|2910296_2912651_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	50.0	7.0e-87
>prophage 230
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2921050	2922286	3963851		Bacillus_virus(100.0%)	1	NA	NA
WP_012117570.1|2921050_2922286_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	31.4	5.2e-49
>prophage 231
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2926130	2937695	3963851	tRNA	Indivirus(33.33%)	10	NA	NA
WP_064107826.1|2926130_2927072_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	29.8	8.9e-09
WP_160223048.1|2927091_2928021_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003154185.1|2928105_2928459_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_052827431.1|2928475_2928754_-	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_053573443.1|2928750_2930898_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.7	4.5e-24
WP_003154192.1|2930917_2931220_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_003154193.1|2931221_2931497_-	glucose-induced regulator RulR	NA	NA	NA	NA	NA
WP_003154195.1|2931510_2932632_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_007409801.1|2932671_2933142_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_160223047.1|2933381_2937695_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	31.5	1.8e-24
>prophage 232
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2942815	2943598	3963851		Flavobacterium_phage(100.0%)	1	NA	NA
WP_007611457.1|2942815_2943598_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	40.7	4.3e-25
>prophage 233
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2947511	2948276	3963851		Salisaeta_icosahedral_phage(100.0%)	1	NA	NA
WP_003154217.1|2947511_2948276_-	RNA polymerase sigma-28 factor SigD	NA	I1ZBD5	Salisaeta_icosahedral_phage	27.4	1.0e-07
>prophage 234
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2974525	2982022	3963851	protease,tRNA	Erwinia_phage(25.0%)	6	NA	NA
WP_007611413.1|2974525_2975929_-	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	27.5	4.1e-42
WP_014417767.1|2975945_2976491_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032871470.1|2976506_2977424_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.7	6.9e-30
WP_094031705.1|2977493_2978801_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_007409771.1|2978865_2980941_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.6	1.1e-104
WP_160223044.1|2981122_2982022_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	38.0	5.1e-30
>prophage 235
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2986348	2987116	3963851		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_007611398.1|2986348_2987116_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.6	6.1e-24
>prophage 236
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	2998357	3000304	3963851		Micromonas_pusilla_virus(33.33%)	3	NA	NA
WP_012117543.1|2998357_2999107_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.9	5.4e-25
WP_003154310.1|2999245_2999479_-	acyl carrier protein	NA	M4M9G2	Vibrio_phage	44.9	7.1e-08
WP_003154312.1|2999563_3000304_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	2.0e-19
>prophage 237
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3011714	3013658	3963851		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_012117534.1|3011714_3013658_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	35.6	5.9e-23
>prophage 238
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3016843	3026832	3963851	tRNA	Prochlorococcus_phage(20.0%)	9	NA	NA
WP_076424120.1|3016843_3017797_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.8	1.1e-09
WP_012117530.1|3017801_3018284_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	45.0	6.4e-19
WP_160223041.1|3018308_3020720_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_136396354.1|3020716_3021937_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.7	3.0e-41
WP_003154346.1|3022027_3022231_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003154347.1|3022234_3022849_-	guanylate kinase	NA	S4W1R9	Pandoravirus	33.1	6.2e-11
WP_003154355.1|3022856_3023126_-	extracellular matrix/biofilm regulator RemA	NA	NA	NA	NA	NA
WP_160223040.1|3023202_3024078_-	YicC family protein	NA	NA	NA	NA	NA
WP_160223039.1|3024159_3026832_-	calcium-translocating P-type ATPase, SERCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	30.1	1.0e-89
>prophage 239
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3031259	3033015	3963851		Tupanvirus(100.0%)	2	NA	NA
WP_007611313.1|3031259_3031853_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	42.0	2.3e-26
WP_061581574.1|3031866_3033015_-	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	30.4	5.7e-42
>prophage 240
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3041394	3051775	3963851	tRNA	Halovirus(25.0%)	9	NA	NA
WP_007409730.1|3041394_3042489_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	38.7	1.8e-61
WP_052827404.1|3042485_3043772_-	dihydroorotase	NA	NA	NA	NA	NA
WP_072589082.1|3043755_3044670_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	37.9	2.4e-35
WP_025284702.1|3044811_3046122_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.2	6.5e-58
WP_003154392.1|3046275_3046821_-	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_007409726.1|3047009_3047924_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003154398.1|3047925_3048387_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_007409725.1|3048488_3048860_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_012117512.1|3049009_3051775_-|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	27.0	3.3e-83
>prophage 241
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3057743	3065810	3963851		Bacillus_phage(50.0%)	5	NA	NA
WP_160223036.1|3057743_3058541_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	2.5e-12
WP_003154420.1|3058669_3059452_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.1	2.2e-45
WP_007409714.1|3059592_3060312_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	41.4	8.1e-18
WP_025284698.1|3060369_3061299_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_160223035.1|3061514_3065810_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	33.6	5.9e-23
>prophage 242
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3086866	3087442	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_012117496.1|3086866_3087442_-	sporulation-specific transcriptional regulator GerR	NA	A0A1D6X8E5	Bacillus_phage	29.5	4.8e-05
>prophage 243
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3090822	3097617	3963851		Catovirus(25.0%)	10	NA	NA
WP_014304961.1|3090822_3091602_-	patatin family protein	NA	A0A1V0SCG0	Catovirus	26.9	9.7e-09
WP_160223032.1|3091781_3093008_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
WP_007409694.1|3093026_3093509_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.9	1.6e-25
WP_025284692.1|3093513_3094068_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003154470.1|3094367_3094640_-	YlbG family protein	NA	NA	NA	NA	NA
WP_003154472.1|3094698_3095148_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_003154475.1|3095218_3095458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409691.1|3095473_3095884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409690.1|3096048_3097089_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.0	3.4e-17
WP_017417724.1|3097173_3097617_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	34.7	1.8e-12
>prophage 244
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3112321	3116996	3963851		Vibrio_phage(50.0%)	5	NA	NA
WP_015239795.1|3112321_3113650_-	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	33.7	4.4e-54
WP_012117484.1|3113804_3114428_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_007409677.1|3114529_3114739_+	YlaI family protein	NA	NA	NA	NA	NA
WP_015239793.1|3114780_3115101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409675.1|3115157_3116996_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	38.8	3.8e-19
>prophage 245
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3126801	3128214	3963851		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_007409663.1|3126801_3128214_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.6	9.8e-44
>prophage 246
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3132237	3133329	3963851		Mycobacterium_phage(100.0%)	1	NA	NA
WP_007409662.1|3132237_3133329_-	serine hydrolase	NA	G1BNF7	Mycobacterium_phage	25.9	3.9e-08
>prophage 247
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3137263	3144646	3963851		Paenibacillus_phage(100.0%)	1	NA	NA
WP_160223029.1|3137263_3144646_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	33.2	1.3e-41
>prophage 248
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3150380	3166086	3963851		Paenibacillus_phage(100.0%)	2	NA	NA
WP_160223027.1|3150380_3157385_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	30.2	3.6e-38
WP_160223026.1|3157377_3166086_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.5	1.6e-35
>prophage 249
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3170905	3183169	3963851		Paenibacillus_phage(100.0%)	1	NA	NA
WP_160223025.1|3170905_3183169_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.6	1.2e-33
>prophage 250
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3187132	3187687	3963851		Synechococcus_phage(100.0%)	1	NA	NA
WP_082997953.1|3187132_3187687_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.0	1.6e-13
>prophage 251
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3195657	3195942	3963851		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003154557.1|3195657_3195942_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	50.0	2.6e-12
>prophage 252
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3199811	3201431	3963851		Tupanvirus(100.0%)	1	NA	NA
WP_007409642.1|3199811_3201431_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.5	8.4e-47
>prophage 253
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3207667	3208360	3963851		Planktothrix_phage(100.0%)	1	NA	NA
WP_007409637.1|3207667_3208360_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	1.0e-33
>prophage 254
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3216896	3217355	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_038463805.1|3216896_3217355_-	TlpA family protein disulfide reductase	NA	A0A127AW88	Bacillus_phage	48.6	6.0e-35
>prophage 255
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3220775	3222614	3963851		Bacillus_phage(100.0%)	3	NA	NA
WP_007409622.1|3220775_3221231_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	31.9	5.3e-15
WP_160223021.1|3221257_3222151_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_012117440.1|3222140_3222614_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	35.7	1.8e-13
>prophage 256
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3228013	3228778	3963851		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003154618.1|3228013_3228778_-	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	39.4	6.7e-39
>prophage 257
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3232353	3243214	3963851		Bacillus_thuringiensis_phage(25.0%)	7	NA	NA
WP_007409609.1|3232353_3233265_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.8	1.8e-46
WP_082997935.1|3233815_3234985_+	aminotransferase A	NA	NA	NA	NA	NA
WP_160223020.1|3235009_3236830_-	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.6	1.0e-08
WP_138092220.1|3237007_3239140_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_160223019.1|3239480_3240266_+	hypothetical protein	NA	U5Q0C0	Bacillus_phage	63.8	2.4e-39
WP_160223018.1|3240299_3241166_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_160223017.1|3241246_3243214_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.6	3.1e-11
>prophage 258
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3246859	3248956	3963851		Vibrio_phage(100.0%)	1	NA	NA
WP_003154656.1|3246859_3248956_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	45.8	3.4e-08
>prophage 259
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3252557	3268288	3963851		Pneumococcus_phage(28.57%)	16	NA	NA
WP_072589032.1|3252557_3254471_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.8	2.2e-110
WP_160223016.1|3254712_3255207_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_007409593.1|3255269_3256610_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_025284651.1|3256725_3257349_-	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	55.4	4.4e-28
WP_059367104.1|3257623_3257818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154669.1|3257981_3258167_+	YkvS family protein	NA	NA	NA	NA	NA
WP_059367106.1|3258239_3258515_-	DUF3219 family protein	NA	NA	NA	NA	NA
WP_160223015.1|3259198_3259945_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	2.3e-15
WP_160223014.1|3260113_3260482_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003154673.1|3260944_3261439_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	73.2	1.1e-55
WP_003154676.1|3261456_3262188_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.6	2.6e-56
WP_007408455.1|3262180_3262624_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_003154679.1|3262624_3263284_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.4	6.6e-67
WP_160223013.1|3263533_3264655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160223012.1|3264752_3265790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160223011.1|3266191_3268288_+	AAA domain-containing protein	NA	H6X3M6	Enterobacteria_phage	42.6	6.6e-129
>prophage 260
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3277540	3281668	3963851		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_015239733.1|3277540_3278320_+	carbon-nitrogen family hydrolase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	27.2	1.3e-10
WP_124934915.1|3278676_3279861_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_160223009.1|3279867_3280929_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_160223008.1|3281170_3281668_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.5	1.1e-18
>prophage 261
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3287730	3296301	3963851	protease,transposase	Bacillus_phage(50.0%)	9	NA	NA
WP_160223007.1|3287730_3288880_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
WP_025284642.1|3288944_3289838_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_007407208.1|3289986_3290688_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003154717.1|3290823_3291018_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	65.5	3.6e-13
WP_007407209.1|3291024_3292194_-	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_003154719.1|3292190_3292946_-	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_015239726.1|3293222_3294005_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	43.1	4.1e-31
WP_007407212.1|3294250_3294820_-	DedA family protein	NA	NA	NA	NA	NA
WP_015239724.1|3295419_3296301_+	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	36.8	3.0e-43
>prophage 262
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3304855	3309287	3963851		Planktothrix_phage(50.0%)	4	NA	NA
WP_160223004.1|3304855_3306493_+	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	4.5e-16
WP_022553447.1|3306467_3307229_+	HMP/thiamine permease ykoC	NA	NA	NA	NA	NA
WP_025284633.1|3307274_3308108_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_007407222.1|3308327_3309287_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	51.2	1.5e-72
>prophage 263
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3319497	3323126	3963851		Streptococcus_phage(66.67%)	3	NA	NA
WP_025284624.1|3319497_3320745_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.1	1.8e-97
WP_136396308.1|3320741_3321854_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.2	3.2e-74
WP_007407234.1|3322223_3323126_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	36.2	1.2e-15
>prophage 264
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3327401	3329276	3963851		Bacillus_virus(50.0%)	2	NA	NA
WP_007610864.1|3327401_3328373_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.6	5.2e-20
WP_015239704.1|3328376_3329276_-	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	43.0	4.5e-18
>prophage 265
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3333015	3334044	3963851		Planktothrix_phage(100.0%)	1	NA	NA
WP_012117374.1|3333015_3334044_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	7.5e-17
>prophage 266
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3338770	3341454	3963851		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_157696431.1|3338770_3340120_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	33.3	2.0e-22
WP_007610846.1|3340482_3341454_-	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.6	3.8e-63
>prophage 267
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3349577	3385590	3963851	holin,terminase,tail,plate,portal	Bacillus_phage(36.36%)	48	NA	NA
WP_007407257.1|3349577_3350456_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
WP_003154813.1|3350469_3350733_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_003154815.1|3350746_3351010_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_160222996.1|3351061_3351823_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_007610833.1|3351879_3352077_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	7.3e-14
WP_043021266.1|3352081_3352453_-	YomQ/XkdW protein, phage-like element PBSX	NA	NA	NA	NA	NA
WP_052827325.1|3352465_3354097_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	33.5	1.6e-53
WP_060674884.1|3354099_3354372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015239689.1|3354368_3354947_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.9	3.1e-12
WP_076423970.1|3354930_3355977_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	1.3e-69
WP_003154825.1|3355969_3356395_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_007610818.1|3356498_3356765_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_044802866.1|3356764_3357742_-	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.9	2.9e-34
WP_160222995.1|3357755_3358415_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.4e-08
WP_160222994.1|3358407_3363453_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.0	8.7e-42
WP_015239684.1|3363440_3363593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154836.1|3363634_3364081_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_003154837.1|3364156_3364600_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_007610810.1|3364601_3365999_-|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
WP_160222993.1|3365998_3366208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222992.1|3366204_3366651_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_042635121.1|3366647_3367151_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.1	2.7e-36
WP_007407272.1|3367147_3367504_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_015239680.1|3367500_3367884_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007407274.1|3367900_3368836_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_160222991.1|3368862_3369708_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.1	2.5e-55
WP_160223388.1|3369727_3371119_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.8e-138
WP_025284605.1|3371167_3372466_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	9.4e-150
WP_100001390.1|3372462_3373260_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.8	1.6e-59
WP_007407279.1|3373372_3373885_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	3.8e-22
WP_100001388.1|3373998_3374202_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	51.5	1.4e-12
WP_100001386.1|3374191_3374533_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_014417520.1|3374797_3375598_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	3.0e-58
WP_025284603.1|3375497_3376325_-	hypothetical protein	NA	S6BFM4	Thermus_phage	49.0	2.2e-19
WP_007407285.1|3376314_3376494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154871.1|3376684_3377023_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_007610775.1|3377171_3377762_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_047935636.1|3377880_3378486_-	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	1.0e-42
WP_007610770.1|3378595_3378973_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_015417280.1|3379010_3379964_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_003154881.1|3380106_3380241_-	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_087920760.1|3380230_3381367_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_025284602.1|3381572_3382040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025284601.1|3382184_3382949_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_025284599.1|3383022_3383214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082187759.1|3383355_3383454_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_025284598.1|3383563_3384922_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.1	2.7e-14
WP_015417275.1|3384918_3385590_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.1	2.4e-24
>prophage 268
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3396509	3400442	3963851		Bacillus_phage(66.67%)	5	NA	NA
WP_160222988.1|3396509_3397247_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.1	1.2e-16
WP_015239663.1|3397248_3398010_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_032871243.1|3398035_3398854_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003154919.1|3399029_3399215_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	75.9	2.6e-21
WP_160222987.1|3399257_3400442_-	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	30.2	7.3e-08
>prophage 269
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3407108	3407744	3963851		Bacillus_virus(100.0%)	1	NA	NA
WP_007407316.1|3407108_3407744_-	methyltransferase	NA	G3MA03	Bacillus_virus	50.4	6.2e-22
>prophage 270
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3415448	3416441	3963851		Tupanvirus(100.0%)	1	NA	NA
WP_012117333.1|3415448_3416441_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.3	1.1e-46
>prophage 271
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3421922	3460841	3963851	tail,coat,tRNA,integrase	Paenibacillus_phage(33.33%)	50	3428595:3428641	3445934:3445980
WP_132106234.1|3421922_3422843_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.9	3.2e-59
WP_136396273.1|3423191_3423578_-	VOC family protein	NA	NA	NA	NA	NA
WP_038457666.1|3423868_3424231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222982.1|3424751_3426530_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	52.2	3.9e-106
WP_021494070.1|3426541_3426934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095352238.1|3427329_3427629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160222981.1|3427994_3428351_+|tRNA	tRNA-Val4	tRNA	NA	NA	NA	NA
3428595:3428641	attL	ATGATTCCGACTGGGCTCGAACCAGCGACCTCTACCCTGTCAAGGTA	NA	NA	NA	NA
WP_024085162.1|3429045_3429252_+	KTSC domain-containing protein	NA	D2IZW7	Enterococcus_phage	48.3	5.1e-10
WP_160222980.1|3429621_3431868_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	38.1	6.3e-61
WP_039063547.1|3432116_3432725_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	42.0	1.8e-31
WP_160222979.1|3432721_3432943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222978.1|3433019_3433727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222977.1|3433763_3434417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222976.1|3434427_3434910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222975.1|3434906_3435275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222974.1|3435963_3436194_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_160222973.1|3436256_3437069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222972.1|3437319_3437808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125122413.1|3438697_3438898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222971.1|3438898_3439219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125122412.1|3439218_3439566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222970.1|3439676_3439910_+	helix-turn-helix transcriptional regulator	NA	A0A0A0RMC4	Bacillus_phage	36.5	1.9e-05
WP_160222969.1|3439899_3440091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160222968.1|3440108_3440708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160222967.1|3440849_3441425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222966.1|3441667_3441892_+	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	71.8	6.2e-09
WP_160222965.1|3442559_3443636_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	25.1	6.4e-11
WP_160222964.1|3443805_3444555_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024085137.1|3444721_3445771_-|integrase	tyrosine-type recombinase/integrase	integrase	Q938N9	Temperate_phage	27.9	1.3e-08
WP_052827270.1|3446145_3447321_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
3445934:3445980	attR	ATGATTCCGACTGGGCTCGAACCAGCGACCTCTACCCTGTCAAGGTA	NA	NA	NA	NA
WP_012117314.1|3447313_3448435_-	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	26.7	3.3e-18
WP_012117313.1|3448803_3449526_+	esterase family protein	NA	NA	NA	NA	NA
WP_007610690.1|3449551_3450067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012117312.1|3450071_3450503_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007409078.1|3450663_3450897_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_007409079.1|3450897_3451635_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.8	2.6e-27
WP_015239588.1|3451627_3452350_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_136396270.1|3452391_3453141_-	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_007409082.1|3453209_3453464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032874483.1|3453582_3455868_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.3	1.9e-84
WP_003154986.1|3455936_3456191_-	sporulation protein	NA	NA	NA	NA	NA
WP_007610678.1|3456357_3456519_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_012117306.1|3456610_3456808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015239585.1|3457094_3457451_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_003154992.1|3457621_3458008_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239584.1|3458045_3458360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239583.1|3458452_3458953_+|coat	spore coat protein X	coat	NA	NA	NA	NA
WP_003154995.1|3459103_3459586_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239582.1|3459731_3460175_+|coat	Spore coat protein Z	coat	NA	NA	NA	NA
WP_160222963.1|3460232_3460841_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 272
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3469371	3474297	3963851		Klosneuvirus(33.33%)	7	NA	NA
WP_007409101.1|3469371_3470121_+	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.4	9.9e-11
WP_150941121.1|3470154_3471048_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.8e-06
WP_003155018.1|3471062_3471863_-	NAD kinase	NA	NA	NA	NA	NA
WP_007610625.1|3471880_3472516_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155020.1|3472543_3472909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014417426.1|3473033_3473606_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_007409105.1|3473610_3474297_+	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	71.2	7.9e-39
>prophage 273
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3480613	3485878	3963851		Pseudomonas_phage(33.33%)	6	NA	NA
WP_007409109.1|3480613_3481270_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	9.9e-31
WP_003155034.1|3481327_3481723_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_007409110.1|3481901_3482480_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160222960.1|3482597_3483785_-	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_015239568.1|3483891_3484809_-	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_003155039.1|3484801_3485878_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
>prophage 274
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3491256	3492009	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_007409116.1|3491256_3492009_-	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	1.9e-49
>prophage 275
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3495815	3497788	3963851		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_003155053.1|3495815_3496805_-	dipeptide ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	24.6	5.7e-06
WP_029325950.1|3496801_3497788_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	6.0e-24
>prophage 276
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3504811	3505783	3963851		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_094031642.1|3504811_3505783_-	ornithine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	27.3	2.6e-19
>prophage 277
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3508858	3511144	3963851		Halovirus(50.0%)	2	NA	NA
WP_012117273.1|3508858_3509917_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.6	4.0e-58
WP_007409133.1|3509986_3511144_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.4	4.8e-28
>prophage 278
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3514912	3517114	3963851		Tupanvirus(50.0%)	2	NA	NA
WP_012117270.1|3514912_3516349_-	FAD-binding oxidoreductase	NA	A0A2K9KZR0	Tupanvirus	29.9	2.1e-49
WP_160222957.1|3516670_3517114_+	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	65.1	4.2e-41
>prophage 279
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3520237	3526281	3963851		Streptococcus_phage(25.0%)	6	NA	NA
WP_007409143.1|3520237_3521080_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	26.7	2.9e-27
WP_032871166.1|3521205_3522057_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.9	2.1e-12
WP_003155105.1|3522105_3522228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080130443.1|3522276_3523527_-	cytochrome P450	NA	NA	NA	NA	NA
WP_160222955.1|3523657_3525307_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.1	1.1e-14
WP_160222954.1|3525303_3526281_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	29.6	1.6e-32
>prophage 280
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3537529	3539371	3963851		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_025284535.1|3537529_3539371_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	28.0	1.2e-33
>prophage 281
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3544634	3552965	3963851		Bacillus_virus(100.0%)	3	NA	NA
WP_160222947.1|3544634_3548027_-	SMC family ATPase	NA	G3MAB6	Bacillus_virus	23.8	1.5e-05
WP_032866159.1|3548023_3549196_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_160223387.1|3549260_3552965_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	26.3	1.3e-15
>prophage 282
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3571498	3577554	3963851		Trichoplusia_ni_ascovirus(33.33%)	5	NA	NA
WP_007610477.1|3571498_3572356_-	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.2	1.4e-53
WP_160222942.1|3572480_3574004_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007409192.1|3574125_3575418_+	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.2	1.5e-09
WP_043021331.1|3575548_3576106_+	biotin biosynthesis protein BioY	NA	NA	NA	NA	NA
WP_160222941.1|3576117_3577554_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.2	1.8e-24
>prophage 283
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3580642	3585226	3963851		Bacillus_phage(50.0%)	4	NA	NA
WP_007409199.1|3580642_3581791_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	46.0	1.5e-50
WP_012117226.1|3581836_3583087_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_012117225.1|3583241_3583637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012117224.1|3583684_3585226_-	fatty acid--CoA ligase family protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.7	1.8e-43
>prophage 284
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3606542	3609429	3963851		Staphylococcus_phage(33.33%)	3	NA	NA
WP_025284506.1|3606542_3607286_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	2.7e-24
WP_007409220.1|3607776_3608214_+	HIT family protein	NA	X4YER2	Lactococcus_phage	33.0	6.2e-05
WP_160222937.1|3608349_3609429_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.3	4.1e-82
>prophage 285
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3621166	3622063	3963851		Staphylococcus_phage(100.0%)	1	NA	NA
WP_007409231.1|3621166_3622063_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	2.6e-26
>prophage 286
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3635659	3640556	3963851		Bacillus_phage(100.0%)	4	NA	NA
WP_007610368.1|3635659_3635866_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	79.0	1.0e-18
WP_076423810.1|3636121_3636742_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_160222935.1|3636780_3638802_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	1.4e-43
WP_063095824.1|3638798_3640556_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	4.4e-49
>prophage 287
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3644792	3648254	3963851		Staphylococcus_phage(66.67%)	5	NA	NA
WP_012117183.1|3644792_3645536_-	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	30.9	1.6e-21
WP_007409256.1|3645587_3646703_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_003155299.1|3646866_3646971_-	YhdX family protein	NA	NA	NA	NA	NA
WP_015417128.1|3647140_3647857_+	glycerophosphodiester phosphodiesterase	NA	A0A220BY94	Staphylococcus_phage	34.7	3.7e-31
WP_032866192.1|3647858_3648254_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	39.7	1.7e-09
>prophage 288
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3660670	3664601	3963851		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_007610321.1|3660670_3661540_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.5	1.9e-50
WP_025284485.1|3661619_3662723_-	citrate synthase/methylcitrate synthase	NA	NA	NA	NA	NA
WP_007409271.1|3662832_3663708_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007409272.1|3663776_3664601_-	C40 family peptidase	NA	U5PW24	Bacillus_virus	43.9	3.0e-16
>prophage 289
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3670313	3671768	3963851		Bacillus_virus(100.0%)	1	NA	NA
WP_082997766.1|3670313_3671768_+	peptidoglycan endopeptidase	NA	M1HNA7	Bacillus_virus	34.0	1.3e-11
>prophage 290
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3675032	3676775	3963851		Streptococcus_phage(100.0%)	1	NA	NA
WP_007409283.1|3675032_3676775_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	50.9	4.5e-163
>prophage 291
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3680226	3681054	3963851		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_015239469.1|3680226_3681054_-	aquaporin family protein	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	34.9	5.6e-31
>prophage 292
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3684946	3687730	3963851		Synechococcus_phage(33.33%)	4	NA	NA
WP_003155347.1|3684946_3685636_-	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	5.2e-06
WP_007408449.1|3685763_3686186_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	34.2	2.3e-12
WP_007408448.1|3686316_3686712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076423787.1|3686821_3687730_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.7	7.3e-08
>prophage 293
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3695162	3700338	3963851		Staphylococcus_phage(50.0%)	6	NA	NA
WP_012117154.1|3695162_3696242_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.5	4.6e-17
WP_076423773.1|3696258_3697089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155376.1|3697471_3697672_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	62.1	3.2e-17
WP_025284471.1|3697763_3698711_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012117151.1|3698703_3699621_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.0	6.2e-39
WP_025284469.1|3699621_3700338_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	2.8e-18
>prophage 294
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3705519	3708790	3963851		Bacillus_phage(50.0%)	2	NA	NA
WP_082997757.1|3705519_3706704_-	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	44.0	1.7e-25
WP_003155391.1|3706894_3708790_-	serine/threonine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.1	1.4e-101
>prophage 295
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3719201	3724845	3963851		Bacillus_virus(33.33%)	5	NA	NA
WP_160222924.1|3719201_3719969_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	2.1e-32
WP_033574447.1|3720191_3721127_-	amidohydrolase	NA	NA	NA	NA	NA
WP_003155420.1|3721383_3722829_+	catalase	NA	A0A2K9L0T1	Tupanvirus	41.7	8.1e-110
WP_015239443.1|3722900_3723866_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_059366796.1|3723858_3724845_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.8	6.7e-15
>prophage 296
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3728946	3730302	3963851		Pandoravirus(100.0%)	1	NA	NA
WP_094031912.1|3728946_3730302_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	39.7	9.5e-44
>prophage 297
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3747004	3748747	3963851		Bacillus_phage(100.0%)	1	NA	NA
WP_012117125.1|3747004_3748747_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	1.3e-48
>prophage 298
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3756149	3758201	3963851		Salmonella_phage(50.0%)	2	NA	NA
WP_003155484.1|3756149_3757130_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.3	1.5e-59
WP_043020689.1|3757340_3758201_-	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	26.4	2.2e-06
>prophage 299
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3770151	3772246	3963851		Mycobacterium_phage(50.0%)	2	NA	NA
WP_160222920.1|3770151_3771744_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.0	4.5e-21
WP_025284442.1|3771703_3772246_-	bacillithiol transferase BstA	NA	D0R7I3	Paenibacillus_phage	45.6	1.4e-17
>prophage 300
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3780562	3786717	3963851		Bacillus_phage(100.0%)	3	NA	NA
WP_076425456.1|3780562_3782380_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	2.5e-55
WP_012117099.1|3782360_3784094_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	4.4e-46
WP_012117098.1|3784389_3786717_-	peptidase G2	NA	Q9ZXE2	Bacillus_phage	38.5	1.7e-133
>prophage 301
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3801440	3802841	3963851		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_160222914.1|3801440_3802841_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.7	3.3e-84
>prophage 302
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3819713	3820229	3963851		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_003155578.1|3819713_3820229_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.9	1.3e-09
>prophage 303
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3833465	3835403	3963851		Streptococcus_phage(100.0%)	1	NA	NA
WP_007610031.1|3833465_3835403_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.9	8.0e-137
>prophage 304
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3839094	3839229	3963851		Bacillus_virus(100.0%)	1	NA	NA
WP_003155609.1|3839094_3839229_+	YflJ family protein	NA	G3MBD1	Bacillus_virus	61.0	1.9e-05
>prophage 305
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3855699	3861475	3963851		Hokovirus(50.0%)	2	NA	NA
WP_160222905.1|3855699_3858789_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.9	1.8e-29
WP_160223384.1|3858943_3861475_-	collagen-like repeat preface domain-containing protein	NA	A0A2R8FCV3	Brazilian_cedratvirus	64.7	1.5e-39
>prophage 306
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3875826	3885632	3963851		Tupanvirus(33.33%)	8	NA	NA
WP_015239365.1|3875826_3876957_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	32.2	2.7e-44
WP_012117051.1|3877128_3878685_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	8.9e-54
WP_007408959.1|3878727_3879912_-	MFS transporter	NA	NA	NA	NA	NA
WP_012117050.1|3879975_3880398_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_136396192.1|3880588_3882478_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	4.1e-53
WP_020955481.1|3882636_3883704_+	glycosyltransferase family 2 protein	NA	A0A1V0SAJ8	Catovirus	30.2	1.2e-14
WP_136396191.1|3883749_3884649_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	50.0	1.4e-67
WP_007408955.1|3884777_3885632_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.6e-09
>prophage 307
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3893191	3897075	3963851		Tupanvirus(50.0%)	3	NA	NA
WP_012117042.1|3893191_3894160_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	29.2	6.1e-29
WP_015239357.1|3894166_3894931_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003155677.1|3895146_3897075_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.5	1.1e-130
>prophage 308
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3905640	3910904	3963851		Staphylococcus_phage(50.0%)	4	NA	NA
WP_015239351.1|3905640_3906531_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	3.5e-23
WP_007609957.1|3906531_3906843_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_015239350.1|3906835_3907429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160222899.1|3907721_3910904_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.5	1.7e-80
>prophage 309
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3921843	3936618	3963851		Bacillus_phage(33.33%)	12	NA	NA
WP_082999071.1|3921843_3923724_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	59.9	1.8e-125
WP_082999070.1|3923729_3924029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082999090.1|3924138_3926145_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	50.9	2.2e-129
WP_082999069.1|3926149_3926623_+	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_063095907.1|3926656_3927112_+	DUF600 family protein	NA	NA	NA	NA	NA
WP_082999068.1|3927156_3927627_+	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_052827156.1|3928039_3928915_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003155721.1|3928915_3929869_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	8.2e-18
WP_052827154.1|3930220_3930688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076425541.1|3930877_3932263_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	45.4	1.7e-109
WP_015239327.1|3932410_3933322_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.6	1.2e-21
WP_015239326.1|3933474_3936618_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.0	2.7e-65
>prophage 310
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3942886	3950311	3963851		Bacillus_virus(33.33%)	5	NA	NA
WP_061581503.1|3942886_3943579_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.1	7.7e-18
WP_082999067.1|3943615_3944611_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
WP_007408912.1|3944848_3946045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025284377.1|3946060_3948067_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	39.8	4.5e-127
WP_032872525.1|3948091_3950311_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.6	5.9e-136
>prophage 311
NZ_CP028207	Bacillus velezensis strain SRCM102743 chromosome, complete genome	3963851	3957745	3962427	3963851		Synechococcus_phage(50.0%)	4	NA	NA
WP_025284372.1|3957745_3959284_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	6.7e-78
WP_007408902.1|3959280_3959868_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
WP_094031563.1|3959864_3960905_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.9	3.7e-64
WP_007609856.1|3960996_3962427_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
