The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	54535	95897	4281863	tRNA,coat,protease	Bacillus_virus(20.0%)	41	NA	NA
WP_003229613.1|54535_55798_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
WP_004398923.1|55949_57608_+|protease	Lon protease 2	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_014480468.1|57788_60113_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
WP_003229621.1|60109_60697_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014477563.1|60718_61216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399038.1|61445_62813_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003222575.1|62820_63651_+	protein HemX	NA	NA	NA	NA	NA
WP_122895579.1|63683_64628_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_014480466.1|64617_65406_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_014480465.1|65402_66377_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014480464.1|66406_67699_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_014480463.1|67829_69551_+|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_122895580.1|69583_70609_+|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_003222590.1|70627_70819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697542.1|71266_73909_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
WP_003229640.1|73968_75261_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_080474433.1|75401_76148_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_122895581.1|76281_77280_+	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_004398496.1|77432_78002_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_041351757.1|78038_78734_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_003229650.1|78825_79839_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_003222609.1|79869_80742_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004398811.1|80738_81257_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004398901.1|81309_81990_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398624.1|81991_82798_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398684.1|82946_83741_+	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_014480452.1|83733_84600_+	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_003229668.1|84746_85055_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_122895582.1|85057_85396_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003222623.1|85408_85693_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229671.1|85813_85936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399131.1|86013_86592_+	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003246161.1|86625_87912_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003222630.1|87972_88416_+	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_122895583.1|88432_89290_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_122895584.1|89313_89856_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_160245043.1|89815_91003_-	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.1	2.3e-33
WP_032722264.1|91105_92701_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_038429401.1|92654_93524_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_046381243.1|93510_94617_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_032722261.1|94733_95897_+|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
>prophage 2
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	275252	312676	4281863	portal,terminase,tail,capsid,plate,holin	uncultured_Caudovirales_phage(31.25%)	50	NA	NA
WP_004398704.1|275252_275603_-	transcriptional regulator SknR	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	30.6	2.0e-06
WP_004398958.1|275778_276009_+	helix-turn-helix transcriptional regulator	NA	A8ATK0	Listeria_phage	53.4	1.1e-08
WP_003229902.1|276038_276179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714341.1|276252_276822_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	1.5e-64
WP_015714340.1|276818_277076_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	6.4e-10
WP_120028409.1|277072_277246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229905.1|277205_277400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072175921.1|277488_278460_+	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	70.4	8.9e-129
WP_160245058.1|278462_279317_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	77.6	3.3e-119
WP_128753685.1|279393_280071_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	32.2	1.1e-05
WP_160245059.1|279952_280894_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	8.0e-58
WP_080333438.1|280884_281034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160245060.1|281128_281557_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	67.2	1.9e-43
WP_003229912.1|281638_281845_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	71.6	5.5e-20
WP_160245061.1|281975_284057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160245062.1|284066_284690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160245063.1|284792_285248_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	74.2	1.8e-60
WP_160245064.1|285596_285830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160245065.1|285871_286636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160245066.1|286698_287415_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	56.3	5.9e-61
WP_160245067.1|287407_288703_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	65.1	1.3e-154
WP_160245068.1|288706_290239_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	52.0	1.0e-147
WP_069704059.1|290235_291153_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	40.5	3.4e-53
WP_069704060.1|291203_292478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069704061.1|292511_293486_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	55.3	5.9e-56
WP_069704062.1|293504_294440_+|capsid	major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	65.0	8.6e-105
WP_069704063.1|294450_294762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069704064.1|294765_295161_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_021480106.1|295157_295520_+	YqbH/XkdH family protein	NA	A0A249XXE9	Clostridium_phage	40.2	1.1e-10
WP_069704065.1|295516_296020_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.5	9.9e-39
WP_069704066.1|296032_296470_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_069704067.1|296466_296658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160245069.1|296658_298059_+|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	39.1	3.1e-74
WP_021480101.1|298060_298504_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.8	1.0e-26
WP_021480100.1|299166_299604_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	40.2	5.8e-11
WP_021480099.1|299645_299783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101172375.1|299785_304543_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	1.3e-44
WP_004398548.1|304535_305195_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	4.8e-25
WP_004398524.1|305207_306188_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.0	2.1e-40
WP_003229938.1|306184_306448_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_004398572.1|306460_306886_+	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	36.4	1.5e-11
WP_003229940.1|306878_307925_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	8.3e-72
WP_003229941.1|307908_308487_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	1.5e-14
WP_003229942.1|308483_308756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229943.1|308758_309859_+	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
WP_009967793.1|309868_310204_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003229944.1|310200_310365_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	2.7e-14
WP_003246010.1|310452_311346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003246208.1|311390_311813_+|holin	holin family protein	holin	D6R405	Bacillus_phage	73.7	3.3e-48
WP_003229946.1|311857_312676_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	74.4	1.0e-64
>prophage 3
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	551901	557997	4281863		Staphylococcus_phage(66.67%)	8	NA	NA
WP_160245106.1|551901_552987_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	6.6e-56
WP_160245107.1|552997_553645_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	2.9e-43
WP_003230496.1|553659_554856_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	5.3e-115
WP_003223915.1|554888_555353_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_003223910.1|555465_555840_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_032722049.1|555853_556378_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003246108.1|556658_557414_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_003223904.1|557403_557997_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
>prophage 4
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	711041	759913	4281863	integrase,tail,holin,bacteriocin	Bacillus_phage(91.89%)	49	710634:710650	758613:758629
710634:710650	attL	CACTTGCTCCAGTTTCT	NA	NA	NA	NA
WP_160245121.1|711041_711932_-	endonuclease YokF	NA	O64020	Bacillus_phage	94.3	8.8e-107
WP_160245122.1|712112_712364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061891063.1|712450_712987_+	SMI1/KNR4 family protein	NA	A0A1P8CWM2	Bacillus_phage	85.2	9.0e-06
WP_160245569.1|713020_713794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160245123.1|714273_716160_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	81.6	3.5e-161
WP_071581355.1|716172_716631_+	SMI1 / KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	84.2	6.8e-71
WP_106293871.1|716933_717017_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_129137746.1|717177_718176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041336419.1|718343_718676_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	98.2	8.4e-55
WP_064627413.1|718668_719919_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	99.0	4.4e-237
WP_009967545.1|720020_720338_+	sublancin immunity protein SunI	NA	NA	NA	NA	NA
WP_009967544.1|720634_720805_+|bacteriocin	bacteriocin sublancin-168	bacteriocin	NA	NA	NA	NA
WP_003246186.1|720862_722980_+	sublancin transporter SunT	NA	W8CYL7	Bacillus_phage	26.1	6.9e-25
WP_003230920.1|722976_723390_+	disulfide bond formation protein BdbA	NA	NA	NA	NA	NA
WP_004399050.1|723389_724658_+	SunS family peptide S-glycosyltransferase	NA	NA	NA	NA	NA
WP_009967541.1|724654_725101_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_004399099.1|725156_725423_-	SPBc2 prophage-derived protein BhlB	NA	A0A2H4J6M0	uncultured_Caudovirales_phage	50.0	1.1e-15
WP_003246119.1|725433_725646_-	SPBc2 prophage-derived protein BhlA	NA	A0A290GDY2	Caldibacillus_phage	59.7	4.2e-15
WP_004399108.1|725733_726837_-	N-acetylmuramoyl-L-alanine amidase BlyA	NA	O64040	Bacillus_phage	100.0	2.8e-187
WP_160245124.1|728067_730302_-	hypothetical protein	NA	A0A0A0RUQ7	Bacillus_phage	38.9	5.3e-68
WP_042976716.1|730314_731133_-	hypothetical protein	NA	O64043	Bacillus_phage	65.7	1.2e-99
WP_160245125.1|731147_733790_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	93.2	0.0e+00
WP_072692673.1|733802_734564_-|tail	phage tail protein	tail	A0A1P8CWP8	Bacillus_phage	98.7	2.0e-131
WP_160245126.1|734604_741495_-	transglycosylase CwlP	NA	A0A1P8CWQ1	Bacillus_phage	72.9	0.0e+00
WP_128992108.1|741548_742175_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	34.8	4.4e-20
WP_144500939.1|742254_743214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033885229.1|743395_744397_-|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	99.1	2.6e-192
WP_033885226.1|744410_744830_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	87.1	2.6e-61
WP_064814696.1|744829_745318_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	73.0	7.0e-58
WP_072692670.1|745355_745496_-	XkdX family protein	NA	NA	NA	NA	NA
WP_072692669.1|745497_745917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052476559.1|745913_746858_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	35.9	1.7e-20
WP_033885222.1|746857_747214_-	hypothetical protein	NA	O64055	Bacillus_phage	90.7	5.0e-53
WP_009967521.1|747277_747505_-	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	100.0	6.4e-38
WP_074794686.1|747504_748116_-	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	99.5	7.5e-65
WP_068947508.1|748133_748931_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	99.6	1.3e-90
WP_003230954.1|748973_749684_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	100.0	1.8e-131
WP_160245127.1|749680_750187_-	hypothetical protein	NA	O64060	Bacillus_phage	99.4	1.7e-91
WP_106293918.1|750183_750834_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	99.1	6.0e-121
WP_128751219.1|750817_751072_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	97.6	3.2e-38
WP_160245128.1|751068_751464_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	96.9	3.0e-67
WP_041352941.1|751478_751949_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	98.7	2.0e-81
WP_041337005.1|751984_753001_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	99.7	2.9e-186
WP_160245129.1|753039_753576_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	98.9	3.9e-94
WP_160245130.1|753600_755037_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	92.5	2.4e-247
WP_160245131.1|755067_756588_-	hypothetical protein	NA	O64068	Bacillus_phage	98.0	2.8e-278
WP_160245132.1|756605_758375_-	hypothetical protein	NA	O64069	Bacillus_phage	99.5	0.0e+00
WP_160245133.1|758361_759282_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	99.7	2.1e-175
758613:758629	attR	CACTTGCTCCAGTTTCT	NA	NA	NA	NA
WP_160245134.1|759388_759913_-	hypothetical protein	NA	U5J9P3	Bacillus_phage	36.2	3.1e-19
>prophage 5
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	763378	773929	4281863		Bacillus_phage(90.0%)	12	NA	NA
WP_144452895.1|763378_763654_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	96.7	2.4e-39
WP_160245135.1|763909_764542_-	hypothetical protein	NA	O64076	Bacillus_phage	78.7	2.8e-91
WP_160245136.1|764763_765666_-	GIY-YIG nuclease family protein	NA	G3MAX5	Bacillus_virus	36.4	1.8e-06
WP_160245137.1|765848_767726_-	hypothetical protein	NA	A0A1P8CWS8	Bacillus_phage	98.6	0.0e+00
WP_072692657.1|767765_767960_-	hypothetical protein	NA	O64077	Bacillus_phage	95.3	8.7e-28
WP_019712271.1|768966_769143_+	hypothetical protein	NA	O64080	Bacillus_phage	94.9	2.6e-10
WP_160245138.1|769161_769413_+	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	94.4	4.6e-29
WP_114168610.1|769457_769646_+	hypothetical protein	NA	O64081	Bacillus_phage	96.8	9.7e-24
WP_160245139.1|769727_770945_+	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	83.7	3.8e-201
WP_160245140.1|771286_771832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071582337.1|772188_772674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153912475.1|773701_773929_+	helix-turn-helix domain-containing protein	NA	O64085	Bacillus_phage	92.0	2.4e-32
>prophage 6
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	780645	836208	4281863	integrase	Bacillus_phage(94.74%)	88	780615:780631	809732:809748
780615:780631	attL	ACAAAAAATATGTATAT	NA	NA	NA	NA
WP_032677204.1|780645_780846_+	hypothetical protein	NA	O64096	Bacillus_phage	98.5	2.0e-27
WP_041336982.1|780848_781166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160245146.1|781214_781427_+	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	94.3	1.8e-26
WP_041336981.1|781416_782493_+|integrase	site-specific integrase	integrase	O64099	Bacillus_phage	99.4	5.9e-198
WP_003231030.1|782599_783982_+	hypothetical protein	NA	O64100	Bacillus_phage	99.3	3.7e-261
WP_003231032.1|784005_784983_+	hypothetical protein	NA	O64101	Bacillus_phage	99.7	4.0e-177
WP_004399410.1|785171_785396_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	100.0	1.9e-34
WP_041336980.1|785578_785797_+	YopT family protein	NA	O64103	Bacillus_phage	97.2	3.3e-31
WP_010330351.1|785868_786066_+	hypothetical protein	NA	O64104	Bacillus_phage	96.9	1.2e-27
WP_003231036.1|786177_786372_+	hypothetical protein	NA	O64105	Bacillus_phage	100.0	1.9e-27
WP_041352905.1|786460_786796_+	hypothetical protein	NA	A0A1P8CWX6	Bacillus_phage	92.8	1.8e-44
WP_042976215.1|786792_787215_+	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	58.3	2.2e-39
WP_041352077.1|787400_787829_+	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	91.0	5.6e-67
WP_160245147.1|787865_788450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160245148.1|788513_788963_+	hypothetical protein	NA	W5QUC5	Bacillus_phage	36.2	1.0e-15
WP_017697056.1|789027_789318_+	hypothetical protein	NA	A0A127AWI5	Bacillus_phage	45.6	9.7e-15
WP_017697057.1|789506_789722_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	80.3	7.7e-25
WP_017697058.1|789737_790112_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	64.5	4.9e-35
WP_017697059.1|790267_790525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947542.1|790588_791344_+	Rha family transcriptional regulator	NA	Q4ZC33	Staphylococcus_virus	42.5	4.3e-54
WP_160245149.1|791635_792448_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	87.0	3.3e-137
WP_053574160.1|792517_793192_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	95.8	1.0e-75
WP_160245150.1|793262_793481_+	hypothetical protein	NA	O64132	Bacillus_phage	93.0	1.1e-31
WP_128751188.1|793483_794188_+	HNH endonuclease	NA	O64121	Bacillus_phage	41.0	5.8e-29
WP_160245151.1|794248_794644_+	hypothetical protein	NA	O64133	Bacillus_phage	96.9	4.2e-69
WP_160245152.1|794741_795566_+	gamma-polyglutamate hydrolase PghZ	NA	O64134	Bacillus_phage	95.3	2.7e-142
WP_160245153.1|795562_797323_+	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	97.3	0.0e+00
WP_113712893.1|797408_797705_+	hypothetical protein	NA	O64136	Bacillus_phage	98.0	6.8e-48
WP_019712321.1|797767_798148_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	96.0	1.2e-65
WP_072692915.1|798462_798834_+	hypothetical protein	NA	O64139	Bacillus_phage	95.1	3.6e-62
WP_160245154.1|798855_799770_+	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	89.5	2.6e-154
WP_004399537.1|799852_800824_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	100.0	1.7e-180
WP_124058372.1|800866_801337_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	98.7	1.0e-85
WP_128751181.1|801351_802866_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	98.4	6.4e-283
WP_160245155.1|802881_804018_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	99.2	5.0e-224
WP_160245156.1|804017_805748_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	97.0	0.0e+00
WP_160245157.1|805760_809678_+	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	97.4	0.0e+00
WP_160245570.1|809706_810423_+	hypothetical protein	NA	O64147	Bacillus_phage	88.2	5.1e-113
809732:809748	attR	ACAAAAAATATGTATAT	NA	NA	NA	NA
WP_160245158.1|810531_810690_+	hypothetical protein	NA	A0A1P8CX11	Bacillus_phage	86.5	2.3e-18
WP_041336515.1|810726_810924_+	hypothetical protein	NA	O64149	Bacillus_phage	96.9	2.1e-29
WP_019712328.1|810956_811172_+	YorP family protein	NA	O64150	Bacillus_phage	98.6	3.0e-37
WP_041338484.1|811164_811320_+	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	94.1	5.7e-22
WP_160245159.1|811319_811817_+	deoxynucleoside kinase	NA	A0A1P8CX28	Bacillus_phage	91.5	2.7e-81
WP_072692910.1|811845_812073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052475786.1|812125_812773_+	HNH endonuclease	NA	O64121	Bacillus_phage	40.5	7.0e-29
WP_160245160.1|812824_813742_+	DNA cytosine methyltransferase	NA	F4YCI6	Synechococcus_phage	47.8	1.1e-59
WP_106021394.1|813789_814008_+	hypothetical protein	NA	A0A1P8CX26	Bacillus_phage	97.2	4.7e-30
WP_160245161.1|814011_814377_+	hypothetical protein	NA	O64156	Bacillus_phage	95.0	1.9e-60
WP_160245162.1|814416_814644_+	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	92.0	1.4e-32
WP_106021389.1|814656_814839_+	hypothetical protein	NA	O64158	Bacillus_phage	98.3	2.0e-26
WP_041353154.1|814906_815119_+	hypothetical protein	NA	O64159	Bacillus_phage	91.4	1.1e-31
WP_032721785.1|815153_815417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041352023.1|815443_815992_+	metallophosphoesterase	NA	A0A223LD99	Bacillus_phage	60.0	4.3e-56
WP_041352021.1|816051_816522_+	hypothetical protein	NA	O64162	Bacillus_phage	94.9	3.0e-82
WP_038458579.1|816577_816784_+	hypothetical protein	NA	A0A1P8CX41	Bacillus_phage	50.0	2.6e-06
WP_160245163.1|816986_817394_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	79.4	1.5e-53
WP_160245164.1|817408_817756_+	hypothetical protein	NA	O64164	Bacillus_phage	95.7	7.5e-54
WP_160245165.1|817935_818154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160245166.1|818187_818379_+	hypothetical protein	NA	S6BUY9	Bacillus_phage	48.4	1.1e-09
WP_121572658.1|818393_818606_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	80.0	1.1e-28
WP_160245167.1|819006_819189_+	hypothetical protein	NA	F8WPL1	Bacillus_phage	71.7	2.2e-20
WP_160245168.1|819269_819623_+	hypothetical protein	NA	O64171	Bacillus_phage	94.0	6.6e-58
WP_160245169.1|819622_820018_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	92.4	1.3e-62
WP_160245170.1|819980_822080_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	62.4	0.0e+00
WP_160245171.1|822093_822606_+	hypothetical protein	NA	Q7Y5F9	Xanthomonas_virus	48.8	2.3e-11
WP_160245571.1|822640_823621_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	81.4	3.2e-150
WP_160245172.1|823617_823860_+	thioredoxin	NA	A0A1P8CX24	Bacillus_phage	90.0	1.6e-34
WP_160245173.1|824120_824549_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	93.0	1.2e-72
WP_017697107.1|824636_824819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033885274.1|825138_825432_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	92.8	1.1e-42
WP_042976089.1|825574_825919_+	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	93.0	1.3e-50
WP_072692897.1|825975_826815_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	96.8	3.4e-161
WP_041336479.1|826814_827336_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	44.7	6.9e-35
WP_160245174.1|827460_827823_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	63.2	2.2e-32
WP_160245175.1|827803_828553_+	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	98.3	8.7e-132
WP_033884587.1|828996_829281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967454.1|829388_829607_-	acid-soluble spore protein SspC	NA	Q77YX0	Bacillus_phage	100.0	5.6e-31
WP_061891166.1|829728_830556_+	metallophosphoesterase	NA	O64184	Bacillus_phage	97.5	1.5e-164
WP_004399249.1|830738_830930_+	hypothetical protein	NA	A0A1P8CX54	Bacillus_phage	100.0	1.0e-33
WP_151262259.1|830969_831326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160245572.1|831382_831643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160245176.1|831698_832127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160245177.1|832107_832656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113712915.1|833205_833655_+	hypothetical protein	NA	A0A1P8CX70	Bacillus_phage	98.6	1.5e-78
WP_160245178.1|833746_834076_+	hypothetical protein	NA	A0A1P8CX80	Bacillus_phage	97.2	7.6e-56
WP_113712938.1|834128_834314_+	hypothetical protein	NA	O64193	Bacillus_phage	91.8	5.6e-24
WP_113712917.1|834633_835221_+	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	95.4	1.9e-105
WP_113712918.1|835458_836208_-	hypothetical protein	NA	A0A1P8CX59	Bacillus_phage	89.2	9.0e-129
>prophage 7
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	1054892	1147201	4281863	coat,portal,terminase,tRNA,tail,capsid,protease,integrase,head,plate,holin	Bacillus_phage(61.9%)	98	1055665:1055684	1140813:1140832
WP_122895398.1|1054892_1055153_+|coat	spore coat protein CotU	coat	NA	NA	NA	NA
1055665:1055684	attL	ATTCATTTTATACATAATAT	NA	NA	NA	NA
WP_014479915.1|1055755_1056190_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	92.3	5.8e-72
WP_121591877.1|1056219_1056681_-	DUF2691 family protein	NA	NA	NA	NA	NA
WP_014479913.1|1057109_1057535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600564.1|1057945_1059130_+	alanine racemase	NA	NA	NA	NA	NA
WP_122895397.1|1059232_1060648_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_122895396.1|1061059_1061695_+	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	67.6	5.5e-71
WP_160245215.1|1062180_1063680_-	xylulokinase	NA	NA	NA	NA	NA
WP_014479908.1|1063830_1065168_-	xylose isomerase	NA	NA	NA	NA	NA
WP_160245216.1|1065405_1066560_+	ROK family protein	NA	NA	NA	NA	NA
WP_122895393.1|1066697_1068299_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_032725796.1|1068329_1069721_-	MFS transporter	NA	NA	NA	NA	NA
WP_015483267.1|1070237_1070549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122895516.1|1070901_1071303_-	hypothetical protein	NA	O64087	Bacillus_phage	77.6	4.8e-44
WP_122895392.1|1071290_1071566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160245217.1|1072427_1072808_-	UPF0715 family protein	NA	NA	NA	NA	NA
WP_160245218.1|1072885_1073788_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015483262.1|1073866_1074403_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_122895389.1|1075381_1076758_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_122895388.1|1076754_1077861_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_122895387.1|1077847_1078555_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_122895386.1|1078551_1079223_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_160245573.1|1079327_1085522_-	collagen-like protein	NA	NA	NA	NA	NA
WP_160245219.1|1085356_1086634_-	NTTRR-F1 domain	NA	NA	NA	NA	NA
WP_122894487.1|1087337_1087475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122894488.1|1087685_1088177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122894489.1|1088430_1088721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947602.1|1089816_1091664_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	55.9	1.3e-120
WP_038427712.1|1091670_1091970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119899421.1|1092010_1092988_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	68.7	7.0e-65
WP_038427709.1|1093031_1093454_-|holin	holin	holin	D6R405	Bacillus_phage	82.7	2.4e-54
WP_119900114.1|1093519_1093771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080282461.1|1093920_1094094_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	75.4	2.5e-18
WP_038427706.1|1094093_1094462_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	47.6	3.5e-17
WP_051673212.1|1094475_1096059_-|plate	phage baseplate upper protein	plate	A0A1P8CWR7	Bacillus_phage	48.0	6.2e-63
WP_119899419.1|1096241_1096550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119899418.1|1096565_1098464_-	teichoic acid biosynthesis protein	NA	A0A185AMX0	Staphylococcus_phage	32.8	1.6e-41
WP_160245220.1|1098513_1100217_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	55.3	6.3e-178
WP_046160652.1|1100231_1101071_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.6	3.4e-92
WP_088325984.1|1101064_1105552_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.5	2.0e-66
WP_088325982.1|1105751_1106129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019260068.1|1106196_1106808_-|tail	tail protein	tail	J7KKC8	Streptococcus_phage	35.1	3.6e-11
WP_088325980.1|1106822_1107215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088325978.1|1107211_1107610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088325976.1|1107609_1107924_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	37.3	9.9e-13
WP_077670781.1|1107913_1108216_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	2.8e-12
WP_160245221.1|1108233_1108632_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	47.6	1.5e-10
WP_088325972.1|1108658_1109945_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	45.0	2.7e-80
WP_088325970.1|1109984_1110722_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	56.4	6.9e-57
WP_160245222.1|1110669_1111977_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.4	1.7e-103
WP_088325966.1|1111977_1112169_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_069837308.1|1112179_1113889_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.5	6.0e-205
WP_088325964.1|1113885_1114401_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.4	2.2e-33
WP_088325962.1|1114628_1114994_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	5.1e-29
WP_072693012.1|1115053_1115314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088325960.1|1115366_1115681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043858639.1|1115936_1116344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041056299.1|1116502_1116823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088325958.1|1117166_1117382_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_128738207.1|1118068_1118452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220264.1|1118687_1119230_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	63.9	5.8e-61
WP_088325954.1|1119229_1119679_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	58.1	3.9e-39
WP_014471604.1|1119776_1119977_-	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	60.0	1.8e-07
WP_088325952.1|1120069_1120822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325948.1|1121059_1122388_-	replicative DNA helicase	NA	W8EEZ1	Geobacillus_phage	56.3	9.3e-137
WP_088325946.1|1122388_1122745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088325944.1|1122737_1123511_-	Replication protein O	NA	A0A2P1JTY8	Anoxybacillus_phage	45.4	1.7e-37
WP_088325942.1|1123523_1123928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088325940.1|1124056_1124905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088325938.1|1124917_1125571_-	DNA-binding protein	NA	A0A0A8WJ71	Clostridium_phage	50.0	2.4e-29
WP_088325936.1|1125567_1125879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088325934.1|1125949_1126219_-	group-specific protein	NA	A0A0S2SXU9	Bacillus_phage	51.7	9.3e-20
WP_088325932.1|1126231_1126477_-	helix-turn-helix transcriptional regulator	NA	A0A0S2SXX9	Bacillus_phage	75.9	3.4e-29
WP_088325930.1|1126654_1127026_+	helix-turn-helix transcriptional regulator	NA	A0A0S2SXM8	Bacillus_phage	72.7	1.2e-22
WP_088325928.1|1127033_1127501_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	59.5	6.5e-45
WP_088325926.1|1127553_1128699_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	40.7	4.1e-72
WP_015252037.1|1128818_1130153_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_122894501.1|1130211_1130619_-	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_003231742.1|1130728_1131994_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_015483254.1|1132011_1133274_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003231746.1|1133406_1134375_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_122894502.1|1135006_1135774_+	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.5	4.1e-52
WP_122894503.1|1135837_1136458_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	2.7e-46
WP_003231754.1|1136507_1137497_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_038828297.1|1137514_1139617_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_122894504.1|1139576_1139969_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_003245262.1|1140211_1140442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122894505.1|1140523_1140796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003221097.1|1140991_1141213_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
1140813:1140832	attR	ATTCATTTTATACATAATAT	NA	NA	NA	NA
WP_003245569.1|1141252_1142197_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003231769.1|1142296_1142710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245252.1|1142798_1143074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015483253.1|1143208_1143526_+	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
WP_014476870.1|1143539_1143893_+	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
WP_003231775.1|1143906_1144359_-	OsmC family protein	NA	NA	NA	NA	NA
WP_003245758.1|1144428_1145136_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_014476869.1|1145414_1145648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122894506.1|1145872_1147201_+|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	34.9	1.9e-28
>prophage 8
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	1620140	1694308	4281863	portal,terminase,protease,plate,holin	Bacillus_phage(23.26%)	85	NA	NA
WP_029946400.1|1620140_1621100_+|protease	serine protease Isp	protease	A0A127AWU5	Bacillus_phage	49.5	5.6e-75
WP_134991548.1|1621515_1623804_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_122894607.1|1623976_1624447_+	guanine deaminase	NA	S4VYZ2	Pandoravirus	45.1	4.0e-26
WP_003232570.1|1624778_1625189_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_014476587.1|1625330_1625774_+	organic hydroperoxide resistance transcriptional regulator OhrR	NA	NA	NA	NA	NA
WP_003232574.1|1625804_1626230_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_122894608.1|1626355_1627603_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.4	1.9e-99
WP_122894609.1|1627614_1628712_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.1	7.3e-71
WP_021479442.1|1629062_1629965_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_015252242.1|1630035_1630353_-	multidrug efflux SMR transporter subunit YkkD	NA	NA	NA	NA	NA
WP_003232583.1|1630352_1630691_-	multidrug efflux SMR transporter subunit YkkC	NA	NA	NA	NA	NA
WP_122894610.1|1630912_1631431_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_122894611.1|1631420_1631948_-	DinB family protein	NA	NA	NA	NA	NA
WP_160245254.1|1632039_1632765_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_015252245.1|1632913_1633138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122894612.1|1633214_1634414_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003232595.1|1634652_1635171_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003232597.1|1635330_1636191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122894613.1|1636280_1637330_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_003232600.1|1637372_1638362_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.2e-17
WP_122894614.1|1638374_1639265_-	gamma-D-glutamyl-L-lysine dipeptidyl-peptidase	NA	A0A0A8WIF2	Clostridium_phage	43.5	9.0e-19
WP_122894615.1|1639261_1640362_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_047182505.1|1640358_1641318_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_122894632.1|1641405_1643055_-	dipeptide ABC transporter substrate-binding protein DppE	NA	NA	NA	NA	NA
WP_122894616.1|1643057_1644065_-	dipeptide ABC transporter ATP-binding subunit DppD	NA	G9BWD6	Planktothrix_phage	28.7	2.4e-15
WP_121591720.1|1644069_1645032_-	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_003245446.1|1645037_1645964_-	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_121591718.1|1645980_1646805_-	D-aminopeptidase DppA	NA	NA	NA	NA	NA
WP_128737781.1|1646934_1647753_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_041337613.1|1647921_1649280_+|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.7	5.8e-25
WP_015715747.1|1649797_1650769_-	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.0	1.9e-62
WP_122894617.1|1650780_1652934_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_122894618.1|1652941_1653088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122894619.1|1653187_1654138_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_041850924.1|1654526_1655843_+	serine/threonine exchanger	NA	NA	NA	NA	NA
WP_003218470.1|1656118_1656736_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_014479569.1|1656748_1657750_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_003244695.1|1657858_1658605_+	toxin-antitoxin-antitoxin system toxin SpoIISA	NA	NA	NA	NA	NA
WP_003232646.1|1658604_1658775_+	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
WP_003232648.1|1658860_1658998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122894620.1|1659034_1659928_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	5.2e-83
WP_003232653.1|1659940_1660204_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	4.7e-24
WP_015252265.1|1660216_1660486_-	hypothetical protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	4.8e-24
WP_122894621.1|1660538_1661378_-	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_014479563.1|1661421_1661586_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
WP_160245255.1|1661582_1661909_-|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	40.9	7.6e-16
WP_122894623.1|1661926_1664368_-	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	35.2	8.2e-22
WP_003232665.1|1664370_1664643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122894624.1|1664639_1665218_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	1.3e-15
WP_021479465.1|1665201_1666248_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	3.7e-72
WP_122894625.1|1666240_1666666_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	40.0	4.6e-13
WP_019714098.1|1666723_1666990_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.4	3.8e-05
WP_122894626.1|1666989_1667967_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.6	1.0e-39
WP_038828716.1|1667982_1668642_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	8.1e-25
WP_160245256.1|1668634_1673800_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	43.8	7.5e-41
WP_014479557.1|1673800_1673941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015715734.1|1673982_1674429_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	37.7	5.9e-11
WP_003239114.1|1674520_1674964_-	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	1.1e-25
WP_021479470.1|1674965_1676366_-	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	1.4e-77
WP_003232679.1|1676362_1676581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122895089.1|1676584_1677025_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003245226.1|1677037_1677523_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_122895090.1|1677519_1677876_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_122895091.1|1677872_1678256_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	41.4	6.4e-14
WP_003232690.1|1678277_1679213_-	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_122895092.1|1679238_1680066_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.2	2.3e-53
WP_122895093.1|1680085_1681573_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.9	2.7e-140
WP_019712462.1|1681576_1682878_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.5	1.1e-153
WP_122895094.1|1682874_1683672_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	50.2	2.1e-59
WP_122895095.1|1683789_1684299_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	5.0e-22
WP_021479478.1|1684414_1684621_-	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	7.1e-12
WP_122895096.1|1684617_1684968_-	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_003245588.1|1685052_1685220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160245257.1|1685219_1686020_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.3	3.3e-60
WP_122895097.1|1685919_1686756_-|portal	phage portal protein	portal	S6BFM4	Thermus_phage	46.4	3.0e-24
WP_003232712.1|1686742_1686922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232719.1|1687100_1687442_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_122895098.1|1687604_1688201_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_122895099.1|1688244_1689081_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_122895100.1|1689157_1689760_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.2	1.3e-45
WP_122895101.1|1689865_1690243_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	43.3	3.6e-17
WP_122895102.1|1690281_1691235_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	74.1	4.3e-67
WP_122895103.1|1691631_1691766_-	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_015252291.1|1691755_1692892_-	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
WP_003245490.1|1693036_1694308_-	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
>prophage 9
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	1727885	1766259	4281863	tRNA,coat	Rhizobium_phage(33.33%)	40	NA	NA
WP_003245601.1|1727885_1728134_+|coat	spore coat protein CotT	coat	NA	NA	NA	NA
WP_010886488.1|1728256_1729246_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_003232822.1|1729865_1730195_+	YjdJ family protein	NA	NA	NA	NA	NA
WP_122895123.1|1730224_1730380_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_122895124.1|1730419_1730899_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_122895125.1|1731127_1731523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122895126.1|1731741_1732248_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_122895127.1|1732293_1732776_-	YjdF family protein	NA	NA	NA	NA	NA
WP_015383390.1|1732945_1733893_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_122895128.1|1733907_1735866_-	PTS mannose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_122895129.1|1736010_1737957_-	mannose transport/utilization transcriptional regulator ManR	NA	NA	NA	NA	NA
WP_003232839.1|1738524_1738872_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_122895130.1|1739031_1739787_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_122895131.1|1740025_1740343_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_160245270.1|1742492_1743308_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_122895133.1|1743330_1744152_+	HNH endonuclease	NA	B4UTX2	Rhizobium_phage	52.5	2.3e-05
WP_052476587.1|1744806_1745061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042977881.1|1745340_1745646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042977879.1|1745688_1745994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042977877.1|1746006_1747422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042977876.1|1747472_1747838_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_063177479.1|1748103_1749036_+	DUF4917 family protein	NA	NA	NA	NA	NA
WP_122895135.1|1752311_1753502_+	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_003232852.1|1753571_1754117_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021479530.1|1754149_1755322_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_122895246.1|1755314_1756436_-	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	4.8e-17
WP_122895136.1|1756791_1757514_+	esterase family protein	NA	NA	NA	NA	NA
WP_003232861.1|1757550_1758066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245407.1|1758069_1758492_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003232866.1|1758565_1758820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122895137.1|1758936_1761216_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.9	2.7e-91
WP_003232870.1|1761290_1761545_-	sporulation-specific transcription regulator SopVIF	NA	NA	NA	NA	NA
WP_003232872.1|1761677_1761827_-	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_017695696.1|1761908_1762115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160245271.1|1762394_1762751_-	sporulation protein YjcA	NA	NA	NA	NA	NA
WP_029726269.1|1762910_1763297_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_160245272.1|1763336_1763660_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014479465.1|1764417_1764906_+|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_014479464.1|1765033_1765483_+|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_122895138.1|1765575_1766259_-|coat	spore coat protein CotO	coat	NA	NA	NA	NA
>prophage 10
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	2308244	2316610	4281863		Synechococcus_phage(50.0%)	8	NA	NA
WP_014479062.1|2308244_2308832_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
WP_014479061.1|2308828_2309869_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	1.7e-64
WP_003233947.1|2309970_2311401_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_122895358.1|2311376_2313605_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.0	3.2e-158
WP_003243954.1|2313588_2314272_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003219409.1|2314268_2314523_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_046380819.1|2314515_2315241_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	4.1e-46
WP_003233955.1|2315314_2316610_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
>prophage 11
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	2357335	2364771	4281863		Tupanvirus(16.67%)	8	NA	NA
WP_014663024.1|2357335_2358922_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.6	1.7e-36
WP_014663023.1|2358946_2359903_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JIM2	Lactococcus_phage	31.5	2.5e-35
WP_014663022.1|2359927_2360902_-	ornithine cyclodeaminase	NA	NA	NA	NA	NA
WP_014663021.1|2360898_2361159_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_014663020.1|2361186_2361732_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	51.4	1.9e-48
WP_142927685.1|2361779_2363522_-	hypothetical protein	NA	E3SL39	Synechococcus_phage	26.5	6.9e-39
WP_014663018.1|2363558_2364290_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	45.0	1.0e-60
WP_014663017.1|2364306_2364771_-	6-carboxytetrahydropterin synthase QueD	NA	E7DN67	Pneumococcus_phage	48.1	3.0e-26
>prophage 12
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	3255098	3310624	4281863	lysis,holin,protease,tRNA,coat	Bacillus_phage(42.86%)	54	NA	NA
WP_082090420.1|3255098_3256340_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003227345.1|3256590_3257106_-	tyrZ transcriptional regulator YwaE	NA	NA	NA	NA	NA
WP_122895589.1|3258079_3258940_+	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	26.4	1.1e-05
WP_003244589.1|3258993_3259836_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_024572918.1|3259889_3261269_-	SacY negative regulator SacX	NA	NA	NA	NA	NA
WP_160245468.1|3261701_3263639_-|protease	minor protease Epr	protease	A0A1B0T6A2	Bacillus_phage	35.1	8.5e-46
WP_064671793.1|3263865_3265200_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_122895592.1|3265277_3265955_+	DUF2711 domain-containing protein	NA	NA	NA	NA	NA
WP_122895593.1|3265992_3266373_-	glyoxalase GlxA	NA	NA	NA	NA	NA
WP_122895594.1|3266493_3267684_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.1	2.9e-73
WP_014481283.1|3267716_3267914_-	YwbE family protein	NA	NA	NA	NA	NA
WP_122895595.1|3267947_3269150_-	MFS transporter	NA	NA	NA	NA	NA
WP_003227371.1|3269254_3269932_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_003227375.1|3269913_3270300_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_122895596.1|3270405_3271311_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_122895597.1|3271318_3272137_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_017697031.1|3272133_3272802_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_122895598.1|3272958_3274404_+	ferrous ion permease EfeU	NA	NA	NA	NA	NA
WP_122895599.1|3274400_3275558_+	iron uptake system lipoprotein EfeM	NA	NA	NA	NA	NA
WP_122895600.1|3275576_3276836_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_122895601.1|3277117_3277738_+	DsbA family protein	NA	NA	NA	NA	NA
WP_015250937.1|3277750_3279292_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_003227392.1|3279288_3279597_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_014478351.1|3279998_3280157_-	transcriptional regulator SlrA	NA	NA	NA	NA	NA
WP_014478350.1|3280511_3281183_+	transcriptional regulator SlrC	NA	NA	NA	NA	NA
WP_003227398.1|3281200_3281584_+	GtrA family protein	NA	NA	NA	NA	NA
WP_029318660.1|3281664_3282837_+	galactokinase	NA	NA	NA	NA	NA
WP_108029182.1|3282840_3284382_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_009968363.1|3284452_3284698_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_010886637.1|3285213_3286179_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003227407.1|3286206_3288156_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003227409.1|3288169_3288784_+	Quinol oxidase subunit 3	NA	NA	NA	NA	NA
WP_003227410.1|3288785_3289160_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003227411.1|3289201_3289465_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_014481268.1|3289693_3290839_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003227413.1|3291048_3292230_+	cell shape-determining peptidoglycan glycosyltransferase RodA	NA	NA	NA	NA	NA
WP_014478349.1|3292335_3293085_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_046160976.1|3293258_3294260_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_122895605.1|3294297_3296718_-|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
WP_003222155.1|3297247_3297550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227423.1|3297589_3298420_+	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_015250948.1|3298458_3299229_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_160245469.1|3299530_3300916_+	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_122895606.1|3300912_3302352_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	27.3	9.1e-21
WP_003243437.1|3302445_3302694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014665830.1|3302784_3303600_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_015250953.1|3303791_3304598_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015384978.1|3304611_3305289_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	1.8e-48
WP_160245470.1|3305313_3306684_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_026113672.1|3306852_3307170_+	YwdI family protein	NA	NA	NA	NA	NA
WP_015384975.1|3307189_3308512_+	purine permease	NA	NA	NA	NA	NA
WP_122895608.1|3308573_3308945_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_014478336.1|3308988_3309534_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_029946239.1|3309853_3310624_+|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
>prophage 13
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	3314112	3369055	4281863	bacteriocin,tRNA,coat,protease	Enterobacteria_phage(20.0%)	55	NA	NA
WP_015384970.1|3314112_3315234_+|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_122895613.1|3315226_3315949_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_122895614.1|3315951_3316971_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_017696230.1|3316995_3317736_+	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	42.0	7.7e-48
WP_122895615.1|3317735_3318683_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	5.7e-72
WP_122895616.1|3318696_3319548_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.3	1.7e-38
WP_014481242.1|3319540_3319996_+|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_122895617.1|3320319_3320784_+	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_122895618.1|3320959_3322234_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_122895619.1|3322460_3324008_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_122895620.1|3324081_3325782_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_015250969.1|3325781_3327194_+	amino acid permease	NA	NA	NA	NA	NA
WP_160245471.1|3327402_3328641_+	MFS transporter	NA	NA	NA	NA	NA
WP_122895622.1|3328792_3329407_+	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_003244300.1|3329396_3330104_+	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_070549230.1|3330106_3330868_+	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.2e-21
WP_003242921.1|3330886_3332305_+	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_122895623.1|3332301_3333486_+	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_122895624.1|3333486_3334686_+	transaminase BacF	NA	NA	NA	NA	NA
WP_122895625.1|3334701_3335481_-	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_122895626.1|3335613_3336378_-	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_003235941.1|3336647_3337619_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_014481233.1|3337764_3338664_+	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_122895627.1|3338712_3339558_+	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_122895628.1|3339725_3340616_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003227516.1|3340759_3341536_-	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_003222050.1|3341750_3341975_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_015250978.1|3342136_3343438_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003227524.1|3343473_3343974_+	YwgA family protein	NA	NA	NA	NA	NA
WP_017696247.1|3344086_3344557_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_029318685.1|3344556_3345966_+	MFS transporter	NA	NA	NA	NA	NA
WP_019716087.1|3346037_3346181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160245472.1|3346543_3348460_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.0	6.2e-142
WP_003242889.1|3348579_3348999_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003222038.1|3349041_3349230_-	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003243167.1|3349338_3349998_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_015250981.1|3350011_3350530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015384942.1|3350822_3352898_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003227543.1|3353100_3353931_+	spermidine synthase	NA	NA	NA	NA	NA
WP_042975442.1|3353991_3354864_+	agmatinase	NA	NA	NA	NA	NA
WP_009968329.1|3355455_3355575_-	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_160245473.1|3355558_3356704_-	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.2	8.5e-78
WP_122895636.1|3356933_3358289_+	YncE family protein	NA	NA	NA	NA	NA
WP_122895637.1|3358327_3359704_+	YncE family protein	NA	NA	NA	NA	NA
WP_015250988.1|3359709_3360411_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_032722698.1|3360407_3361688_-	insulinase family protein	NA	NA	NA	NA	NA
WP_072175642.1|3361692_3362853_-	insulinase family protein	NA	NA	NA	NA	NA
WP_160245474.1|3362842_3364153_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_029726076.1|3364145_3364865_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	5.6e-19
WP_003222006.1|3364861_3365023_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_015714887.1|3365035_3366382_-	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_010886632.1|3366406_3366559_-|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_003222002.1|3366515_3366647_-|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003243604.1|3366959_3367388_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003227570.1|3367384_3369055_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	3747108	3754843	4281863	holin	Anomala_cuprea_entomopoxvirus(50.0%)	9	NA	NA
WP_003243370.1|3747108_3748251_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
WP_160245517.1|3748273_3748927_+|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_160245588.1|3748946_3749858_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160245518.1|3749875_3750550_+|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_014478002.1|3750581_3751115_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160245519.1|3751398_3752544_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.3	6.0e-15
WP_017695164.1|3752560_3753214_+|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_017695163.1|3753225_3754146_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017695162.1|3754162_3754843_+|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
>prophage 15
NZ_CP028202	Bacillus subtilis strain SRCM102754 chromosome, complete genome	4281863	4027729	4081424	4281863	transposase,coat,holin	Bacillus_phage(20.0%)	47	NA	NA
WP_122895851.1|4027729_4028919_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	1.6e-31
WP_003243556.1|4029019_4029565_-	biofilm-surface layer protein BslA	NA	NA	NA	NA	NA
WP_015251366.1|4029761_4030304_-	transcriptional regulator GbsR	NA	NA	NA	NA	NA
WP_153529864.1|4030502_4031975_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_129110627.1|4031991_4033200_+|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_014477775.1|4033287_4033866_+	molybdenum cofactor sulfurase	NA	NA	NA	NA	NA
WP_160245592.1|4033871_4034360_-	DinB family protein	NA	NA	NA	NA	NA
WP_072175167.1|4034527_4035052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072175124.1|4035070_4036600_+	flotillin lipid rafts scaffold protein FloT	NA	A0A2I2L4B2	Orpheovirus	27.5	2.7e-07
WP_003228963.1|4036617_4037139_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003228966.1|4037180_4037759_-	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_029318314.1|4045424_4047308_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_003229018.1|4047304_4048447_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_004398841.1|4048470_4049502_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_122895719.1|4049498_4050953_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_122895720.1|4050939_4053336_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.2e-12
WP_003229024.1|4053366_4053834_-	TspO/MBR family protein	NA	NA	NA	NA	NA
WP_082090411.1|4053913_4054987_-|coat	spore coat kinase CotI	coat	NA	NA	NA	NA
WP_046160770.1|4055176_4056310_+|coat	spore coat protein CotSA	coat	NA	NA	NA	NA
WP_122895721.1|4056324_4057380_+|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_122895722.1|4057381_4057834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122895723.1|4057907_4059131_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_042977518.1|4059133_4060084_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.9	8.4e-31
WP_122895724.1|4060080_4061367_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.8	2.3e-71
WP_003229044.1|4061538_4062357_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	8.2e-51
WP_029727104.1|4062365_4063085_-	yteA family sporulation protein	NA	NA	NA	NA	NA
WP_015251378.1|4063374_4064790_+	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_015714576.1|4064786_4066529_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_015714575.1|4066516_4067341_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_003229054.1|4067375_4068191_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_122895725.1|4068281_4069742_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	33.1	1.0e-75
WP_003229057.1|4069738_4070854_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_003229060.1|4071133_4072054_+	manganese ABC transporter substrate-binding protein/adhesin MntA	NA	NA	NA	NA	NA
WP_017695441.1|4072072_4072825_+	manganese ABC transporter ATP-binding protein MntB	NA	A0A1V0SE00	Indivirus	27.1	6.0e-16
WP_122895726.1|4072830_4074138_+	manganese ABC transporter permease MntC	NA	NA	NA	NA	NA
WP_003229067.1|4074127_4075015_+	manganese ABC transporter permease MntD	NA	NA	NA	NA	NA
WP_003229069.1|4075033_4075192_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_014480631.1|4075245_4076286_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003229073.1|4076328_4077660_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003219346.1|4077865_4078114_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_014477744.1|4078207_4078771_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003229076.1|4078767_4078995_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	2.8e-25
WP_003219361.1|4079123_4079597_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_014480629.1|4079716_4080154_+	FixH family protein	NA	NA	NA	NA	NA
WP_010886599.1|4080147_4080324_-	YtzI protein	NA	NA	NA	NA	NA
WP_003229083.1|4080416_4080854_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	1.3e-47
WP_003229085.1|4081019_4081424_+|holin	holin family protein	holin	NA	NA	NA	NA
