The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	0	46106	2752646	holin,tail,portal,integrase,head,terminase,capsid,protease	Staphylococcus_phage(93.75%)	48	40241:40257	47676:47692
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000642727.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	99.6	4.0e-129
WP_000154559.1|3609_4755_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114226.1|5675_6080_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268735.1|6484_7129_+|tail	phage tail protein	tail	A0EWZ9	Staphylococcus_phage	100.0	3.8e-120
WP_071621395.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_160203704.1|8039_12572_+|tail	phage tail tape measure protein	tail	A0A075M036	Staphylococcus_phage	99.1	0.0e+00
WP_000567393.1|12568_14053_+|tail	phage tail protein	tail	A0A075LZV5	Staphylococcus_phage	100.0	5.3e-298
WP_000582184.1|14068_17854_+	hypothetical protein	NA	D2JLF9	Staphylococcus_phage	97.8	0.0e+00
WP_000654329.1|17843_17996_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	98.0	1.2e-19
WP_001040255.1|18042_18330_+	hypothetical protein	NA	A0A075LZJ6	Staphylococcus_phage	100.0	5.8e-44
WP_000340977.1|18385_18760_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_000034846.1|19171_19954_+	staphylococcal enterotoxin type P	NA	A0A075M4C7	Staphylococcus_phage	99.6	1.6e-149
WP_011447039.1|20156_20333_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_031762631.1|20385_20493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|20544_20799_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|20810_21566_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000920038.1|21756_22248_+	staphylokinase	NA	A0A1W6JQ12	Staphylococcus_phage	99.4	4.7e-86
WP_001110820.1|22937_23234_+	peptidoglycan hydrolase	NA	A0A1P8L6B4	Staphylococcus_phage	95.9	1.6e-49
WP_000702263.1|23744_24095_+	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|24147_24408_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669791.1|24718_24898_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	98.3	1.4e-24
WP_000669720.1|25855_27910_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_001068542.1|28233_29520_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|29719_29818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681968.1|30060_30237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|30495_30876_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991302.1|30872_31769_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645727.1|31769_32450_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|32446_33319_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
WP_001221651.1|33318_34059_+	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
WP_000182842.1|34124_34688_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000966288.1|34808_35333_+	membrane protein	NA	NA	NA	NA	NA
WP_001033971.1|35392_35950_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000713072.1|35946_36789_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_001188077.1|36845_37886_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_000267034.1|38336_38510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000289000.1|39533_40685_+|integrase	tyrosine-type recombinase/integrase	integrase	P97010	Streptococcus_pyogenes_phage	31.6	1.8e-11
40241:40257	attL	AATAGTTTTGAAAAATA	NA	NA	NA	NA
WP_002457928.1|40723_42751_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000410572.1|42759_43125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080009663.1|44541_44961_-	hypothetical protein	NA	U3PG23	Staphylococcus_phage	50.4	3.2e-27
WP_000733625.1|45260_46106_-	penicillin-hydrolyzing class A beta-lactamase BlaZ	NA	A0A1B0VBP7	Salmonella_phage	34.3	3.4e-31
47676:47692	attR	AATAGTTTTGAAAAATA	NA	NA	NA	NA
>prophage 2
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	52727	54757	2752646		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|52727_53288_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275730.1|53659_54757_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	1.9e-47
>prophage 3
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	58787	61071	2752646		Bacillus_virus(100.0%)	2	NA	NA
WP_000284431.1|58787_60257_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	4.5e-108
WP_000040873.1|60249_61071_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	1.8e-69
>prophage 4
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	64773	71540	2752646		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|64773_66069_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|66177_66480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272070.1|66651_67344_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992921.1|67340_69533_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774565.1|69536_71540_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	5.8e-114
>prophage 5
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	78657	83686	2752646		Catovirus(33.33%)	5	NA	NA
WP_001231451.1|78657_79605_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-16
WP_001147868.1|79685_81047_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.8	1.1e-103
WP_000548781.1|81216_81747_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140176.1|81993_83064_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613733.1|83131_83686_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	36.3	9.2e-30
>prophage 6
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	87137	87551	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001549145.1|87137_87551_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	37.7	5.1e-17
>prophage 7
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	92720	93350	2752646		Bacillus_phage(100.0%)	1	NA	NA
WP_000153530.1|92720_93350_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 8
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	108834	110571	2752646		Bacillus_phage(100.0%)	1	NA	NA
WP_000597238.1|108834_110571_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 9
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	127099	127828	2752646		Planktothrix_phage(100.0%)	1	NA	NA
WP_001144055.1|127099_127828_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
>prophage 10
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	138664	139009	2752646		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|138664_139009_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 11
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	148481	149222	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216878.1|148481_149222_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 12
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	158103	221868	2752646	protease,transposase	Staphylococcus_phage(92.16%)	63	NA	NA
WP_000206350.1|158103_158892_-	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	95.8	5.3e-140
WP_001790220.1|158904_159444_-	hypothetical protein	NA	Q4ZCB9	Staphylococcus_virus	76.8	2.0e-61
WP_000473596.1|160243_161179_+	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	1.4e-174
WP_000782464.1|161180_162164_+	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.1	2.3e-185
WP_000416759.1|162405_162549_+	gallidermin/nisin family lantibiotic	NA	NA	NA	NA	NA
WP_000416756.1|163285_163429_+	gallidermin/nisin family lantibiotic	NA	A0A2H4PQH4	Staphylococcus_phage	80.9	5.3e-14
WP_001092605.1|163493_166487_+	lantibiotic dehydratase	NA	A0A2H4PQG8	Staphylococcus_phage	97.3	0.0e+00
WP_000566596.1|166479_167724_+	lanthionine synthetase C family protein	NA	A0A2H4PQH9	Staphylococcus_phage	100.0	5.1e-238
WP_000504439.1|167739_168258_+	enterotoxin	NA	A0A2H4PQG9	Staphylococcus_phage	100.0	2.0e-95
WP_000691541.1|168267_169641_+	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	100.0	2.9e-258
WP_001096791.1|169663_170356_+	lantibiotic protection ABC transporter ATP-binding subunit	NA	A0A2H4PQG7	Staphylococcus_phage	100.0	6.2e-124
WP_000581553.1|170352_171114_+	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	A0A2H4PQH2	Staphylococcus_phage	99.6	1.7e-130
WP_000586140.1|171110_171809_+	hypothetical protein	NA	A0A2H4PQH0	Staphylococcus_phage	94.4	3.8e-113
WP_001092766.1|172282_172849_-	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	99.5	9.5e-99
WP_001039435.1|173812_174520_+|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	100.0	2.6e-130
WP_001039447.1|174644_175367_+|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	99.6	2.4e-131
WP_001038867.1|175424_176144_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	99.2	1.2e-130
WP_001038688.1|176264_176984_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	100.0	1.1e-131
WP_001791797.1|177048_177183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001793440.1|177163_178903_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	2.4e-289
WP_002868972.1|185590_185950_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001791893.1|186297_186399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001801861.1|186521_186617_-	type I toxin-antitoxin system Fst family toxin PepA1	NA	NA	NA	NA	NA
WP_001549059.1|186819_186963_+|transposase	transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	100.0	6.4e-20
WP_000070811.1|187566_187950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000375476.1|187960_188137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000809857.1|188138_188324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000494956.1|188437_189079_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	93.2	2.6e-76
WP_000414205.1|189296_189848_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.1	1.0e-20
WP_000627551.1|189945_190290_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	92.0	6.3e-53
WP_000669046.1|190330_190957_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	82.7	7.1e-79
WP_000070653.1|191032_192028_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	96.4	7.1e-73
WP_001795535.1|192108_192759_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	2.7e-44
WP_011443643.1|193061_193517_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	98.6	3.0e-79
WP_000348360.1|193675_195154_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.0	2.0e-281
WP_000778525.1|195158_196160_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.9	2.2e-186
WP_000718107.1|196156_196414_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672014.1|196479_196953_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	4.7e-83
WP_002868962.1|196957_197704_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.4	7.1e-142
WP_000093392.1|198078_198564_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
WP_000109906.1|198699_200292_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
WP_000933822.1|200662_201856_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
WP_000366154.1|201980_202889_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	98.7	3.2e-136
WP_000453320.1|203100_203934_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	98.6	9.6e-156
WP_000623472.1|206017_206371_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	88.0	6.5e-13
WP_001200542.1|206367_206733_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091445.1|206988_207291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|207550_208264_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_001168904.1|208633_209269_-|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_001030465.1|209564_210008_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	85.0	3.0e-55
WP_001153742.1|209994_210438_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671052.1|210550_211021_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	99.4	1.0e-82
WP_000384171.1|211219_211444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|211719_212574_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000163235.1|212868_213264_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	100.0	6.3e-73
WP_000989121.1|213281_214574_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
WP_000221180.1|214573_214888_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	99.0	9.8e-53
WP_001261681.1|215410_216913_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	100.0	2.3e-30
WP_000384180.1|217405_218437_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	99.1	2.4e-196
WP_000493892.1|218443_219076_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.5	1.7e-112
WP_001159022.1|219086_220268_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
WP_001008551.1|220280_220745_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	99.4	5.8e-70
WP_001196354.1|220866_221868_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.7	9.0e-185
>prophage 13
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	225028	239142	2752646	tRNA	Staphylococcus_phage(100.0%)	7	NA	NA
WP_000764419.1|225028_225592_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
WP_000526539.1|225588_226542_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_001025061.1|226651_227833_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	100.0	5.6e-218
WP_001108734.1|228123_230538_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.3	0.0e+00
WP_000836465.1|230559_230871_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	100.0	1.6e-52
WP_160203708.1|231196_237757_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	98.2	6.8e-305
WP_000285019.1|237873_239142_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	100.0	4.1e-57
>prophage 14
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	250794	256122	2752646		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|250794_251652_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048368.1|251680_252277_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000118293.1|252297_256122_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 15
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	265027	266734	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862083.1|265027_266734_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	100.0	1.2e-274
>prophage 16
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	273350	275981	2752646	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|273350_274613_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279338.1|274706_275981_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 17
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	279750	283885	2752646		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808845.1|279750_281355_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291430.1|281341_282502_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553926.1|282615_283062_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174282.1|283141_283885_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.0	4.9e-18
>prophage 18
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	301425	304623	2752646		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226911.1|301425_304623_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	1.3e-136
>prophage 19
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	309556	311314	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232648.1|309556_311314_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
>prophage 20
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	318175	326339	2752646		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080028.1|318175_318880_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_011443641.1|318879_320541_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_000849439.1|321039_322527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038308.1|322820_325451_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_001114452.1|325466_326339_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.0e-42
>prophage 21
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	330253	341406	2752646	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|330253_331174_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_001790562.1|331266_331389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|331586_333524_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049154.1|333949_335443_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791162.1|335671_336199_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_001125540.1|336227_336428_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|336474_336831_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032659.1|336972_337581_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.5	1.9e-20
WP_001280018.1|337599_338529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|338533_338644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127573.1|338691_339993_+	trigger factor	NA	NA	NA	NA	NA
WP_000472302.1|340143_341406_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.0	5.0e-140
>prophage 22
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	350973	353604	2752646	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000425353.1|350973_353604_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.7	3.7e-153
>prophage 23
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	363471	398851	2752646	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|363471_364476_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019172.1|364477_365503_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|365525_366665_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|366683_366944_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_050958320.1|367218_369498_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000594993.1|369700_371974_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.8	1.2e-62
WP_000364542.1|371995_372514_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058583.1|372941_375131_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869983.1|375142_375595_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|375591_376467_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590826.1|376927_378190_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044799.1|378205_379972_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001790559.1|380304_380433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682646.1|380432_381206_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102735.1|381366_382641_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.7	1.8e-105
WP_000704122.1|382725_383148_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|383247_383430_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000009238.1|383469_383616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985886.1|383852_384866_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409167.1|385177_386320_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000066097.1|386320_387439_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567028.1|387900_388569_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001283311.1|388570_391048_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_000734064.1|391390_394021_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|394083_394344_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939057.1|394347_394776_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|394790_395099_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342266.1|395383_396022_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137775.1|396024_396948_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|396959_398228_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|398227_398851_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 24
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	405523	407910	2752646		Lactococcus_phage(50.0%)	2	NA	NA
WP_000542309.1|405523_406744_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	33.3	5.0e-52
WP_001548981.1|407157_407910_+	enterotoxin	NA	A0EX09	Staphylococcus_phage	39.8	4.6e-48
>prophage 25
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	415179	421343	2752646		Bacillus_phage(33.33%)	5	NA	NA
WP_000439693.1|415179_415641_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_000953300.1|415699_417847_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	1.2e-32
WP_001282562.1|417903_418878_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|418922_419174_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368341.1|419519_421343_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 26
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	424834	427942	2752646		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|424834_426667_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_001119021.1|426802_427942_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
>prophage 27
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	434412	435360	2752646		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|434412_435360_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 28
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	438413	452141	2752646	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|438413_439805_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001789866.1|440139_440763_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411299.1|440773_441592_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001556038.1|441652_443452_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	6.0e-54
WP_001283055.1|443675_444782_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624584.1|444912_445590_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683931.1|445592_446693_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	29.6	5.2e-08
WP_001062180.1|446806_448153_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	33.7	5.3e-55
WP_000924214.1|448162_449053_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
WP_001213908.1|449178_449964_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564316.1|450005_450869_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|450855_451266_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|451541_452141_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 29
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	458314	458938	2752646		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|458314_458938_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 30
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	464482	467294	2752646		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019687.1|464482_465829_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.7	6.3e-64
WP_000202189.1|465821_467294_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.3	6.2e-81
>prophage 31
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	474794	481365	2752646		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|474794_476132_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159865.1|476124_476355_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183378.1|476332_477214_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	26.1	8.9e-11
WP_001124985.1|477645_478098_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942211.1|478113_479793_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291535.1|479943_481365_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	5.1e-40
>prophage 32
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	488194	489601	2752646		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|488194_489601_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 33
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	494247	495732	2752646		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|494247_495732_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 34
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	499261	510875	2752646		Klosneuvirus(16.67%)	12	NA	NA
WP_001171351.1|499261_500170_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.5	3.4e-05
WP_000365246.1|500251_500794_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000392691.1|500898_501348_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000447733.1|501396_502284_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_160203711.1|502361_502868_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273371.1|502959_503691_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	7.9e-05
WP_000368653.1|503683_504226_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|504218_504956_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|505088_505814_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987772.1|505794_507546_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
WP_001838558.1|507790_508720_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001033768.1|508712_510875_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	97.5	1.1e-107
>prophage 35
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	515253	517932	2752646		Bacillus_phage(50.0%)	3	NA	NA
WP_001151997.1|515253_515502_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163801.1|515609_516563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902119.1|516552_517932_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.6	2.9e-56
>prophage 36
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	527356	532823	2752646		Bacillus_phage(25.0%)	7	NA	NA
WP_001043863.1|527356_527629_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450553.1|528059_528632_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774684.1|528634_529360_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001817755.1|529376_530321_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|530412_530862_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_000789522.1|531070_531271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001269929.1|531656_532823_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.1	7.6e-34
>prophage 37
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	536485	537061	2752646		Bacillus_virus(100.0%)	1	NA	NA
WP_000005213.1|536485_537061_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.7e-08
>prophage 38
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	540431	547937	2752646	tRNA	unidentified_phage(25.0%)	5	NA	NA
WP_000361544.1|540431_541634_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	42.5	3.2e-35
WP_000049919.1|541620_542592_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525078.1|542615_545309_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858789.1|545630_546923_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	1.9e-54
WP_000362212.1|547250_547937_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
>prophage 39
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	551677	552304	2752646		Bacillus_phage(100.0%)	1	NA	NA
WP_001108889.1|551677_552304_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 40
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	561629	562508	2752646		Bacillus_phage(100.0%)	1	NA	NA
WP_001133011.1|561629_562508_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	6.2e-20
>prophage 41
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	601188	610578	2752646		Staphylococcus_phage(60.0%)	13	NA	NA
WP_000282171.1|601188_601893_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
WP_001795441.1|602137_602332_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000691942.1|602343_602595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404650.1|602632_603757_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995287.1|603772_604210_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934885.1|604633_605590_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|605789_606269_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166059.1|606283_607123_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	77.3	2.3e-48
WP_000159902.1|607208_607742_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913315.1|607734_608163_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473652.1|608174_608675_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|608674_608896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342125.1|609087_610578_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	2.3e-22
>prophage 42
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	613986	615998	2752646		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|613986_614646_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166801.1|614642_615998_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 43
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	622163	622955	2752646		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|622163_622955_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 44
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	627435	632466	2752646	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138402.1|627435_628572_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	3.3e-34
WP_001788788.1|628603_629233_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|629251_629521_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|629683_629992_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|630162_630363_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876201.1|630559_630961_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216946.1|631200_632466_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	6.2e-13
>prophage 45
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	640310	641912	2752646		Klosneuvirus(100.0%)	1	NA	NA
WP_000942300.1|640310_641912_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 46
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	646997	650451	2752646		Indivirus(50.0%)	3	NA	NA
WP_160203715.1|646997_647849_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.2	4.4e-15
WP_000974847.1|647855_648497_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077571.1|648636_650451_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.1	5.1e-154
>prophage 47
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	653865	654567	2752646		Tupanvirus(100.0%)	1	NA	NA
WP_000571258.1|653865_654567_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	1.5e-13
>prophage 48
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	662081	664436	2752646		Acinetobacter_phage(100.0%)	3	NA	NA
WP_000154116.1|662081_662864_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.3	1.2e-27
WP_000173832.1|662865_663864_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	35.3	3.8e-34
WP_000604817.1|663869_664436_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
>prophage 49
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	668754	670017	2752646		Bacillus_phage(100.0%)	1	NA	NA
WP_000283015.1|668754_670017_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.1	2.2e-95
>prophage 50
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	679676	684070	2752646		Bacillus_phage(50.0%)	2	NA	NA
WP_001289569.1|679676_682079_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	1.8e-93
WP_001548666.1|682078_684070_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 51
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	690006	691653	2752646		Vibrio_phage(100.0%)	1	NA	NA
WP_160203717.1|690006_691653_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.2	4.2e-22
>prophage 52
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	695322	696444	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691284.1|695322_696444_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 53
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	700594	706250	2752646		Phage_Wrath(25.0%)	7	NA	NA
WP_001208760.1|700594_701218_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
WP_000380731.1|701597_702461_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	4.1e-16
WP_001791425.1|702534_702639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688126.1|702635_703613_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	100.0	2.1e-186
WP_001085655.1|703769_704039_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|704492_704642_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000082539.1|704732_706250_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
>prophage 54
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	716386	720662	2752646		Bacillus_phage(50.0%)	6	NA	NA
WP_000841351.1|716386_716920_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|717058_717247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202390.1|717359_717962_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670300.1|717958_719050_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603968.1|719053_719785_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000593436.1|719753_720662_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	3.1e-22
>prophage 55
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	725210	731635	2752646		Staphylococcus_phage(66.67%)	14	NA	NA
WP_000900530.1|725210_725501_-	hypothetical protein	NA	S6B1L4	Thermus_phage	35.1	5.4e-05
WP_000600812.1|725928_726066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000903039.1|726062_726329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001790531.1|726448_726571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000906224.1|726605_726854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000899337.1|726974_727559_-	hypothetical protein	NA	Q4ZE35	Staphylococcus_virus	72.0	2.0e-30
WP_000956747.1|727604_727856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791646.1|727856_728030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477492.1|727984_728089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000006110.1|728600_728786_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_001788716.1|729213_729324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002340.1|730024_730231_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	59.7	1.3e-13
WP_001789892.1|730524_730749_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	71.0	4.3e-18
WP_001789891.1|731437_731635_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
>prophage 56
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	736704	737181	2752646		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|736704_737181_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 57
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	743123	749595	2752646		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103743.1|743123_743942_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
WP_001077635.1|744406_744949_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516259.1|744954_746964_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	4.8e-60
WP_000073352.1|746976_749595_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	8.5e-41
>prophage 58
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	759009	760053	2752646		Bacillus_phage(100.0%)	1	NA	NA
WP_160203719.1|759009_760053_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	4.2e-124
>prophage 59
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	764254	769798	2752646		Bacillus_virus(33.33%)	4	NA	NA
WP_000664766.1|764254_765541_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
WP_000089940.1|765540_766806_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.5	7.7e-40
WP_001293307.1|766836_767550_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001806691.1|767554_769798_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 60
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	774938	786751	2752646	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864185.1|774938_775910_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282305.1|775924_776842_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|777010_777361_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043634.1|777746_779864_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020853.1|779868_780186_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|780182_780467_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097466.1|780487_781663_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036631.1|781683_782151_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001820550.1|782440_786751_-	DNA polymerase III subunit alpha	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 61
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	791049	791820	2752646		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|791049_791820_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 62
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	796594	810265	2752646	protease,tRNA	Erwinia_phage(16.67%)	11	NA	NA
WP_000379054.1|796594_797998_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	4.9e-27
WP_000072681.1|798063_798609_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015597.1|798605_799502_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.5	3.6e-31
WP_000195254.1|799918_801226_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001548566.1|801381_803457_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000593193.1|803630_804503_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000672867.1|804675_805920_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_001041662.1|805947_807066_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000110253.1|807292_808201_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_001020801.1|808222_809389_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_053868557.1|809497_810265_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	1.9e-25
>prophage 63
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	823649	825707	2752646		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|823649_824381_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|824496_824730_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|824972_825707_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 64
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	836077	838072	2752646		Moumouvirus(100.0%)	1	NA	NA
WP_000579564.1|836077_838072_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 65
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	841219	842155	2752646	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161299.1|841219_842155_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.9	1.2e-10
>prophage 66
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	847167	849424	2752646		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|847167_848367_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|848582_848801_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368227.1|848800_849424_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.7	3.6e-22
>prophage 67
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	852738	853350	2752646		Pandoravirus(100.0%)	1	NA	NA
WP_001040245.1|852738_853350_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	6.2e-27
>prophage 68
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	857317	861928	2752646		Halovirus(33.33%)	4	NA	NA
WP_001190913.1|857317_858418_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
WP_000767028.1|858419_859694_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|859711_860593_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178619.1|860620_861928_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 69
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	866391	869145	2752646	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384691.1|866391_869145_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 70
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	888735	888924	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245802.1|888735_888924_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	86.9	3.8e-20
>prophage 71
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	897895	899855	2752646		Staphylococcus_phage(100.0%)	3	NA	NA
WP_001802045.1|897895_898120_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
WP_000765708.1|898076_898223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160203724.1|898895_899855_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	29.9	2.8e-34
>prophage 72
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	913898	918456	2752646		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|913898_914213_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249285.1|914385_916734_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.3	1.1e-15
WP_000161942.1|916743_918456_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	8.9e-15
>prophage 73
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	923197	924256	2752646	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003559.1|923197_924256_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 74
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	936203	939111	2752646		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|936203_936686_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263796.1|936687_937230_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|937299_937689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|937691_937946_-	YlbG family protein	NA	NA	NA	NA	NA
WP_160203725.1|938184_939111_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	25.8	3.8e-12
>prophage 75
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	950628	952476	2752646		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000182654.1|950628_952476_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 76
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	960611	969444	2752646		Mycoplasma_phage(25.0%)	9	NA	NA
WP_000433551.1|960611_961706_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020625.1|961718_962258_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000455597.1|962401_962677_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|962844_964251_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000863441.1|964254_965547_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_000068176.1|965637_966615_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000035320.1|966618_967731_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000668339.1|967901_968528_-	cell-wall-binding lipoprotein	NA	NA	NA	NA	NA
WP_000957036.1|968892_969444_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 77
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	975558	979938	2752646		Bacillus_virus(50.0%)	5	NA	NA
WP_001289614.1|975558_975792_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
WP_000040054.1|976028_977747_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|977749_978016_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505965.1|978169_978712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685079.1|978765_979938_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	9.0e-75
>prophage 78
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	983117	997877	2752646		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921968.1|983117_984518_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273253.1|984510_985317_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101908.1|985581_986829_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709290.1|986850_988329_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	9.2e-77
WP_000238664.1|988343_988910_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
WP_000030812.1|988912_989941_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	1.3e-61
WP_000483713.1|989933_991418_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	3.2e-45
WP_000032728.1|991396_993586_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	1.3e-140
WP_000666799.1|993578_994250_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000848350.1|994251_994515_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174053.1|994514_995219_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
WP_001010412.1|995222_996347_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861572.1|996333_996816_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
WP_160203726.1|997016_997877_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	6.9e-40
>prophage 79
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1008274	1012045	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160203728.1|1008274_1012045_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.1e-54
>prophage 80
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1015711	1016722	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000676548.1|1015711_1016722_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	32.3	6.2e-16
>prophage 81
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1025028	1025319	2752646		Enterococcus_phage(100.0%)	1	NA	NA
WP_001788574.1|1025028_1025319_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
>prophage 82
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1029882	1030524	2752646		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571179.1|1029882_1030524_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	2.2e-19
>prophage 83
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1040719	1045930	2752646	protease	Pithovirus(33.33%)	3	NA	NA
WP_000455278.1|1040719_1043044_-|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.8e-11
WP_000928412.1|1043262_1044066_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049959.1|1044367_1045930_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	4.9e-36
>prophage 84
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1064857	1066666	2752646		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082731.1|1064857_1066666_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.4	9.3e-47
>prophage 85
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1073461	1074448	2752646		Bacillus_virus(100.0%)	1	NA	NA
WP_001067038.1|1073461_1074448_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.4	1.0e-15
>prophage 86
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1078099	1080113	2752646		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000786734.1|1078099_1079041_-	ATP-binding cassette domain-containing protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	1.6e-05
WP_000140050.1|1079030_1080113_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
>prophage 87
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1088708	1095518	2752646		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619365.1|1088708_1089854_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	2.5e-05
WP_001047066.1|1089963_1090833_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353955.1|1090891_1093501_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044214.1|1093703_1095518_-	O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	1.1e-36
>prophage 88
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1100635	1104289	2752646		Bacillus_phage(100.0%)	1	NA	NA
WP_160203732.1|1100635_1104289_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.7	1.2e-24
>prophage 89
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1114443	1121602	2752646		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000185326.1|1114443_1115373_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.7	4.0e-17
WP_160203733.1|1115875_1117120_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_000167314.1|1117228_1118419_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.3e-33
WP_000838037.1|1118726_1119854_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1120215_1120593_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1121008_1121602_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 90
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1131522	1135150	2752646		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009697.1|1131522_1132998_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	6.9e-48
WP_000046076.1|1133128_1134337_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143497.1|1134790_1135150_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 91
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1139193	1141862	2752646		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1139193_1140408_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129653.1|1140404_1141862_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	4.4e-39
>prophage 92
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1154982	1158505	2752646		environmental_halophage(50.0%)	3	NA	NA
WP_000807671.1|1154982_1156224_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.1e-110
WP_000205572.1|1156338_1157646_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1157743_1158505_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 93
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1161991	1163017	2752646		Bacillus_virus(100.0%)	1	NA	NA
WP_000571218.1|1161991_1163017_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	3.9e-26
>prophage 94
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1166273	1171450	2752646		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1166273_1166630_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001190695.1|1166773_1167094_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1167243_1167783_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150017.1|1167865_1168582_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.6	3.0e-17
WP_000974460.1|1168729_1169152_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1169550_1170045_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255561.1|1170199_1170817_+	amino acid transporter	NA	NA	NA	NA	NA
WP_001802951.1|1170889_1171450_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.4	3.8e-31
>prophage 95
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1174855	1176099	2752646		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1174855_1175056_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001548082.1|1175412_1176099_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 96
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1187733	1193884	2752646		Staphylococcus_phage(33.33%)	6	NA	NA
WP_001085185.1|1187733_1188198_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_001050064.1|1188219_1190592_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.2	2.7e-94
WP_001165952.1|1190625_1191366_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000556760.1|1191481_1191715_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|1191781_1192240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1192579_1193884_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 97
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1202941	1208876	2752646		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1202941_1203529_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1204101_1205046_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1205155_1206151_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369722.1|1206147_1207059_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134963.1|1207940_1208876_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 98
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1213266	1216113	2752646		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662681.1|1213266_1216113_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	0.0e+00
>prophage 99
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1219431	1220271	2752646		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000749380.1|1219431_1220271_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 100
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1226349	1232060	2752646		Streptococcus_phage(66.67%)	5	NA	NA
WP_001548033.1|1226349_1227432_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.2	1.3e-43
WP_000686342.1|1227795_1228662_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192947.1|1228805_1229447_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
WP_000258151.1|1229616_1230672_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1230989_1232060_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 101
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1241342	1264793	2752646		uncultured_Caudovirales_phage(35.71%)	19	NA	NA
WP_000616842.1|1241342_1242104_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	8.5e-18
WP_001245579.1|1242100_1243057_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000876321.1|1243043_1244015_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.6	2.1e-138
WP_000499195.1|1244053_1244209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562498.1|1244610_1245582_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1245699_1247805_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1247767_1248166_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068497.1|1248966_1249833_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|1249852_1250353_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_000193751.1|1250693_1252199_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_001790641.1|1252276_1252378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429014.1|1252468_1253386_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	3.7e-07
WP_000197271.1|1254008_1254551_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663022.1|1254901_1255960_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	27.3	1.1e-20
WP_000180991.1|1256199_1257714_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589260.1|1257706_1258684_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	5.4e-25
WP_000983677.1|1258905_1260687_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525111.1|1260698_1262582_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	2.0e-55
WP_000098285.1|1262852_1264793_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 102
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1267932	1277778	2752646		Pandoravirus(12.5%)	12	NA	NA
WP_001217785.1|1267932_1269084_-	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	35.7	1.6e-23
WP_000604514.1|1269067_1269661_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
WP_160203738.1|1270011_1270680_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.1	1.3e-65
WP_000941336.1|1270681_1271101_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062972.1|1271104_1271818_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000637687.1|1271916_1272501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093553.1|1272780_1273221_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1273562_1274036_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1274010_1274697_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244412.1|1274696_1275752_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.0	2.1e-14
WP_000702782.1|1275823_1276807_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.3	1.5e-62
WP_000931237.1|1276938_1277778_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
>prophage 103
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1289390	1290764	2752646		Bandra_megavirus(100.0%)	1	NA	NA
WP_000952048.1|1289390_1290764_-	deoxyribodipyrimidine photo-lyase	NA	A0A2K9V7Z5	Bandra_megavirus	29.2	5.6e-44
>prophage 104
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1295741	1302021	2752646		Bacillus_phage(33.33%)	6	NA	NA
WP_000857602.1|1295741_1297415_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	22.9	4.5e-11
WP_000737143.1|1297411_1299043_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.8	6.7e-12
WP_000469890.1|1299261_1300137_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358498.1|1300308_1300992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148828.1|1300994_1301453_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1301454_1302021_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
>prophage 105
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1308949	1309423	2752646		Pandoravirus(100.0%)	1	NA	NA
WP_000833483.1|1308949_1309423_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	2.1e-14
>prophage 106
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1314685	1315483	2752646		Bacillus_phage(100.0%)	1	NA	NA
WP_000731644.1|1314685_1315483_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	1.2e-06
>prophage 107
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1320314	1321076	2752646		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|1320314_1321076_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 108
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1325450	1326494	2752646		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001030771.1|1325450_1326494_-	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-17
>prophage 109
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1333016	1333814	2752646		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1333016_1333814_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 110
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1337039	1340998	2752646		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1337039_1338767_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793070.1|1339187_1340483_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1340599_1340998_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 111
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1347932	1348676	2752646		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|1347932_1348676_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 112
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1359826	1360387	2752646	integrase	Streptococcus_phage(100.0%)	1	1353980:1353994	1363976:1363990
1353980:1353994	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044915.1|1359826_1360387_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
WP_001044915.1|1359826_1360387_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
1363976:1363990	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 113
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1363686	1364475	2752646		Mycobacterium_phage(100.0%)	1	NA	NA
WP_153154990.1|1363686_1364475_-	alpha/beta fold hydrolase	NA	A0A0B5A484	Mycobacterium_phage	34.4	2.9e-05
>prophage 114
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1373458	1376812	2752646		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1373458_1374469_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1374967_1375489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180230.1|1375516_1376812_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	2.1e-24
>prophage 115
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1390361	1391684	2752646		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860582.1|1390361_1391684_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.3	2.2e-109
>prophage 116
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1402989	1403646	2752646		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455256.1|1402989_1403646_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 117
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1407287	1410608	2752646		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001100835.1|1407287_1408664_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	3.9e-21
WP_000347061.1|1409207_1410608_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
>prophage 118
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1434035	1434698	2752646		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067262.1|1434035_1434698_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 119
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1441277	1442465	2752646		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250824.1|1441277_1442465_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	7.5e-45
>prophage 120
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1445493	1456447	2752646		Streptococcus_phage(33.33%)	6	NA	NA
WP_160203740.1|1445493_1447575_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.1e-66
WP_001137495.1|1447697_1448168_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1448233_1448647_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1448744_1448999_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001788197.1|1449135_1452732_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
WP_000918667.1|1452895_1456447_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 121
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1460130	1464913	2752646	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1460130_1460679_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1460691_1460874_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|1460929_1461073_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872873.1|1461187_1461757_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664738.1|1461837_1462362_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390328.1|1462361_1463108_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370182.1|1463115_1463520_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631963.1|1463512_1464913_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	3.2e-55
>prophage 122
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1470924	1473381	2752646	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1470924_1473381_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 123
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1492162	1502434	2752646	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1492162_1493650_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_001790128.1|1493702_1493795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613716.1|1494188_1494665_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|1494661_1495027_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167924.1|1495004_1495808_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.3	1.3e-21
WP_000057594.1|1496023_1496956_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1497134_1498016_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1498244_1500338_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1500594_1501134_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176715.1|1501138_1502434_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	4.8e-13
>prophage 124
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1511690	1514155	2752646		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1511690_1512656_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252529.1|1512802_1514155_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 125
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1520037	1523135	2752646	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_001051116.1|1520037_1522011_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.0	1.2e-92
WP_000279926.1|1522295_1523135_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 126
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1527041	1527659	2752646		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1527041_1527659_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 127
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1536793	1538491	2752646		Streptococcus_virus(100.0%)	1	NA	NA
WP_160203742.1|1536793_1538491_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.0	4.3e-54
>prophage 128
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1555137	1561375	2752646		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170264.1|1555137_1556142_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.2	1.6e-24
WP_000825521.1|1556473_1557316_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467994.1|1557352_1558012_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569286.1|1558015_1559041_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	8.2e-32
WP_001036663.1|1559334_1560477_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000634105.1|1560460_1561375_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.7	6.6e-49
>prophage 129
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1587564	1590325	2752646		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072584.1|1587564_1588776_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.2	2.2e-44
WP_000028628.1|1588768_1590325_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	99.2	6.8e-288
>prophage 130
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1604027	1609477	2752646	transposase	Paenibacillus_phage(25.0%)	5	NA	NA
WP_000159787.1|1604027_1604300_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	50.6	1.3e-13
WP_000041883.1|1604698_1605403_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	37.6	2.6e-29
WP_000551776.1|1605795_1606332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424966.1|1606444_1607986_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1608010_1609477_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 131
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1618437	1619961	2752646		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930486.1|1618437_1619961_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.6	1.9e-40
>prophage 132
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1626155	1634573	2752646	integrase	Staphylococcus_phage(66.67%)	12	1623100:1623114	1645452:1645466
1623100:1623114	attL	AGTAGTAATTGAATA	NA	NA	NA	NA
WP_000237577.1|1626155_1626314_+|integrase	integrase	integrase	Q4ZE80	Staphylococcus_phage	66.7	6.7e-10
WP_001797636.1|1626391_1626703_+|integrase	tyrosine-type recombinase/integrase	integrase	Q4ZE80	Staphylococcus_phage	70.5	5.5e-24
WP_001822249.1|1626741_1627680_+	Abi family protein	NA	NA	NA	NA	NA
WP_000897044.1|1627945_1628188_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_000934799.1|1628239_1628743_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1628763_1629060_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1629303_1629495_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_160203746.1|1629580_1630678_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157345.1|1630689_1630893_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_001077602.1|1630922_1631804_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001550052.1|1631960_1632806_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655692.1|1633469_1634573_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
1645452:1645466	attR	AGTAGTAATTGAATA	NA	NA	NA	NA
>prophage 133
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1644491	1645334	2752646		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209565.1|1644491_1645334_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	7.7e-12
>prophage 134
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1666546	1669281	2752646		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280803.1|1666546_1667569_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	29.7	1.1e-09
WP_001191946.1|1667546_1668491_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449060.1|1668480_1669281_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.9	8.9e-42
>prophage 135
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1687509	1688187	2752646		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911019.1|1687509_1688187_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	9.2e-32
>prophage 136
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1704234	1708674	2752646		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549278.1|1704234_1708674_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	24.3	8.2e-28
>prophage 137
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1720637	1722299	2752646		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_000570071.1|1720637_1721297_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
WP_000736798.1|1721348_1722299_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 138
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1731534	1732971	2752646		Pandoravirus(100.0%)	1	NA	NA
WP_000163988.1|1731534_1732971_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.8	3.7e-30
>prophage 139
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1736731	1741271	2752646		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925394.1|1736731_1738471_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
WP_000608826.1|1738732_1739407_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975357.1|1739546_1741271_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 140
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1750598	1751642	2752646		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645604.1|1750598_1751642_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.6	4.6e-14
>prophage 141
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1758849	1760379	2752646		Vibrio_phage(100.0%)	1	NA	NA
WP_000838204.1|1758849_1760379_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 142
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1769254	1770760	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008401.1|1769254_1770760_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	3.5e-39
>prophage 143
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1781831	1787190	2752646		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1781831_1784081_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837105.1|1784668_1785637_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127982.1|1785633_1787190_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 144
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1797400	1799459	2752646		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818914.1|1797400_1798498_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166917.1|1798880_1799459_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	39.4	9.7e-14
>prophage 145
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1807994	1809587	2752646		Bacillus_virus(100.0%)	1	NA	NA
WP_000067349.1|1807994_1809587_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	6.4e-15
>prophage 146
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1827747	1828932	2752646		Klosneuvirus(100.0%)	1	NA	NA
WP_001084436.1|1827747_1828932_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.2	9.2e-35
>prophage 147
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1833768	1844052	2752646		Tupanvirus(50.0%)	3	NA	NA
WP_000605282.1|1833768_1840944_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.5	1.0e-67
WP_000826862.1|1841390_1842641_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706137.1|1843026_1844052_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 148
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1847590	1850588	2752646		Bacillus_virus(50.0%)	4	NA	NA
WP_000590853.1|1847590_1848331_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	1.5e-38
WP_000171919.1|1848672_1849185_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356963.1|1849363_1849567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013484.1|1849628_1850588_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
>prophage 149
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1853943	1856428	2752646		Catovirus(50.0%)	2	NA	NA
WP_000723454.1|1853943_1855089_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	2.4e-24
WP_000779497.1|1855165_1856428_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	26.0	6.6e-23
>prophage 150
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1863263	1869828	2752646		Catovirus(50.0%)	6	NA	NA
WP_000413171.1|1863263_1864388_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
WP_001028293.1|1864391_1865501_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459054.1|1865513_1866542_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.0	3.3e-41
WP_160203753.1|1866531_1868355_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.1	5.2e-29
WP_000565302.1|1868374_1869139_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037332.1|1869141_1869828_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 151
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1881108	1881882	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078092.1|1881108_1881882_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 152
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1889917	1890517	2752646		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1889917_1890517_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 153
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1895454	1896435	2752646		Catovirus(100.0%)	1	NA	NA
WP_001789408.1|1895454_1896435_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.0	1.0e-47
>prophage 154
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1899805	1901008	2752646		Tupanvirus(100.0%)	1	NA	NA
WP_001223700.1|1899805_1901008_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	20.8	1.1e-08
>prophage 155
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1909274	1913484	2752646		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1909274_1910255_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045111.1|1910485_1911478_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000924997.1|1911493_1912489_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136636.1|1912485_1913484_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.2e-14
>prophage 156
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1950512	1951580	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000816129.1|1950512_1951580_-	persulfide response sulfurtransferase CstA	NA	A0A2H4PQR9	Staphylococcus_phage	41.5	3.5e-09
>prophage 157
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1959172	1969184	2752646		Bacillus_phage(40.0%)	7	NA	NA
WP_000088648.1|1959172_1959973_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	4.6e-38
WP_001104172.1|1960362_1961151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060154.1|1961151_1962486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|1962478_1964305_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000101976.1|1964317_1965019_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095327.1|1966222_1967506_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	2.3e-68
WP_000375647.1|1967783_1969184_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 158
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1975871	1984910	2752646	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884334.1|1975871_1977158_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177464.1|1977536_1979051_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.6	6.8e-91
WP_000449218.1|1979376_1980189_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819084.1|1980275_1982939_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	2.7e-119
WP_000255584.1|1982975_1984910_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	4.4e-143
>prophage 159
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	1994992	1998258	2752646		Faecalibacterium_phage(33.33%)	5	NA	NA
WP_000742837.1|1994992_1995832_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
WP_000491382.1|1996285_1996639_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779136.1|1996706_1997102_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054118.1|1997361_1997931_+	helix-turn-helix domain-containing protein	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|1998057_1998258_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
>prophage 160
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2002558	2003317	2752646		Planktothrix_phage(100.0%)	1	NA	NA
WP_000154162.1|2002558_2003317_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 161
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2017574	2019287	2752646		Planktothrix_phage(100.0%)	1	NA	NA
WP_160203757.1|2017574_2019287_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-20
>prophage 162
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2024916	2025930	2752646		Faustovirus(100.0%)	1	NA	NA
WP_000639183.1|2024916_2025930_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	22.2	2.1e-08
>prophage 163
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2038381	2039074	2752646		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185864.1|2038381_2039074_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	1.7e-28
>prophage 164
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2065175	2067035	2752646		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125611.1|2065175_2067035_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 165
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2092743	2094494	2752646		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143419.1|2092743_2093631_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	2.5e-05
WP_000923760.1|2093738_2094494_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 166
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2097914	2098412	2752646		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|2097914_2098412_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 167
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2103464	2105848	2752646		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071717.1|2103464_2105315_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	1.2e-235
WP_000601724.1|2105311_2105848_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	49.4	8.6e-41
>prophage 168
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2111693	2121807	2752646	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2111693_2113403_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2113680_2113893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708242.1|2114173_2114617_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172340.1|2114810_2116409_+	acetyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
WP_001791775.1|2116468_2116798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2117093_2118590_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_053868499.1|2118782_2119673_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	28.6	1.0e-06
WP_001237629.1|2119795_2120212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030057.1|2120469_2121807_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.0e-18
>prophage 169
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2149358	2154530	2752646	transposase	Staphylococcus_phage(66.67%)	4	NA	NA
WP_001105940.1|2149358_2150033_+|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	87.9	4.8e-113
WP_000751267.1|2150743_2151445_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.4	4.0e-38
WP_000996736.1|2151720_2152209_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000379821.1|2152718_2154530_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 170
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2162963	2166819	2752646		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_000161357.1|2162963_2163962_+	D-lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	33.0	2.6e-35
WP_000076661.1|2164051_2164258_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024127.1|2164410_2166819_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	41.0	4.9e-128
>prophage 171
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2176060	2179096	2752646	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001058988.1|2176060_2178166_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.5	3.1e-118
WP_000455987.1|2178574_2179096_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.1	2.0e-26
>prophage 172
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2186979	2193363	2752646		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062658.1|2186979_2188719_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.3	2.7e-35
WP_000473675.1|2189019_2191086_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2191465_2191876_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240662.1|2191917_2192262_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228162.1|2192394_2193363_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	5.2e-12
>prophage 173
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2202949	2203942	2752646		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161536.1|2202949_2203942_-	D-lactate dehydrogenase	NA	M1HYB0	Acanthocystis_turfacea_Chlorella_virus	31.5	1.1e-36
>prophage 174
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2213222	2213918	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382904.1|2213222_2213918_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	3.0e-38
>prophage 175
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2234296	2235163	2752646		Bacillus_phage(100.0%)	1	NA	NA
WP_000721336.1|2234296_2235163_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	1.3e-78
>prophage 176
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2242965	2248146	2752646		Streptococcus_phage(50.0%)	3	NA	NA
WP_001795457.1|2242965_2244774_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	38.1	1.9e-95
WP_000755954.1|2244890_2245283_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_160203767.1|2245284_2248146_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	2.4e-28
>prophage 177
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2254970	2255666	2752646		Bacillus_phage(100.0%)	1	NA	NA
WP_000217466.1|2254970_2255666_+	oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	8.6e-09
>prophage 178
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2269027	2270585	2752646		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173869.1|2269027_2269843_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	1.8e-13
WP_000590516.1|2269835_2270585_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.4	5.3e-20
>prophage 179
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2277718	2282147	2752646		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000923520.1|2277718_2278381_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.2	6.5e-22
WP_000072147.1|2278373_2279150_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001802848.1|2279554_2280733_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700921.1|2280794_2282147_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 180
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2285840	2287699	2752646		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000948981.1|2285840_2287067_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
WP_000569120.1|2287063_2287699_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	9.0e-05
>prophage 181
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2305426	2311613	2752646		Bacillus_phage(66.67%)	5	NA	NA
WP_001176863.1|2305426_2306569_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
WP_000779358.1|2306836_2307223_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482650.1|2307356_2307464_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064838.1|2308091_2309855_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	1.5e-36
WP_000486494.1|2309879_2311613_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.0e-31
>prophage 182
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2315073	2320845	2752646		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000671751.1|2315073_2316189_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	1.6e-20
WP_000286875.1|2316199_2316892_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200948.1|2316902_2317370_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_000783428.1|2317421_2318399_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	7.1e-142
WP_000916713.1|2318400_2319348_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.1	1.2e-138
WP_000594519.1|2319915_2320845_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 183
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2328789	2329521	2752646		Bacillus_virus(100.0%)	1	NA	NA
WP_000615461.1|2328789_2329521_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.1e-25
>prophage 184
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2346169	2347729	2752646		Escherichia_phage(100.0%)	1	NA	NA
WP_000692645.1|2346169_2347729_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 185
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2369147	2370182	2752646		Bacillus_virus(100.0%)	1	NA	NA
WP_000655971.1|2369147_2370182_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 186
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2380041	2383938	2752646		Hokovirus(33.33%)	4	NA	NA
WP_000477329.1|2380041_2381415_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	1.3e-13
WP_000249497.1|2381407_2382082_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
WP_000761395.1|2382217_2383273_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229911.1|2383272_2383938_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.2e-36
>prophage 187
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2388517	2389726	2752646		Salmonella_phage(100.0%)	1	NA	NA
WP_000999131.1|2388517_2389726_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	3.9e-33
>prophage 188
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2401820	2402720	2752646		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524836.1|2401820_2402720_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.2	4.2e-16
>prophage 189
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2410092	2410512	2752646		Bacillus_phage(100.0%)	1	NA	NA
WP_000920239.1|2410092_2410512_-	FosB1/FosB3 family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	2.6e-37
>prophage 190
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2416205	2417087	2752646		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730043.1|2416205_2417087_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	2.2e-62
>prophage 191
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2424965	2425601	2752646		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|2424965_2425601_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 192
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2439165	2443146	2752646		Staphylococcus_phage(50.0%)	4	NA	NA
WP_011447058.1|2439165_2439804_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JQU5	Staphylococcus_phage	48.1	2.6e-36
WP_000684141.1|2440114_2441239_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	5.5e-13
WP_000417016.1|2441330_2442284_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.9	2.9e-31
WP_000737705.1|2442645_2443146_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 193
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2447062	2447866	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717381.1|2447062_2447866_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.3e-07
>prophage 194
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2466844	2467450	2752646		Pithovirus(100.0%)	1	NA	NA
WP_000913019.1|2466844_2467450_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 195
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2479534	2482702	2752646		Leptospira_phage(100.0%)	1	NA	NA
WP_000592303.1|2479534_2482702_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	6.2e-62
>prophage 196
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2506165	2507832	2752646		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000389662.1|2506165_2506975_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	2.2e-19
WP_000155386.1|2506971_2507832_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	9.7e-10
>prophage 197
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2513261	2522491	2752646	protease	Vibrio_phage(33.33%)	9	NA	NA
WP_000402465.1|2513261_2514398_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7SAX5	Vibrio_phage	27.0	5.4e-08
WP_001549616.1|2514526_2515933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000655244.1|2516486_2516669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001797632.1|2516650_2516890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130150.1|2517122_2518787_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.7	4.0e-44
WP_000186134.1|2518823_2519528_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_001549607.1|2519891_2520317_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044363.1|2520610_2521426_+	hydrolase	NA	NA	NA	NA	NA
WP_001044432.1|2521636_2522491_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	41.4	3.4e-07
>prophage 198
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2525867	2528962	2752646		Staphylococcus_phage(50.0%)	5	NA	NA
WP_001015500.1|2525867_2526716_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.2	2.0e-44
WP_001549596.1|2526935_2527061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160203778.1|2527322_2527931_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_001791678.1|2528023_2528185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549592.1|2528221_2528962_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.4	7.3e-14
>prophage 199
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2535283	2536696	2752646		Pandoravirus(100.0%)	1	NA	NA
WP_000169220.1|2535283_2536696_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	5.0e-48
>prophage 200
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2540656	2542219	2752646		Vibrio_phage(100.0%)	1	NA	NA
WP_000792334.1|2540656_2542219_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.2	1.2e-18
>prophage 201
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2554376	2555345	2752646		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989091.1|2554376_2555345_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.3e-15
>prophage 202
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2572874	2573783	2752646		Klosneuvirus(100.0%)	1	NA	NA
WP_000167867.1|2572874_2573783_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	3.2e-27
>prophage 203
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2577373	2584810	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001048287.1|2577373_2584810_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	23.5	3.4e-18
>prophage 204
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2591066	2593886	2752646		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334465.1|2591066_2592872_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.6	2.0e-97
WP_000908177.1|2593103_2593886_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	1.7e-08
>prophage 205
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2606549	2610381	2752646		Clostridium_phage(50.0%)	4	NA	NA
WP_000070866.1|2606549_2606993_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_000160304.1|2607113_2607824_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083311.1|2608138_2608801_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242318.1|2609079_2610381_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	2.7e-133
>prophage 206
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2618319	2619930	2752646		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2618319_2619930_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 207
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2627733	2635483	2752646		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2627733_2628333_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460242.1|2628333_2629410_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248735.1|2629396_2630233_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011447046.1|2630265_2631363_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	7.9e-41
WP_000697334.1|2631359_2631779_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654185.1|2631885_2632410_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2632436_2633675_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2633702_2634332_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723418.1|2634355_2635483_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	1.0e-27
>prophage 208
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2645887	2646283	2752646		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000932694.1|2645887_2646283_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 209
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2652453	2653101	2752646		Moumouvirus(100.0%)	1	NA	NA
WP_001187629.1|2652453_2653101_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	6.1e-09
>prophage 210
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2660301	2661822	2752646		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178942.1|2660301_2661822_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 211
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2667509	2669537	2752646		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546584.1|2667509_2669537_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	5.6e-24
>prophage 212
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2674687	2678072	2752646		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621175.1|2674687_2675050_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2675399_2676401_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2676519_2676846_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190829.1|2676847_2677327_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041103.1|2677301_2678072_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 213
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2691755	2696479	2752646		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094576.1|2691755_2693285_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
WP_000214557.1|2693314_2694319_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2694455_2694710_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047820.1|2694709_2696479_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	5.3e-63
>prophage 214
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2700239	2714083	2752646	tRNA	Moraxella_phage(16.67%)	13	NA	NA
WP_000159034.1|2700239_2701265_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	6.9e-63
WP_000106330.1|2701366_2702977_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	26.9	3.3e-19
WP_001790685.1|2703065_2703194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602074.1|2703337_2705266_-	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	30.4	2.4e-53
WP_001283612.1|2705518_2706154_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_072353927.1|2706508_2707537_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581077.1|2707596_2707821_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052270.1|2708027_2709278_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	4.5e-40
WP_000790330.1|2709460_2710411_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000141414.1|2710559_2712044_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.6	4.0e-19
WP_001253312.1|2712040_2713000_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_001790167.1|2713187_2713295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000688492.1|2713366_2714083_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 215
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2721184	2724662	2752646	terminase	uncultured_virus(50.0%)	4	NA	NA
WP_000917289.1|2721184_2721469_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240645.1|2721544_2723161_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
WP_000128898.1|2723862_2724075_+	hypothetical protein	NA	Q4ZE86	Staphylococcus_phage	74.3	1.1e-23
WP_001293058.1|2724071_2724662_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	95.8	1.1e-97
>prophage 216
NZ_CP047849	Staphylococcus aureus strain UP_403 chromosome, complete genome	2752646	2732134	2752176	2752646	integrase	Staphylococcus_phage(97.22%)	37	2734977:2734991	2743668:2743682
WP_000791407.1|2732134_2733190_+	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.8e-35
WP_000595324.1|2733211_2734228_+	bi-component leukocidin LukGH subunit G	NA	A0A2I6PER8	Staphylococcus_phage	29.0	1.1e-25
2734977:2734991	attL	CTATCATTATCGAAT	NA	NA	NA	NA
WP_000857191.1|2735346_2736384_-|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	100.0	9.1e-180
WP_000825947.1|2736442_2736907_-	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
WP_000705248.1|2737006_2737189_-	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
WP_000591749.1|2737392_2737734_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
WP_000759682.1|2737739_2738672_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
WP_001031454.1|2738687_2739401_-	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_061819782.1|2739363_2739513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025404.1|2739577_2739793_+	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	100.0	4.8e-35
WP_000128907.1|2739781_2740111_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
WP_001148605.1|2740161_2740914_+	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_001148862.1|2740929_2741127_+	hypothetical protein	NA	O80075	Staphylococcus_phage	87.7	3.5e-24
WP_000762521.1|2741113_2741494_-	DUF2513 domain-containing protein	NA	Q9T1Z5	Staphylococcus_phage	100.0	1.2e-68
WP_001120201.1|2741548_2741872_+	DUF771 domain-containing protein	NA	A0A075LYF5	Staphylococcus_phage	100.0	3.0e-57
WP_000048129.1|2741868_2742030_+	DUF1270 family protein	NA	A0A1P8L6G0	Staphylococcus_phage	100.0	1.9e-20
WP_000165371.1|2742124_2742427_+	DUF2482 family protein	NA	A0A1P8L6F8	Staphylococcus_phage	100.0	7.0e-48
WP_000291510.1|2742431_2742692_+	DUF1108 family protein	NA	A0A1P8L6F5	Staphylococcus_phage	100.0	5.2e-44
WP_001205732.1|2742700_2742964_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700555.1|2742972_2744916_+	AAA family ATPase	NA	S4V9K6	Staphylococcus_phage	100.0	0.0e+00
2743668:2743682	attR	ATTCGATAATGATAG	NA	NA	NA	NA
WP_160203783.1|2744917_2745838_+	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	99.7	8.6e-166
WP_071665632.1|2745918_2746536_+	MBL fold metallo-hydrolase	NA	A0A0H3U2T4	Staphylococcus_phage	100.0	4.1e-87
WP_000934760.1|2746536_2747007_+	single-stranded DNA-binding protein	NA	A0EWX3	Staphylococcus_phage	99.4	7.4e-81
WP_000148321.1|2747036_2747930_+	DnaD domain-containing protein	NA	A0A2I6PDG7	Staphylococcus_phage	99.3	5.5e-141
WP_000338530.1|2747936_2748155_+	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	100.0	1.0e-37
WP_000401960.1|2748163_2748568_+	RusA family crossover junction endodeoxyribonuclease	NA	A0EWX6	Staphylococcus_phage	100.0	1.9e-72
WP_000101288.1|2748580_2748949_+	hypothetical protein	NA	A0A0H3U2T3	Staphylococcus_phage	100.0	2.0e-49
WP_000131370.1|2748952_2749195_+	hypothetical protein	NA	Q4ZDP7	Staphylococcus_virus	95.0	2.1e-39
WP_001065094.1|2749209_2749458_+	DUF1024 family protein	NA	A0A075LYF1	Staphylococcus_phage	97.6	4.1e-38
WP_001066447.1|2749450_2749987_+	hypothetical protein	NA	A0A0H3U2Z8	Staphylococcus_phage	100.0	7.2e-96
WP_001282074.1|2750023_2750269_+	hypothetical protein	NA	A0A2I6PDW7	Staphylococcus_phage	100.0	5.0e-36
WP_000195803.1|2750265_2750472_+	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_000592207.1|2750468_2750855_+	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	3.0e-64
WP_000595265.1|2750851_2751001_+	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_000265043.1|2751000_2751201_+	DUF1514 domain-containing protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
WP_000590122.1|2751228_2751645_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988336.1|2751876_2752176_+	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
>prophage 1
NZ_CP047850	Staphylococcus aureus strain UP_403 plasmid unnamed, complete sequence	25704	14332	23905	25704	integrase,transposase	Staphylococcus_phage(57.14%)	10	3837:3860	24012:24035
3837:3860	attL	AAGGTTCTGTTGCAAAGTTAGAAA	NA	NA	NA	NA
WP_012816637.1|14332_14941_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	28.7	1.0e-13
WP_000358995.1|15131_15527_-	thioredoxin-dependent arsenate reductase	NA	A0A2H4PQT9	Staphylococcus_phage	86.3	8.5e-62
WP_000153629.1|15544_16834_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	81.8	1.7e-188
WP_000120606.1|16833_17148_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4PQT4	Staphylococcus_phage	74.0	1.6e-39
WP_000633164.1|17208_17544_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001035802.1|17863_18076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105940.1|18110_18785_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	87.9	4.8e-113
WP_160203788.1|18851_19418_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	49.7	3.8e-39
WP_160203789.1|19617_21723_-	AlwI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_012816642.1|21772_23905_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1W6JN66	Lactococcus_phage	43.2	1.2e-61
24012:24035	attR	AAGGTTCTGTTGCAAAGTTAGAAA	NA	NA	NA	NA
