The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	0	35820	2933430	holin,tail,capsid,protease,transposase,portal,terminase,head	Staphylococcus_phage(96.77%)	38	NA	NA
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000154559.1|3609_4755_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114226.1|5675_6080_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268735.1|6484_7129_+|tail	phage tail protein	tail	A0EWZ9	Staphylococcus_phage	100.0	3.8e-120
WP_071621395.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_031880692.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	99.1	2.3e-58
WP_001643732.1|8039_12569_+|tail	phage tail tape measure protein	tail	A0EX03	Staphylococcus_phage	100.0	0.0e+00
WP_000567413.1|12565_14050_+|tail	phage tail protein	tail	A0EX04	Staphylococcus_phage	100.0	4.5e-297
WP_000582190.1|14065_17851_+	hypothetical protein	NA	A0EX05	Staphylococcus_phage	100.0	0.0e+00
WP_001153681.1|17840_17993_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040259.1|18039_18327_+	hypothetical protein	NA	G4KNR2	Staphylococcus_phage	100.0	9.9e-44
WP_000340977.1|18382_18757_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_000750406.1|19177_19951_+	staphylococcal enterotoxin type A	NA	A0EX09	Staphylococcus_phage	100.0	2.2e-146
WP_011447039.1|20059_20236_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_001791821.1|20288_20396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|20447_20702_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|20713_21469_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_160176474.1|21659_22151_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	99.4	1.2e-86
WP_020444758.1|22677_23136_+	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	4.9e-85
WP_000727649.1|23230_23680_-	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_000702263.1|24364_24715_+	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|24767_25028_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|25338_25518_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_000669728.1|26475_28545_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000277741.1|28842_30489_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_001068528.1|30736_32023_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|32222_32321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681966.1|32562_32739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|32996_33377_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991315.1|33373_34270_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645732.1|34270_34951_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|34947_35820_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
>prophage 2
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	41065	41467	2933430		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000205106.1|41065_41467_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
>prophage 3
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	45663	47694	2933430		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|45663_46224_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275719.1|46596_47694_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	8.7e-48
>prophage 4
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	51724	54008	2933430		Bacillus_virus(100.0%)	2	NA	NA
WP_000284434.1|51724_53194_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.5	8.5e-107
WP_000040861.1|53186_54008_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 5
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	57698	64476	2933430		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|57698_58994_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|59102_59405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272063.1|59587_60280_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|60276_62469_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774552.1|62472_64476_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	9.8e-114
>prophage 6
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	71705	76733	2933430		Catovirus(33.33%)	5	NA	NA
WP_001231458.1|71705_72653_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.5e-16
WP_001147874.1|72733_74095_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	43.0	1.5e-102
WP_000548777.1|74264_74795_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140179.1|75041_76112_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|76178_76733_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 7
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	80186	80600	2933430		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001643743.1|80186_80600_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.5	3.0e-17
>prophage 8
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	85580	86210	2933430		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|85580_86210_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 9
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	92239	166586	2933430	holin,integrase,tail,capsid,plate,tRNA,portal,terminase,head	Staphylococcus_phage(64.71%)	88	84081:84098	112473:112490
84081:84098	attL	ATCATCATCTTGTTCGTC	NA	NA	NA	NA
WP_001145722.1|92239_93286_-|integrase	site-specific integrase	integrase	Q4ZB10	Staphylococcus_virus	100.0	5.5e-201
WP_000337827.1|93398_93578_+	hypothetical protein	NA	Q4ZBP0	Staphylococcus_phage	100.0	3.7e-25
WP_000392183.1|93557_94490_-	hypothetical protein	NA	A0EX19	Staphylococcus_virus	100.0	6.7e-174
WP_000775189.1|95460_96135_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	94.6	5.2e-120
WP_001055142.1|96151_96484_-	helix-turn-helix transcriptional regulator	NA	R4IH08	Staphylococcus_phage	98.2	2.0e-56
WP_000108121.1|96746_96941_+	helix-turn-helix transcriptional regulator	NA	A0A0F6N3M9	Staphylococcus_phage	96.9	6.9e-25
WP_031880731.1|96940_97705_+	phage antirepressor KilAC domain-containing protein	NA	R4IFK0	Staphylococcus_phage	98.0	2.6e-139
WP_001148857.1|97721_97916_+	hypothetical protein	NA	A0A1X9H0A2	Staphylococcus_phage	98.4	3.3e-19
WP_000395455.1|98097_98328_-	hypothetical protein	NA	C8CGY3	Staphylococcus_phage	100.0	2.3e-35
WP_000594789.1|98398_98620_+	hypothetical protein	NA	B2ZYU8	Staphylococcus_phage	100.0	8.7e-32
WP_000066011.1|98612_98774_+	DUF1270 domain-containing protein	NA	Q4ZAZ7	Staphylococcus_virus	100.0	2.5e-20
WP_000291090.1|98870_99131_+	DUF1108 family protein	NA	Q4ZDA1	Staphylococcus_virus	100.0	1.2e-43
WP_001662742.1|99143_99680_+	hypothetical protein	NA	A0A0F6N4M6	Staphylococcus_phage	96.1	9.4e-80
WP_031916505.1|99680_100328_+	single-stranded DNA-binding protein	NA	A0A0F6N3I5	Staphylococcus_phage	96.3	6.4e-115
WP_001662745.1|100327_100744_+	single-stranded DNA-binding protein	NA	Q9B0G2	Staphylococcus_virus	83.7	3.3e-56
WP_160176475.1|100757_101426_+	hypothetical protein	NA	R4IH15	Staphylococcus_phage	98.2	6.3e-126
WP_000240896.1|101425_102190_+	AP2 domain-containing protein	NA	A0A2I6PDA5	Staphylococcus_phage	99.2	3.5e-144
WP_001816890.1|102244_102652_+	HNH endonuclease	NA	A7TWN1	Staphylococcus_phage	100.0	7.1e-72
WP_000031113.1|102644_103367_+	helix-turn-helix domain-containing protein	NA	A7TWN2	Staphylococcus_phage	100.0	1.6e-106
WP_031880733.1|103376_104156_+	ATP-binding protein	NA	W5RAN3	Staphylococcus_phage	99.6	2.7e-144
WP_001123688.1|104323_104545_+	DUF3269 family protein	NA	Q9G021	Staphylococcus_phage	100.0	1.3e-35
WP_031906189.1|104554_104980_+	adenine methyltransferase	NA	C8CGZ6	Staphylococcus_phage	99.3	3.0e-81
WP_000049780.1|104976_105381_+	DUF1064 domain-containing protein	NA	Q4ZAR7	Staphylococcus_virus	100.0	1.5e-66
WP_001187239.1|105385_105571_+	DUF3113 family protein	NA	Q4ZAR6	Staphylococcus_virus	100.0	2.4e-27
WP_031906188.1|105571_105934_+	phage protein	NA	R4II61	Staphylococcus_phage	99.2	1.9e-47
WP_031906187.1|105934_106183_+	phage protein	NA	A7TWA8	Staphylococcus_phage	97.6	2.0e-40
WP_001662397.1|106223_106475_+	DUF1024 family protein	NA	E0Y3Q8	Staphylococcus_virus	96.4	1.2e-37
WP_000454994.1|106638_106920_+	hypothetical protein	NA	A0A2I6PDX3	Staphylococcus_phage	100.0	8.5e-48
WP_001662396.1|107096_107600_+	phage dUTPase	NA	Q4ZDP4	Staphylococcus_virus	97.6	2.3e-88
WP_001209216.1|107636_107810_+	hypothetical protein	NA	A0A1W6JQ45	Staphylococcus_phage	100.0	4.7e-25
WP_000195761.1|107826_108063_+	DUF1381 domain-containing protein	NA	M1T303	Staphylococcus_phage	100.0	9.6e-37
WP_000483477.1|108087_108324_+	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
WP_002870008.1|108316_108490_+	phage transcriptional activator RinB	NA	Q4ZAX6	Staphylococcus_virus	100.0	6.4e-22
WP_000989998.1|108490_108637_+	hypothetical protein	NA	A0A059T5A8	Staphylococcus_phage	100.0	2.2e-15
WP_000162699.1|108660_109083_+	RinA family phage transcriptional activator	NA	Q8SDV1	Staphylococcus_phage	100.0	1.6e-74
WP_001003272.1|109269_109710_+|terminase	terminase small subunit	terminase	Q8SDV0	Staphylococcus_phage	100.0	2.8e-74
WP_000169944.1|109696_110974_+|terminase	PBSX family phage terminase large subunit	terminase	Q8SDU9	Staphylococcus_phage	100.0	3.0e-249
WP_015977939.1|110984_112520_+|portal	phage portal protein	portal	Q4ZDV9	Staphylococcus_virus	100.0	3.1e-293
112473:112490	attR	GACGAACAAGATGATGAT	NA	NA	NA	NA
WP_001555735.1|112526_113522_+|head	phage head morphogenesis protein	head	Q4ZDV8	Staphylococcus_virus	100.0	5.8e-184
WP_000072206.1|113594_113765_+	hypothetical protein	NA	Q4ZDV7	Staphylococcus_virus	100.0	3.3e-23
WP_000392140.1|113873_114494_+	DUF4355 domain-containing protein	NA	Q8SDU6	Staphylococcus_phage	100.0	6.4e-64
WP_000438500.1|114507_115482_+|capsid	phage major capsid protein	capsid	B7T0D2	Staphylococcus_virus	99.7	1.8e-182
WP_031880722.1|115503_115791_+	hypothetical protein	NA	S4V6D9	Staphylococcus_phage	98.9	8.1e-46
WP_000208959.1|115799_116132_+|head,tail	phage head-tail connector protein	head,tail	E0Y3L2	Staphylococcus_virus	100.0	7.1e-54
WP_031880723.1|116128_116431_+	hypothetical protein	NA	E0Y3L3	Staphylococcus_virus	99.0	7.4e-50
WP_061650217.1|116430_116775_+	HK97 gp10 family phage protein	NA	A0A0F6N3F5	Staphylococcus_phage	99.1	3.8e-58
WP_000188649.1|116786_117170_+	hypothetical protein	NA	A0A0F6N3L1	Staphylococcus_phage	100.0	1.5e-68
WP_000002577.1|117188_117770_+|tail	phage major tail protein, TP901-1 family	tail	A0A0F6N3L8	Staphylococcus_phage	100.0	4.9e-106
WP_001100163.1|117831_118197_+	hypothetical protein	NA	Q8SDT9	Staphylococcus_phage	100.0	2.8e-59
WP_000105584.1|118226_118571_+	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
WP_160176476.1|118587_122055_+	hypothetical protein	NA	Q4ZDU6	Staphylococcus_virus	95.2	6.9e-248
WP_000350680.1|122067_123015_+|tail	phage tail family protein	tail	Q8SDT6	Staphylococcus_phage	100.0	2.1e-183
WP_000156404.1|123023_124925_+	peptidase	NA	Q4ZDD8	Staphylococcus_virus	100.0	0.0e+00
WP_160176477.1|124939_126850_+	hypothetical protein	NA	Q4ZDU1	Staphylococcus_virus	97.8	0.0e+00
WP_160176478.1|126849_128673_+|plate	BppU family phage baseplate upper protein	plate	A0A0H4ISS3	Staphylococcus_phage	99.7	0.0e+00
WP_015977952.1|128672_129050_+	DUF2977 domain-containing protein	NA	Q4ZDT8	Staphylococcus_virus	100.0	3.6e-54
WP_001790193.1|129053_129227_+	XkdX family protein	NA	Q8LTH6	Staphylococcus_phage	100.0	1.7e-27
WP_015977953.1|129267_129567_+	DUF2951 domain-containing protein	NA	Q4ZDT6	Staphylococcus_virus	100.0	1.3e-46
WP_147712336.1|129703_131602_+	CHAP domain-containing protein	NA	Q8SDT1	Staphylococcus_phage	99.8	0.0e+00
WP_160176479.1|131614_132787_+|plate	BppU family phage baseplate upper protein	plate	A9CRD3	Staphylococcus_phage	95.6	2.2e-190
WP_000398878.1|132791_133187_+	hypothetical protein	NA	Q4ZBP5	Staphylococcus_phage	100.0	2.7e-68
WP_000354121.1|133242_133680_+|holin	phage holin	holin	B2ZZ05	Staphylococcus_phage	98.6	2.0e-72
WP_031905172.1|133660_135106_+	CHAP domain-containing protein	NA	A0EWV1	Staphylococcus_virus	98.8	2.9e-293
WP_001788502.1|135348_135501_+	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
WP_000139423.1|135571_135682_+	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	100.0	1.7e-12
WP_000382163.1|135668_135869_+	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
WP_100250272.1|136194_136275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005407.1|136621_136783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000163281.1|136912_137428_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000830380.1|137768_138578_+	monofunctional peptidoglycan glycosyltransferase SgtB	NA	NA	NA	NA	NA
WP_001124422.1|138838_139657_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000435806.1|139634_139949_+	YfhH family protein	NA	NA	NA	NA	NA
WP_000535849.1|139963_141481_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000886472.1|141489_142326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379091.1|142586_143564_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000284755.1|143715_144753_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000251252.1|145055_145598_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_000597238.1|145888_147625_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
WP_001236371.1|147815_148910_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_001011603.1|149202_150492_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_000939530.1|150572_151028_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_000869463.1|151033_151984_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_000110011.1|152080_152527_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_000063551.1|161340_162402_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_000649898.1|162660_164118_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_001144055.1|164104_164833_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
WP_160176480.1|164968_166111_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000181394.1|166115_166586_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	175488	175833	2933430		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|175488_175833_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 11
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	185421	186162	2933430		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|185421_186162_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 12
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	194025	198305	2933430		Staphylococcus_phage(80.0%)	5	NA	NA
WP_147612242.1|194025_194808_+	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	38.6	8.7e-34
WP_000821649.1|195089_195809_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	34.6	4.9e-23
WP_000721567.1|195843_196572_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.8	1.3e-28
WP_000764684.1|196725_197511_+	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	42.7	2.9e-45
WP_001235656.1|197549_198305_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	40.8	2.3e-39
>prophage 13
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	201559	271848	2933430	protease,tRNA	Staphylococcus_phage(93.02%)	63	NA	NA
WP_000711499.1|201559_202906_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	51.1	2.5e-65
WP_000595635.1|203152_203668_-	membrane protein	NA	NA	NA	NA	NA
WP_001039022.1|204682_205402_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.7	6.4e-124
WP_001038766.1|205525_206242_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	5.5e-83
WP_001038734.1|207287_208004_+|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	97.1	6.6e-129
WP_001038742.1|208173_208893_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	98.3	1.0e-129
WP_160176481.1|209072_210812_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.5	7.1e-286
WP_000072622.1|210804_211959_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.3	7.8e-39
WP_000095390.1|214073_214373_-	secretion protein	NA	NA	NA	NA	NA
WP_001053714.1|214387_215998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000619920.1|216040_216490_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_078072715.1|216717_217077_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_031880637.1|217202_219623_-	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_000731421.1|220589_221033_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001037039.1|221032_221476_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001791232.1|221650_221752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001801861.1|221874_221970_-	type I toxin-antitoxin system Fst family toxin PepA1	NA	NA	NA	NA	NA
WP_000747804.1|222420_222867_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000125075.1|223059_223629_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
WP_001093574.1|223628_224996_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000414222.1|225144_225717_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
WP_000627550.1|225814_226159_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
WP_000669038.1|226199_226826_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
WP_000070654.1|226901_227897_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	3.8e-74
WP_001794016.1|227977_228628_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	1.0e-51
WP_016186903.1|228929_229385_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	3.5e-75
WP_000348372.1|229543_231022_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
WP_000778539.1|231026_232028_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	96.7	8.5e-183
WP_000718107.1|232024_232282_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672010.1|232347_232821_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	9.5e-84
WP_001801476.1|232825_233572_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.3e-139
WP_000109909.1|233864_235457_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
WP_000933819.1|235828_237022_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000366165.1|237146_238055_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
WP_000453316.1|238266_239100_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.6	1.2e-158
WP_000623481.1|239349_239703_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	97.4	4.2e-20
WP_070974337.1|239699_240065_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	99.2	1.4e-58
WP_000091444.1|240319_240622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|240880_241594_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_000492901.1|242051_242672_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001168914.1|242838_243474_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001030476.1|243771_244215_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
WP_001152695.1|244201_244645_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671059.1|244757_245228_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	85.8	7.7e-70
WP_000384171.1|245426_245651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|245926_246781_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989104.1|246867_248160_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	95.1	2.6e-216
WP_000221181.1|248159_248474_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	97.1	1.7e-52
WP_001819953.1|251110_252142_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.3	5.8e-195
WP_000493891.1|252148_252781_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
WP_001159032.1|252791_253973_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
WP_001008556.1|253985_254450_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	97.4	1.9e-68
WP_001196351.1|254571_255573_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.1	5.0e-183
WP_014937042.1|255684_255804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266099.1|255806_256634_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|257206_257608_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764425.1|257726_258290_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
WP_000526541.1|258286_259240_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
WP_001025064.1|259349_260531_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
WP_001108722.1|260822_263237_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.8	0.0e+00
WP_000836472.1|263258_263570_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
WP_160176482.1|263893_270463_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	88.0	2.9e-295
WP_000284993.1|270579_271848_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	5.9e-56
>prophage 14
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	279985	283922	2933430		Salmonella_phage(50.0%)	4	NA	NA
WP_000733283.1|279985_280831_-	BlaZ family penicillin-hydrolyzing class A beta-lactamase PC1	NA	A0A1B0VBP7	Salmonella_phage	34.0	1.5e-31
WP_001096374.1|280937_282695_+	beta-lactam sensor/signal transducer BlaR1	NA	NA	NA	NA	NA
WP_001284656.1|282684_283065_+	penicillinase repressor BlaI	NA	NA	NA	NA	NA
WP_000690628.1|283328_283922_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	1.1e-41
>prophage 15
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	289505	294875	2933430		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|289505_290363_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048374.1|290391_291030_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000118301.1|291050_294875_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 16
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	303447	305154	2933430		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862084.1|303447_305154_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.8	2.1e-274
>prophage 17
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	311758	314389	2933430	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|311758_313021_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279341.1|313114_314389_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 18
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	318157	322293	2933430		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808837.1|318157_319762_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_160176483.1|319748_320909_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553919.1|321023_321470_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174275.1|321549_322293_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.9	8.3e-18
>prophage 19
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	339875	343073	2933430		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226930.1|339875_343073_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	5.5e-135
>prophage 20
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	348005	349763	2933430		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232655.1|348005_349763_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	3.3e-41
>prophage 21
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	354646	362811	2933430		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080025.1|354646_355348_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_073392727.1|355350_357012_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.0	1.7e-34
WP_000849445.1|357512_359000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038301.1|359292_361923_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	32.7	1.8e-46
WP_001114454.1|361938_362811_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
>prophage 22
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	366725	377879	2933430	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|366725_367646_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_016186894.1|367738_367834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|368058_369996_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049150.1|370422_371916_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791219.1|372144_372672_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	5.3e-11
WP_001125540.1|372700_372901_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|372947_373304_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032653.1|373445_374054_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	36.4	1.7e-21
WP_001280014.1|374072_375002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|375006_375117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127572.1|375164_376466_+	trigger factor	NA	NA	NA	NA	NA
WP_000472293.1|376616_377879_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	1.1e-139
>prophage 23
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	387445	394083	2933430	transposase,tRNA	Catovirus(50.0%)	5	NA	NA
WP_000425358.1|387445_390076_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	3.7e-153
WP_001108339.1|390088_391360_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000261106.1|391620_392328_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000692880.1|392324_392879_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000868132.1|392997_394083_+|transposase	transposase	transposase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
>prophage 24
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	397415	398147	2933430		Streptococcus_phage(100.0%)	1	NA	NA
WP_001072201.1|397415_398147_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
>prophage 25
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	406744	442342	2933430	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|406744_407749_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019178.1|407750_408776_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|408798_409938_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|409956_410217_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749802.1|410491_412771_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000595001.1|412973_415247_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
WP_000364542.1|415268_415787_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058583.1|416214_418404_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869979.1|418415_418868_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|418864_419740_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590826.1|420200_421463_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044796.1|421478_423245_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001791215.1|423577_423706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682640.1|423705_424479_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102741.1|424639_425914_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.9	6.3e-106
WP_000704122.1|425998_426421_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|426520_426703_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000008061.1|426742_426889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985898.1|427125_428139_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409167.1|428448_429591_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000066097.1|429591_430710_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567025.1|431391_432060_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001283316.1|432061_434539_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_000734077.1|434881_437512_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|437574_437835_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|437838_438267_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|438281_438590_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342267.1|438874_439513_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137775.1|439515_440439_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|440450_441719_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|441718_442342_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 26
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	458806	464970	2933430		Bacillus_phage(33.33%)	5	NA	NA
WP_000439692.1|458806_459268_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_000953291.1|459326_461474_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	9.1e-33
WP_001282570.1|461530_462505_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|462549_462801_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|463146_464970_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 27
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	468405	471513	2933430		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|468405_470238_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_001119020.1|470373_471513_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.5	6.8e-27
>prophage 28
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	477982	478930	2933430		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117769.1|477982_478930_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	4.9e-47
>prophage 29
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	481984	495712	2933430	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_160176488.1|481984_483376_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.2	2.3e-45
WP_001794939.1|483710_484334_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|484344_485163_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217253.1|485223_487023_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
WP_001283055.1|487246_488353_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624581.1|488483_489161_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683921.1|489163_490264_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
WP_001062173.1|490377_491724_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	1.4e-55
WP_000924211.1|491733_492624_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
WP_001213908.1|492749_493535_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564316.1|493576_494440_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|494426_494837_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|495112_495712_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 30
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	501884	502508	2933430		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|501884_502508_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 31
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	508052	510864	2933430		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019697.1|508052_509399_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.9	2.1e-64
WP_000202178.1|509391_510864_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.1	1.4e-80
>prophage 32
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	518384	524954	2933430		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|518384_519722_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159866.1|519714_519945_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_160176489.1|519922_520804_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	1.3e-09
WP_001124985.1|521234_521687_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942216.1|521702_523382_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291540.1|523532_524954_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	6.6e-40
>prophage 33
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	531782	533189	2933430		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|531782_533189_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 34
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	540536	542021	2933430		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|540536_542021_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 35
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	547685	614999	2933430	holin,integrase,tail,capsid,plate,protease,transposase,portal,terminase,head	Staphylococcus_phage(84.29%)	87	556979:557007	614795:614823
WP_000447733.1|547685_548573_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183424.1|548650_549157_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273367.1|549248_549980_+	segregation and condensation protein A	NA	NA	NA	NA	NA
WP_000368652.1|549972_550515_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|550507_551245_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|551377_552103_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987777.1|552083_553835_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
WP_001574168.1|554086_555019_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001794062.1|555005_557048_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	44.1	1.1e-38
556979:557007	attL	ACCATCTCATTATGATGATATGTTTATTT	NA	NA	NA	NA
WP_000264747.1|557090_558296_-|integrase	site-specific integrase	integrase	A0A2I6PEZ6	Staphylococcus_phage	100.0	1.6e-223
WP_001166482.1|558421_559045_+	hypothetical protein	NA	B7T0F3	Staphylococcus_virus	99.5	9.8e-105
WP_000705240.1|559190_559373_-	hypothetical protein	NA	A0A2I6PDR4	Staphylococcus_phage	100.0	5.3e-27
WP_000511090.1|559443_560175_-	helix-turn-helix transcriptional regulator	NA	S4SVC5	Staphylococcus_phage	99.2	1.3e-132
WP_000213811.1|560326_560539_+	helix-turn-helix transcriptional regulator	NA	A7TWF1	Staphylococcus_phage	100.0	1.6e-30
WP_000435357.1|560586_561030_+	hypothetical protein	NA	A7TWF2	Staphylococcus_phage	100.0	8.9e-76
WP_000362644.1|561234_561447_-	hypothetical protein	NA	D2JGJ1	Staphylococcus_phage	100.0	7.6e-33
WP_001148860.1|561516_561714_+	hypothetical protein	NA	A7TWF5	Staphylococcus_phage	100.0	4.6e-24
WP_000773059.1|561700_562081_-	DUF2513 domain-containing protein	NA	Q4ZCQ5	Staphylococcus_virus	100.0	5.8e-68
WP_001025401.1|562147_562393_+	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
WP_001128433.1|562361_562727_-	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	100.0	2.4e-63
WP_001097552.1|562781_562997_+	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	100.0	1.9e-31
WP_001124160.1|563021_563285_+	helix-turn-helix domain-containing protein	NA	A7TWG0	Staphylococcus_phage	100.0	5.7e-46
WP_001285954.1|563297_563459_+	DUF1270 domain-containing protein	NA	A7TWM3	Staphylococcus_phage	100.0	8.6e-21
WP_000175000.1|563537_563861_+	hypothetical protein	NA	A0A2I6PDL5	Staphylococcus_phage	100.0	1.3e-52
WP_000985986.1|563875_564238_+	hypothetical protein	NA	Q4ZCP8	Staphylococcus_virus	100.0	2.2e-56
WP_160176490.1|564234_565401_+	DUF2800 domain-containing protein	NA	Q8SDR9	Staphylococcus_virus	98.7	8.5e-219
WP_000647288.1|565427_565982_+	DUF2815 family protein	NA	M9QRS1	Staphylococcus_phage	100.0	1.4e-99
WP_078341700.1|566050_568003_+	DNA polymerase	NA	A0A2I6PE86	Staphylococcus_phage	99.2	0.0e+00
WP_001164629.1|568015_568201_+	DUF3113 family protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
WP_160176491.1|568200_568602_+	PVL family protein	NA	A7TWG8	Staphylococcus_phage	99.2	2.8e-68
WP_000111487.1|568601_568856_+	DUF3310 domain-containing protein	NA	A0A2I6PF10	Staphylococcus_phage	100.0	3.7e-42
WP_160176492.1|568855_569104_+	hypothetical protein	NA	A0A2I6PDM0	Staphylococcus_phage	96.3	4.0e-41
WP_064140615.1|569144_569399_+	DUF1024 family protein	NA	A0A1W6JPK6	Staphylococcus_phage	100.0	9.4e-38
WP_078064235.1|569361_569556_+	hypothetical protein	NA	M1SVE4	Staphylococcus_phage	100.0	8.2e-26
WP_001066455.1|569548_570085_+	hypothetical protein	NA	M1SNY5	Staphylococcus_phage	100.0	5.5e-96
WP_001209216.1|570121_570295_+	hypothetical protein	NA	A0A1W6JQ45	Staphylococcus_phage	100.0	4.7e-25
WP_000195761.1|570311_570548_+	DUF1381 domain-containing protein	NA	M1T303	Staphylococcus_phage	100.0	9.6e-37
WP_000483477.1|570572_570809_+	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
WP_000592202.1|570801_571188_+	hypothetical protein	NA	A0A1X9IGZ2	Staphylococcus_phage	100.0	3.0e-64
WP_160176493.1|571184_571337_+	transcriptional regulator	NA	A7TWI2	Staphylococcus_phage	96.0	2.9e-18
WP_000265258.1|571404_571605_+	DUF1514 domain-containing protein	NA	A0A2I6PF41	Staphylococcus_phage	100.0	2.9e-26
WP_000884879.1|571657_574105_+	hypothetical protein	NA	B5WZN5	Staphylococcus_phage	99.9	0.0e+00
WP_015978074.1|574207_574312_-	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	2.7e-12
WP_000665205.1|574445_574736_+	VRR-NUC domain-containing protein	NA	U5U7A3	Staphylococcus_phage	100.0	4.9e-51
WP_001795330.1|574716_576084_+	DEAD/DEAH box helicase	NA	Q4ZCF6	Staphylococcus_virus	100.0	4.6e-264
WP_000513704.1|576096_576534_+	transcriptional regulator	NA	A0A2K9VBV2	Staphylococcus_phage	100.0	6.1e-77
WP_000166884.1|576690_577011_+	HNH endonuclease	NA	A0A2K9VBV6	Staphylococcus_phage	99.1	1.1e-56
WP_000778935.1|577135_577441_+|terminase	P27 family phage terminase small subunit	terminase	U5U414	Staphylococcus_phage	100.0	2.9e-49
WP_000152858.1|577430_579122_+|terminase	terminase large subunit	terminase	A0A2K9VBQ1	Staphylococcus_phage	100.0	0.0e+00
WP_001100660.1|579126_580365_+|portal	phage portal protein	portal	A0A2K9VBP0	Staphylococcus_phage	99.5	2.0e-234
WP_000061872.1|580348_581122_+|protease	Clp protease ClpP	protease	M1TAZ4	Staphylococcus_phage	100.0	9.2e-137
WP_001142739.1|581133_582297_+|capsid	phage major capsid protein	capsid	A0A2I6PDD7	Staphylococcus_phage	100.0	9.4e-218
WP_000050973.1|582365_582644_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_000395501.1|582655_582988_+	hypothetical protein	NA	A0A2I6PDD6	Staphylococcus_phage	100.0	6.2e-58
WP_000110020.1|582984_583386_+	hypothetical protein	NA	A0A2I6PDD3	Staphylococcus_phage	100.0	6.2e-68
WP_160176494.1|583386_583782_+	hypothetical protein	NA	A0A2I6PDD8	Staphylococcus_phage	99.2	8.5e-62
WP_078056058.1|583978_584515_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	9.9e-29
WP_000746372.1|584495_584999_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001255377.1|585107_585449_-	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_000810443.1|585504_586095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000247474.1|586101_587148_-	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	36.9	8.1e-19
WP_000681147.1|587137_588985_-	membrane protein	NA	NA	NA	NA	NA
WP_001251200.1|588989_590348_-	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	29.9	1.2e-41
WP_001049264.1|590401_592897_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000358144.1|592931_593315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015644.1|593326_593587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692005.1|593591_594647_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_031880729.1|594707_595733_-	replication initiation factor domain-containing protein	NA	NA	NA	NA	NA
WP_000386891.1|595974_596277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805733.1|596290_596611_-	DUF961 domain-containing protein	NA	NA	NA	NA	NA
WP_000134550.1|596761_597046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807536.1|597159_597801_+|tail	tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	100.0	5.9e-121
WP_000169127.1|597892_598348_+	Ig domain-containing protein	NA	A0A2I6PER6	Staphylococcus_phage	100.0	5.7e-78
WP_000589167.1|598405_598756_+	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
WP_000438833.1|598797_598956_+	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_160176495.1|598969_605170_+|tail	phage tail tape measure protein	tail	U5U762	Staphylococcus_phage	99.6	0.0e+00
WP_001190533.1|605169_605994_+|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
WP_000384474.1|606002_607586_+	peptidase	NA	A0A2I6PEQ5	Staphylococcus_phage	100.0	9.3e-309
WP_000179858.1|607585_607876_+	hypothetical protein	NA	U5U457	Staphylococcus_phage	100.0	2.1e-49
WP_000429558.1|607891_609802_+	minor structural protein	NA	A0A2I6PEQ9	Staphylococcus_phage	100.0	0.0e+00
WP_000067132.1|609801_611268_+|plate	BppU family phage baseplate upper protein	plate	B5WZQ8	Staphylococcus_phage	100.0	7.6e-257
WP_001166599.1|611267_611657_+	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
WP_000916020.1|611649_611814_+	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_160176496.1|611859_612159_+	DUF2951 family protein	NA	A0A2I6PER2	Staphylococcus_phage	99.0	7.7e-31
WP_000339141.1|612294_612597_+|holin	phage holin	holin	A0A2I6PF56	Staphylococcus_phage	100.0	3.1e-48
WP_000909205.1|612607_614062_+	CHAP domain-containing protein	NA	A0A2I6PF47	Staphylococcus_phage	99.6	2.8e-288
WP_000209712.1|614783_614999_+	hypothetical protein	NA	A0ZS61	Staphylococcus_virus	100.0	2.0e-25
614795:614823	attR	ACCATCTCATTATGATGATATGTTTATTT	NA	NA	NA	NA
>prophage 36
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	618223	620902	2933430		Bacillus_phage(50.0%)	3	NA	NA
WP_001151997.1|618223_618472_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163814.1|618579_619533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902107.1|619522_620902_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.3	2.9e-56
>prophage 37
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	630309	635450	2933430		Bacillus_phage(25.0%)	6	NA	NA
WP_001043863.1|630309_630582_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|631012_631585_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774679.1|631587_632313_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001819897.1|632329_633274_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|633365_633815_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_001269937.1|634283_635450_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	1.5e-34
>prophage 38
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	639112	639688	2933430		Bacillus_virus(100.0%)	1	NA	NA
WP_000005208.1|639112_639688_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	4.6e-08
>prophage 39
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	643060	650567	2933430	tRNA	unidentified_phage(25.0%)	5	NA	NA
WP_000361536.1|643060_644263_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	42.5	1.4e-35
WP_000049917.1|644249_645221_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525060.1|645244_647938_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858795.1|648259_649552_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	4.3e-54
WP_000362222.1|649880_650567_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
>prophage 40
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	654258	654885	2933430		Bacillus_phage(100.0%)	1	NA	NA
WP_001108885.1|654258_654885_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 41
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	664349	665228	2933430		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|664349_665228_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 42
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	703821	714278	2933430	transposase	Staphylococcus_phage(50.0%)	14	NA	NA
WP_000282169.1|703821_704526_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.3	1.9e-11
WP_001814377.1|704770_704965_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001165814.1|704976_705228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404628.1|705265_706390_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995290.1|706405_706843_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934885.1|707266_708223_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|708422_708902_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166055.1|708916_709756_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	5.1e-48
WP_000159899.1|709841_710375_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|710367_710796_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473654.1|710807_711308_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|711307_711529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|711601_712549_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_160176498.1|712787_714278_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	1.7e-22
>prophage 43
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	717686	719698	2933430		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|717686_718346_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166793.1|718342_719698_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 44
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	726066	726858	2933430		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|726066_726858_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 45
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	730393	735419	2933430	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138413.1|730393_731530_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001794103.1|731561_732191_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|732209_732479_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|732640_732949_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|733119_733320_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876206.1|733516_733918_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216956.1|734153_735419_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.0	4.0e-12
>prophage 46
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	743261	744863	2933430		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|743261_744863_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 47
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	749288	752742	2933430		Indivirus(50.0%)	3	NA	NA
WP_000079448.1|749288_750140_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.8e-16
WP_000974850.1|750146_750788_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077549.1|750927_752742_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.3	2.3e-154
>prophage 48
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	756156	756858	2933430		Tupanvirus(100.0%)	1	NA	NA
WP_000571253.1|756156_756858_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.0e-13
>prophage 49
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	764339	766692	2933430		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000153717.1|764339_765122_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.7	1.2e-27
WP_000604802.1|766125_766692_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	31.8	1.7e-23
>prophage 50
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	771010	774576	2933430	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_000283027.1|771010_772273_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	1.7e-95
WP_001123276.1|772420_772606_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_000277741.1|772929_774576_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 51
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	783845	788239	2933430		Bacillus_phage(50.0%)	2	NA	NA
WP_001289586.1|783845_786248_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	1.1e-92
WP_001574370.1|786247_788239_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 52
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	793855	795502	2933430		Vibrio_phage(100.0%)	1	NA	NA
WP_001088983.1|793855_795502_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.5	1.9e-22
>prophage 53
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	799171	800293	2933430		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691309.1|799171_800293_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.1	2.1e-09
>prophage 54
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	804442	810098	2933430		Phage_Wrath(25.0%)	7	NA	NA
WP_001208760.1|804442_805066_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
WP_000380738.1|805445_806309_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	1.2e-15
WP_001791425.1|806382_806487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688127.1|806483_807461_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085657.1|807617_807887_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|808340_808490_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000089857.1|808580_810098_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.8	2.7e-92
>prophage 55
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	820234	824510	2933430		Bacillus_phage(50.0%)	6	NA	NA
WP_000841344.1|820234_820768_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|820906_821095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000624452.1|821207_821810_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_160176500.1|821806_822898_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603961.1|822901_823633_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001794121.1|823601_824510_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	9.8e-21
>prophage 56
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	828464	828800	2933430	head	Staphylococcus_phage(100.0%)	1	NA	NA
WP_077670291.1|828464_828800_-|head	phage head morphogenesis protein	head	A0A1J0MFV1	Staphylococcus_phage	60.4	2.6e-27
>prophage 57
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	832737	839343	2933430	transposase,capsid	Staphylococcus_phage(80.0%)	8	NA	NA
WP_077670290.1|832737_833403_-|capsid	phage capsid protein	capsid	A0A1J0MF61	Staphylococcus_phage	53.0	4.6e-60
WP_000585095.1|833463_833715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477487.1|835235_835652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121213.1|836078_837026_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	99.7	1.6e-183
WP_000006110.1|837237_837423_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_031788482.1|837815_837926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002343.1|838627_838834_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
WP_001071312.1|839130_839343_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	3.6e-19
>prophage 58
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	846725	853599	2933430	transposase	Staphylococcus_phage(50.0%)	8	NA	NA
WP_031876457.1|846725_848084_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	29.9	4.0e-42
WP_160176501.1|848088_849936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000247474.1|849925_850972_+	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	36.9	8.1e-19
WP_000810443.1|850978_851569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001255381.1|851624_851981_+	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_000746372.1|852089_852593_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078367270.1|852573_853110_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	1.3e-28
WP_001659797.1|853401_853599_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
>prophage 59
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	858670	859147	2933430		Fowlpox_virus(100.0%)	1	NA	NA
WP_160176502.1|858670_859147_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	37.6	4.7e-22
>prophage 60
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	865090	871572	2933430		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103747.1|865090_865909_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	3.1e-26
WP_001077635.1|866383_866926_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516249.1|866931_868941_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.2	4.1e-59
WP_000073334.1|868953_871572_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	3.8e-41
>prophage 61
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	880986	882030	2933430		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|880986_882030_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 62
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	886230	891774	2933430		Bacillus_virus(33.33%)	4	NA	NA
WP_086045381.1|886230_887517_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.5	8.7e-15
WP_160176503.1|887516_888782_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	9.1e-41
WP_001293307.1|888812_889526_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042907377.1|889530_891774_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 63
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	896914	908729	2933430	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864182.1|896914_897886_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282296.1|897900_898818_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|898987_899338_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043642.1|899724_901842_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020856.1|901846_902164_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|902160_902445_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097463.1|902465_903641_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036631.1|903661_904129_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000139497.1|904418_908729_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 64
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	913002	913773	2933430		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|913002_913773_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 65
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	918547	932218	2933430	protease,tRNA	Erwinia_phage(16.67%)	11	NA	NA
WP_000379051.1|918547_919951_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	6.4e-27
WP_000072681.1|920016_920562_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015609.1|920558_921455_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	6.1e-31
WP_000195263.1|921872_923180_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001557331.1|923335_925411_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000620184.1|925584_926457_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000672864.1|926628_927873_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_001041658.1|927900_929019_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000110252.1|929245_930154_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	2.3e-17
WP_001020801.1|930175_931342_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176401.1|931450_932218_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 66
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	945602	947723	2933430		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|945602_946334_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|946449_946683_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|946988_947723_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 67
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	958093	960088	2933430		Moumouvirus(100.0%)	1	NA	NA
WP_000579564.1|958093_960088_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 68
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	963235	964171	2933430	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|963235_964171_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 69
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	969180	971437	2933430		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|969180_970380_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|970595_970814_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368225.1|970813_971437_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	6.1e-22
>prophage 70
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	974751	975363	2933430		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|974751_975363_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 71
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	979330	983941	2933430		Halovirus(33.33%)	4	NA	NA
WP_001190910.1|979330_980431_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	9.6e-63
WP_000767018.1|980432_981707_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|981724_982606_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178615.1|982633_983941_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 72
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	988872	991626	2933430	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384706.1|988872_991626_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	2.1e-90
>prophage 73
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1010982	1011180	2933430		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245800.1|1010982_1011180_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	1.2e-19
>prophage 74
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1020091	1022267	2933430	transposase	Staphylococcus_virus(100.0%)	2	NA	NA
WP_000277741.1|1020091_1021738_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_001801391.1|1022039_1022267_-	hypothetical protein	NA	Q4ZBW5	Staphylococcus_virus	67.7	1.9e-18
>prophage 75
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1025727	1026078	2933430		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000669541.1|1025727_1026078_-	complement inhibitor SCIN-C	NA	A7TWS0	Staphylococcus_phage	50.0	1.9e-20
>prophage 76
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1037512	1042070	2933430		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|1037512_1037827_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249264.1|1037999_1040348_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
WP_000161937.1|1040357_1042070_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
>prophage 77
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1046948	1048007	2933430	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|1046948_1048007_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 78
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1059986	1062897	2933430		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|1059986_1060469_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263793.1|1060470_1061013_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|1061082_1061472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|1061474_1061729_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757584.1|1061967_1062897_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	6.5e-12
>prophage 79
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1084538	1088181	2933430		Mycoplasma_phage(50.0%)	4	NA	NA
WP_000433551.1|1084538_1085633_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020627.1|1085645_1086185_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000455584.1|1086328_1086604_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|1086774_1088181_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
>prophage 80
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1092822	1093374	2933430		Synechococcus_phage(100.0%)	1	NA	NA
WP_000957036.1|1092822_1093374_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 81
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1099488	1160517	2933430	transposase,protease,bacteriocin,holin	Bacillus_virus(12.5%)	62	NA	NA
WP_001289622.1|1099488_1099722_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	1.3e-09
WP_000040041.1|1099958_1101677_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|1101679_1101946_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505964.1|1102099_1102642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685075.1|1102695_1103868_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.6	1.5e-74
WP_000009075.1|1104292_1105588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064214.1|1105739_1105874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277741.1|1106160_1107807_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_000033477.1|1108376_1108952_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000921981.1|1108966_1110367_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.4e-10
WP_000273254.1|1110359_1111166_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101912.1|1111433_1112681_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709288.1|1112702_1114181_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	9.2e-77
WP_000238673.1|1114195_1114762_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
WP_000030814.1|1114764_1115793_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	7.6e-62
WP_000483716.1|1115785_1117270_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.4	8.5e-46
WP_000032734.1|1117248_1119438_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.2	5.1e-140
WP_000666808.1|1119430_1120102_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000848351.1|1120103_1120367_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174050.1|1120366_1121071_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.6	7.3e-48
WP_001010391.1|1121074_1122199_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861576.1|1122185_1122668_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_000225845.1|1122868_1123729_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	1.2e-39
WP_001037831.1|1124510_1124828_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_031788462.1|1124975_1125095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000032836.1|1125399_1126500_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_001010763.1|1126499_1128488_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_000017736.1|1128477_1129083_+	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_000104251.1|1129079_1129370_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_000671206.1|1129712_1130906_-	teichoic acid D-Ala esterase FmtA	NA	NA	NA	NA	NA
WP_001031977.1|1131346_1132573_+	polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase	NA	NA	NA	NA	NA
WP_000088437.1|1132620_1133091_+	DUF2538 family protein	NA	NA	NA	NA	NA
WP_000491975.1|1133246_1133681_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001074519.1|1133908_1137682_+	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	38.0	1.1e-54
WP_001788579.1|1137752_1137863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278015.1|1137889_1138309_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000202434.1|1138461_1139472_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000777562.1|1139666_1140821_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000676568.1|1141348_1142422_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	31.7	1.1e-15
WP_001088791.1|1142503_1143685_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_000284455.1|1143722_1144052_+	staphostatin B	NA	NA	NA	NA	NA
WP_000184947.1|1144287_1145109_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150205.1|1145101_1145905_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000526678.1|1145891_1147565_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_001814117.1|1147551_1148763_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_072357920.1|1148866_1148944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070967.1|1149094_1150033_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000620943.1|1150084_1150636_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001794164.1|1150725_1151016_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	2.6e-07
WP_001794249.1|1151079_1151211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081338.1|1151257_1152217_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766009.1|1152707_1153064_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000719183.1|1153152_1154634_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000410718.1|1154639_1154927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791476.1|1155267_1155558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571191.1|1155645_1156287_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	5.0e-19
WP_000873929.1|1156283_1156604_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000870819.1|1156606_1158571_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_001794574.1|1158614_1158887_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_001790623.1|1158896_1158998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119695.1|1159536_1159614_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_001033867.1|1159914_1160517_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 82
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1166484	1171695	2933430	protease	Pithovirus(33.33%)	3	NA	NA
WP_001794169.1|1166484_1168809_-|protease	serine protease	protease	W5SAB9	Pithovirus	26.8	4.0e-10
WP_000928413.1|1169027_1169831_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049957.1|1170132_1171695_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
>prophage 83
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1192915	1194724	2933430		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082722.1|1192915_1194724_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	9.3e-47
>prophage 84
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1198674	1212518	2933430	transposase	Bacillus_virus(28.57%)	12	NA	NA
WP_160176155.1|1198674_1200321_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.9	8.2e-292
WP_094409958.1|1200616_1202183_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_001180271.1|1202273_1203155_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001574526.1|1203166_1203817_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000427776.1|1203809_1204790_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_001067041.1|1204792_1205779_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
WP_073392975.1|1205829_1207299_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000121211.1|1207413_1208361_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000517177.1|1208352_1208619_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000197096.1|1208830_1210486_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000786746.1|1210504_1211446_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	9.3e-06
WP_000140043.1|1211435_1212518_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	2.4e-18
>prophage 85
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1221112	1227923	2933430		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619360.1|1221112_1222258_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047061.1|1222368_1223238_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353950.1|1223296_1225906_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044234.1|1226108_1227923_-	O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	8.8e-37
>prophage 86
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1231188	1238648	2933430	transposase	Staphylococcus_virus(50.0%)	4	NA	NA
WP_000277726.1|1231188_1232835_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	6.9e-291
WP_000902813.1|1233211_1233601_-	YisL family protein	NA	NA	NA	NA	NA
WP_000670753.1|1233926_1234829_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000154949.1|1234994_1238648_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
>prophage 87
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1248803	1255853	2933430		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185311.1|1248803_1249733_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.5	1.8e-38
WP_000138487.1|1250127_1251372_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000167321.1|1251480_1252671_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.0	1.3e-33
WP_000838047.1|1252978_1254106_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1254467_1254845_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1255259_1255853_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 88
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1265787	1269415	2933430		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009683.1|1265787_1267263_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	1.2e-47
WP_000046076.1|1267393_1268602_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143497.1|1269055_1269415_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 89
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1273458	1276127	2933430		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1273458_1274673_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129645.1|1274669_1276127_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	4.4e-39
>prophage 90
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1289339	1292862	2933430		environmental_halophage(50.0%)	3	NA	NA
WP_000807671.1|1289339_1290581_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.1e-110
WP_000205572.1|1290695_1292003_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1292100_1292862_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 91
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1296811	1297837	2933430		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571209.1|1296811_1297837_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.2e-28
>prophage 92
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1301047	1301779	2933430		Streptococcus_phage(100.0%)	1	NA	NA
WP_001072201.1|1301047_1301779_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
>prophage 93
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1305111	1312812	2933430	transposase	Streptococcus_phage(40.0%)	11	NA	NA
WP_000868132.1|1305111_1306197_-|transposase	transposase	transposase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
WP_001814102.1|1306298_1306919_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000290491.1|1307096_1307477_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000589549.1|1307634_1307991_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147955.1|1308134_1308455_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1308604_1309144_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150036.1|1309226_1309943_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.7	6.8e-17
WP_000974455.1|1310090_1310513_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1310911_1311406_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255545.1|1311561_1312179_+	amino acid transporter	NA	NA	NA	NA	NA
WP_016187137.1|1312251_1312812_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	3.8e-31
>prophage 94
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1316217	1317461	2933430		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1316217_1316418_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001574556.1|1316774_1317461_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 95
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1326917	1335674	2933430		Staphylococcus_phage(50.0%)	8	NA	NA
WP_001574560.1|1326917_1327646_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	4.8e-18
WP_000999096.1|1327933_1328548_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_001085185.1|1329513_1329978_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_160176509.1|1329999_1332372_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	1.9e-92
WP_001165967.1|1332405_1333146_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000556760.1|1333274_1333508_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785248.1|1333574_1334033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160176510.1|1334369_1335674_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.5	2.5e-195
>prophage 96
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1346362	1352168	2933430		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1346362_1346950_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1347508_1348453_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1348561_1349557_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369719.1|1349553_1350465_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134960.1|1351232_1352168_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	8.4e-84
>prophage 97
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1356565	1359412	2933430		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662687.1|1356565_1359412_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 98
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1362730	1363570	2933430		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000749385.1|1362730_1363570_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 99
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1370008	1375713	2933430		Streptococcus_phage(66.67%)	5	NA	NA
WP_000370984.1|1370008_1371091_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.8	1.2e-44
WP_000686342.1|1371454_1372321_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192947.1|1372464_1373106_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
WP_000258151.1|1373269_1374325_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1374642_1375713_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 100
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1384990	1407961	2933430		uncultured_Caudovirales_phage(35.71%)	18	NA	NA
WP_000616865.1|1384990_1385752_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
WP_001245566.1|1385748_1386705_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
WP_160176514.1|1386691_1387663_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	79.9	2.3e-140
WP_000562498.1|1388039_1389011_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1389130_1391236_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1391198_1391597_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068491.1|1392398_1393265_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930016.1|1393284_1393785_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
WP_000193750.1|1394124_1395630_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031788440.1|1395707_1395809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429002.1|1395899_1396817_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	8.2e-07
WP_000197262.1|1397368_1397911_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663016.1|1398069_1399128_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.5	5.7e-20
WP_000180987.1|1399367_1400882_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589241.1|1400874_1401852_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.1e-25
WP_000983677.1|1402072_1403854_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525101.1|1403865_1405749_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	8.8e-56
WP_000098285.1|1406020_1407961_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 101
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1411100	1420946	2933430		Pandoravirus(12.5%)	12	NA	NA
WP_001217804.1|1411100_1412252_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
WP_000604508.1|1412235_1412829_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
WP_000446724.1|1413179_1413848_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1413849_1414269_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062968.1|1414272_1414986_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000637686.1|1415084_1415669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093552.1|1415948_1416389_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1416730_1417204_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1417178_1417865_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244416.1|1417864_1418920_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702776.1|1418991_1419975_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.0	7.3e-62
WP_000931237.1|1420106_1420946_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
>prophage 102
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1428108	1476281	2933430	transposase,bacteriocin,tRNA	Staphylococcus_phage(31.25%)	49	NA	NA
WP_001107240.1|1428108_1428591_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_000216727.1|1428764_1429217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041284.1|1429513_1430680_-	multidrug efflux MFS transporter NorA	NA	NA	NA	NA	NA
WP_000776010.1|1430889_1431312_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001191871.1|1431498_1432116_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_000154465.1|1432112_1432397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952030.1|1432551_1433925_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	1.2e-46
WP_000005632.1|1434010_1435564_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_000180420.1|1435846_1436134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435104.1|1436168_1437077_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_000794424.1|1437179_1438106_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001283444.1|1438332_1438776_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000857616.1|1438902_1440576_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	24.2	2.0e-11
WP_000737163.1|1440572_1442204_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	28.2	2.3e-12
WP_160176515.1|1442422_1443298_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358501.1|1443469_1444153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148821.1|1444155_1444614_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1444615_1445182_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
WP_000638614.1|1445276_1445819_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000545116.1|1445898_1446198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000733427.1|1446335_1446725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259673.1|1446791_1447235_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000842865.1|1447361_1448051_+	DUF1129 family protein	NA	NA	NA	NA	NA
WP_001105942.1|1448713_1449388_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
WP_000361064.1|1449482_1449860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159128.1|1450097_1450463_+	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	47.8	8.5e-24
WP_000378396.1|1450455_1452636_+	cadmium-translocating P-type ATPase CadA	NA	E4ZFI9	Streptococcus_phage	63.7	9.3e-251
WP_000277738.1|1452998_1454645_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.4	1.0e-289
WP_000277154.1|1454711_1456145_-	multi-copper oxidase Mco	NA	NA	NA	NA	NA
WP_000069452.1|1456159_1458205_-	copper-translocating P-type ATPase CopB	NA	E4ZFI9	Streptococcus_phage	29.2	2.3e-65
WP_000690626.1|1458471_1459047_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	2.9e-42
WP_000838599.1|1459381_1460377_-	YeiH family protein	NA	NA	NA	NA	NA
WP_000377738.1|1460501_1461323_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791613.1|1461624_1461717_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000397995.1|1461945_1462269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998976.1|1463485_1463911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273007.1|1465619_1466120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001582045.1|1466186_1466513_-	recombinase	NA	NA	NA	NA	NA
WP_001643491.1|1466452_1466830_-	recombinase	NA	NA	NA	NA	NA
WP_000277741.1|1466984_1468631_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_000593106.1|1468992_1469619_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.1e-22
WP_000831610.1|1469630_1469942_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000713732.1|1469945_1471880_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000726502.1|1471954_1472248_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000358995.1|1472627_1473023_-	thioredoxin-dependent arsenate reductase	NA	A0A2H4PQT9	Staphylococcus_phage	86.3	8.5e-62
WP_000153633.1|1473040_1474330_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	81.1	5.6e-187
WP_000120605.1|1474329_1474644_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4PQT4	Staphylococcus_phage	73.1	4.7e-39
WP_001035802.1|1475359_1475572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105942.1|1475606_1476281_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
>prophage 103
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1481585	1482059	2933430		Pandoravirus(100.0%)	1	NA	NA
WP_000833480.1|1481585_1482059_-	cupin	NA	A0A291AU44	Pandoravirus	38.7	4.6e-14
>prophage 104
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1487310	1488108	2933430		Lactobacillus_virus(100.0%)	1	NA	NA
WP_000731642.1|1487310_1488108_+	LysM peptidoglycan-binding domain-containing protein	NA	C1KFN7	Lactobacillus_virus	35.8	2.1e-06
>prophage 105
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1492829	1493591	2933430		Planktothrix_phage(100.0%)	1	NA	NA
WP_000153733.1|1492829_1493591_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.2e-33
>prophage 106
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1497957	1499001	2933430		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_001030763.1|1497957_1499001_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.1	3.8e-16
>prophage 107
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1505523	1506321	2933430		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1505523_1506321_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 108
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1509548	1513507	2933430		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1509548_1511276_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793055.1|1511696_1512992_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1513108_1513507_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 109
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1520440	1521184	2933430		Indivirus(100.0%)	1	NA	NA
WP_000894458.1|1520440_1521184_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-12
>prophage 110
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1534000	1534561	2933430	integrase	Streptococcus_phage(100.0%)	1	1528154:1528168	1538143:1538157
1528154:1528168	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044966.1|1534000_1534561_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
WP_001044966.1|1534000_1534561_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
1538143:1538157	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 111
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1547728	1551082	2933430		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1547728_1548739_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1549237_1549759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180233.1|1549786_1551082_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 112
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1558613	1559936	2933430		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860607.1|1558613_1559936_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	8.2e-109
>prophage 113
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1571240	1571897	2933430		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455258.1|1571240_1571897_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	6.4e-46
>prophage 114
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1575564	1578886	2933430		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000382588.1|1575564_1576941_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	6.7e-21
WP_000347064.1|1577485_1578886_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.0	9.4e-55
>prophage 115
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1602133	1602796	2933430		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|1602133_1602796_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 116
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1609384	1610572	2933430		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_160176516.1|1609384_1610572_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	2.0e-45
>prophage 117
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1613599	1624553	2933430		Streptococcus_phage(33.33%)	6	NA	NA
WP_031880669.1|1613599_1615681_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	6.1e-66
WP_001137495.1|1615803_1616274_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1616339_1616753_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1616850_1617105_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001819727.1|1617241_1620838_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	4.3e-67
WP_000918664.1|1621001_1624553_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	6.1e-50
>prophage 118
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1628236	1633019	2933430	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1628236_1628785_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1628797_1628980_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001791441.1|1629035_1629179_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872867.1|1629293_1629863_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664740.1|1629943_1630468_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1630467_1631214_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370181.1|1631221_1631626_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631982.1|1631618_1633019_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	2.5e-55
>prophage 119
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1639030	1641487	2933430	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1639030_1641487_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 120
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1660569	1671027	2933430	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1660569_1662057_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_016186812.1|1662109_1662202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613720.1|1662595_1663072_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154303.1|1663068_1663434_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167936.1|1663411_1664215_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	6.7e-21
WP_000057594.1|1664430_1665363_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1665541_1666423_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1666836_1668930_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1669187_1669727_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176721.1|1669731_1671027_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.3	8.2e-13
>prophage 121
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1680283	1682748	2933430		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1680283_1681249_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252515.1|1681395_1682748_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	1.1e-23
>prophage 122
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1688632	1691730	2933430	tRNA	Hokovirus(50.0%)	2	NA	NA
WP_001051120.1|1688632_1690606_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.6	3.2e-93
WP_000279925.1|1690890_1691730_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 123
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1695636	1696254	2933430		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1695636_1696254_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 124
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1705098	1706796	2933430		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109044.1|1705098_1706796_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 125
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1723433	1729670	2933430		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170274.1|1723433_1724438_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.1	1.4e-23
WP_000825534.1|1724771_1725614_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467992.1|1725650_1726310_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569267.1|1726313_1727339_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	1.4e-31
WP_001036658.1|1727629_1728772_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_160176546.1|1728764_1729670_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.4	7.2e-48
>prophage 126
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1753207	1755989	2933430		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072632.1|1753207_1754440_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	2.7e-45
WP_000028598.1|1754432_1755989_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.5	1.7e-286
>prophage 127
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1767476	1767803	2933430	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001799349.1|1767476_1767803_+|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	85.4	4.3e-11
>prophage 128
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1771050	1774083	2933430		Hokovirus(50.0%)	2	NA	NA
WP_000424963.1|1771050_1772592_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1772616_1774083_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 129
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1783183	1784707	2933430		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930503.1|1783183_1784707_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.2	5.5e-40
>prophage 130
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1793859	1814864	2933430	integrase,coat,terminase	Staphylococcus_phage(81.82%)	30	1793136:1793153	1808237:1808254
1793136:1793153	attL	ATATTATTGTTCTTCTTT	NA	NA	NA	NA
WP_000813311.1|1793859_1794372_-	hypothetical protein	NA	Q4ZE83	Staphylococcus_phage	100.0	1.4e-69
WP_073392942.1|1794489_1794927_-	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	58.2	9.8e-27
WP_000801980.1|1795068_1796037_-	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	2.7e-24
WP_001293071.1|1796313_1796883_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	4.6e-101
WP_001656917.1|1796879_1797092_-	hypothetical protein	NA	Q4ZE86	Staphylococcus_phage	97.1	5.4e-31
WP_000771361.1|1797223_1797751_-|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	100.0	6.8e-91
WP_000214170.1|1797803_1798457_-	hypothetical protein	NA	Q4ZE82	Staphylococcus_phage	99.5	7.6e-116
WP_001288442.1|1798487_1798832_-	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	91.7	1.3e-50
WP_001019762.1|1799539_1800181_-	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	92.5	4.7e-110
WP_000356942.1|1800177_1800558_-	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	96.8	1.7e-67
WP_000447468.1|1800867_1802577_-	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	92.8	8.2e-303
WP_001002709.1|1802590_1803460_-	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	96.2	5.3e-165
WP_001103967.1|1803524_1803851_-	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	96.3	3.5e-53
WP_000403837.1|1803851_1804235_-	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	4.8e-62
WP_001231376.1|1804236_1804440_-	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	98.5	2.0e-30
WP_000784892.1|1804406_1804580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138305.1|1804591_1804864_-	winged helix-turn-helix domain-containing protein	NA	Q4ZE77	Staphylococcus_phage	94.4	1.2e-43
WP_001611932.1|1804864_1805029_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000230361.1|1805177_1805801_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000270135.1|1805961_1807176_+|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	97.3	3.3e-221
WP_000400841.1|1807288_1808008_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q4ZE81	Staphylococcus_phage	29.8	3.7e-23
WP_000897044.1|1808239_1808482_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
1808237:1808254	attR	ATATTATTGTTCTTCTTT	NA	NA	NA	NA
WP_000934799.1|1808533_1809037_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1809057_1809354_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1809597_1809789_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1809874_1810972_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1810983_1811187_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373076.1|1811216_1812098_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001573568.1|1812251_1813097_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_070879978.1|1813760_1814864_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 131
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1824785	1825628	2933430		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209478.1|1824785_1825628_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.2	4.5e-12
>prophage 132
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1847038	1849773	2933430		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280814.1|1847038_1848061_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.1	6.7e-10
WP_001191936.1|1848038_1848983_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449073.1|1848972_1849773_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	44.4	1.5e-41
>prophage 133
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1868010	1868688	2933430		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911024.1|1868010_1868688_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.2e-31
>prophage 134
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1882740	1887189	2933430		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549309.1|1882740_1887189_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.7	1.7e-28
>prophage 135
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1897792	1899454	2933430		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000570080.1|1897792_1898452_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	5.8e-23
WP_000736790.1|1898503_1899454_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 136
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1908261	1909698	2933430		Pandoravirus(100.0%)	1	NA	NA
WP_000163995.1|1908261_1909698_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.0	1.3e-30
>prophage 137
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1916206	1920750	2933430		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925396.1|1916206_1917946_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	2.0e-62
WP_000608835.1|1918211_1918886_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975347.1|1919025_1920750_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 138
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1938884	1940414	2933430		Vibrio_phage(100.0%)	1	NA	NA
WP_000838204.1|1938884_1940414_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 139
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1950099	1951605	2933430		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008395.1|1950099_1951605_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 140
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1962566	1967925	2933430		Tetraselmis_virus(50.0%)	3	NA	NA
WP_031880698.1|1962566_1964816_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.2	5.7e-187
WP_000837114.1|1965403_1966372_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_160176526.1|1966368_1967925_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	26.2	6.9e-14
>prophage 141
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1978236	1980295	2933430		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818914.1|1978236_1979334_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166911.1|1979716_1980295_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	43.0	1.6e-13
>prophage 142
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	1988106	1989699	2933430		Planktothrix_phage(100.0%)	1	NA	NA
WP_000067363.1|1988106_1989699_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	5.4e-22
>prophage 143
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2005791	2006976	2933430		Klosneuvirus(100.0%)	1	NA	NA
WP_001084444.1|2005791_2006976_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.6	2.4e-35
>prophage 144
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2011834	2022118	2933430		Tupanvirus(50.0%)	3	NA	NA
WP_000605273.1|2011834_2019010_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.9	3.4e-68
WP_000826855.1|2019456_2020707_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706134.1|2021092_2022118_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 145
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2025654	2028653	2933430		Bacillus_virus(50.0%)	4	NA	NA
WP_000590840.1|2025654_2026395_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	6.5e-39
WP_000171926.1|2026736_2027249_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356967.1|2027428_2027632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013476.1|2027693_2028653_-	cation transporter	NA	A0A1V0SED0	Indivirus	33.6	2.8e-10
>prophage 146
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2031994	2034479	2933430		Catovirus(50.0%)	2	NA	NA
WP_000723445.1|2031994_2033140_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	3.2e-24
WP_000779509.1|2033216_2034479_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	2.5e-22
>prophage 147
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2041496	2048061	2933430		Catovirus(50.0%)	6	NA	NA
WP_000413167.1|2041496_2042621_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	3.9e-128
WP_001028294.1|2042624_2043734_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|2043746_2044775_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940769.1|2044764_2046588_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.4	3.0e-29
WP_000565301.1|2046607_2047372_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037317.1|2047374_2048061_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	8.2e-28
>prophage 148
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2052084	2053260	2933430		Clostridium_phage(100.0%)	1	NA	NA
WP_000469818.1|2052084_2053260_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.9	5.2e-30
>prophage 149
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2058718	2059492	2933430		Staphylococcus_phage(100.0%)	1	NA	NA
WP_031880696.1|2058718_2059492_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	1.4e-12
>prophage 150
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2067378	2067978	2933430		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|2067378_2067978_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 151
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2072912	2078007	2933430		Catovirus(50.0%)	5	NA	NA
WP_001793810.1|2072912_2073893_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.3	1.3e-47
WP_000183771.1|2074227_2075004_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414632.1|2075214_2075841_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|2076036_2076801_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223717.1|2076804_2078007_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.3	5.1e-09
>prophage 152
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2086273	2090483	2933430		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|2086273_2087254_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045124.1|2087484_2088477_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000925002.1|2088492_2089488_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136645.1|2089484_2090483_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.6e-14
>prophage 153
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2122554	2127889	2933430	transposase	Acidithiobacillus_phage(33.33%)	5	NA	NA
WP_000649665.1|2122554_2124255_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	26.8	4.1e-20
WP_001794509.1|2124544_2124919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|2125104_2126052_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000370465.1|2126056_2126572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088356251.1|2126759_2127889_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.0	6.4e-78
>prophage 154
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2133769	2143765	2933430		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2133769_2134570_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104171.1|2134957_2135746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060146.1|2135746_2137081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871610.1|2137073_2138900_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	2.1e-30
WP_000101976.1|2138912_2139614_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2140803_2142087_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2142364_2143765_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 155
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2150447	2159484	2933430	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884337.1|2150447_2151734_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177483.1|2152111_2153626_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	4.4e-90
WP_000449218.1|2153951_2154764_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819098.1|2154852_2157513_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.8	4.6e-119
WP_000255583.1|2157549_2159484_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	4.4e-143
>prophage 156
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2169571	2172871	2933430		Faecalibacterium_phage(33.33%)	5	NA	NA
WP_000742840.1|2169571_2170411_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.4	1.4e-05
WP_000491382.1|2170905_2171259_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|2171326_2171722_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054111.1|2171974_2172544_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	34.8	2.8e-05
WP_001059079.1|2172670_2172871_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
>prophage 157
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2178664	2179423	2933430		Planktothrix_phage(100.0%)	1	NA	NA
WP_160176529.1|2178664_2179423_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.0	3.4e-35
>prophage 158
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2196566	2198279	2933430		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138663.1|2196566_2198279_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	5.4e-20
>prophage 159
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2203907	2204921	2933430		Faustovirus(100.0%)	1	NA	NA
WP_000639198.1|2203907_2204921_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	22.2	8.2e-08
>prophage 160
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2217312	2218005	2933430		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185860.1|2217312_2218005_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 161
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2241881	2243741	2933430		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125631.1|2241881_2243741_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 162
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2269434	2271185	2933430		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143418.1|2269434_2270322_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	7.4e-05
WP_000923764.1|2270429_2271185_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.8e-31
>prophage 163
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2274622	2275120	2933430		Canarypox_virus(100.0%)	1	NA	NA
WP_001065267.1|2274622_2275120_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	2.4e-21
>prophage 164
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2280170	2282554	2933430		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071721.1|2280170_2282021_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.9	1.3e-234
WP_000173336.1|2282017_2282554_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	47.5	1.1e-40
>prophage 165
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2287430	2297541	2933430	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2287430_2289140_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2289417_2289630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028789.1|2289909_2290353_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172333.1|2290546_2292145_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.6	2.6e-77
WP_001793854.1|2292204_2292405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2292831_2294328_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031407.1|2294520_2295411_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237625.1|2295533_2295950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030061.1|2296203_2297541_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	6.7e-18
>prophage 166
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2325697	2328897	2933430		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751265.1|2325697_2326399_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.8	2.1e-39
WP_000379825.1|2327085_2328897_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 167
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2337342	2341797	2933430		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161364.1|2337342_2338341_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	2.6e-35
WP_000076662.1|2338430_2338637_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024137.1|2339388_2341797_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	2.9e-128
>prophage 168
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2351038	2354028	2933430	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001063330.1|2351038_2353144_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.5	6.9e-118
WP_000262597.1|2353506_2354028_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	2.4e-27
>prophage 169
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2360452	2366835	2933430		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062662.1|2360452_2362192_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
WP_000473682.1|2362491_2364558_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2364937_2365348_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240663.1|2365389_2365746_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228158.1|2365866_2366835_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	3.1e-12
>prophage 170
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2375659	2376652	2933430		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161541.1|2375659_2376652_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	9.7e-38
>prophage 171
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2386068	2386764	2933430		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382892.1|2386068_2386764_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	2.0e-37
>prophage 172
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2405363	2412539	2933430		Bacillus_phage(66.67%)	6	NA	NA
WP_000721330.1|2405363_2406230_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	4.4e-79
WP_001573690.1|2406356_2406665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678764.1|2406808_2407075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001793882.1|2407358_2409167_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.5	1.0e-93
WP_000755954.1|2409283_2409676_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000088715.1|2409677_2412539_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	1.2e-27
>prophage 173
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2416982	2417678	2933430		Bacillus_phage(100.0%)	1	NA	NA
WP_000217452.1|2416982_2417678_+	oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	5.1e-09
>prophage 174
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2423354	2424173	2933430		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824929.1|2423354_2424173_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.8	1.9e-10
>prophage 175
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2432238	2433796	2933430		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173876.1|2432238_2433054_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	6.1e-14
WP_000590515.1|2433046_2433796_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 176
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2440029	2444456	2933430		Bacillus_phage(50.0%)	4	NA	NA
WP_000923514.1|2440029_2440692_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.5	2.2e-17
WP_000072154.1|2440684_2441461_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026190.1|2441854_2443042_+	MFS transporter	NA	NA	NA	NA	NA
WP_031880751.1|2443103_2444456_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	3.0e-13
>prophage 177
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2447849	2449076	2933430		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000948990.1|2447849_2449076_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 178
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2467452	2473659	2933430		Bacillus_phage(66.67%)	5	NA	NA
WP_001176855.1|2467452_2468595_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.9	2.6e-55
WP_000779351.1|2468862_2469249_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2469382_2469490_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064829.1|2470137_2471901_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	1.6e-35
WP_000486505.1|2471925_2473659_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.5e-30
>prophage 179
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2477120	2482874	2933430		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971554.1|2477120_2478236_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.9	7.1e-21
WP_000286868.1|2478246_2478939_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200947.1|2478949_2479417_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_001056917.1|2479468_2480446_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	2.4e-142
WP_000916697.1|2480447_2481395_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	2.1e-138
WP_000594516.1|2481944_2482874_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.4	1.5e-120
>prophage 180
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2490767	2491499	2933430		Bacillus_virus(100.0%)	1	NA	NA
WP_000615467.1|2490767_2491499_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	1.3e-23
>prophage 181
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2508363	2509923	2933430		Escherichia_phage(100.0%)	1	NA	NA
WP_160176534.1|2508363_2509923_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	3.4e-21
>prophage 182
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2520653	2522300	2933430	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_000277741.1|2520653_2522300_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 183
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2533241	2534276	2933430		Bacillus_virus(100.0%)	1	NA	NA
WP_000655979.1|2533241_2534276_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	1.7e-16
>prophage 184
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2544739	2551296	2933430		Staphylococcus_phage(25.0%)	8	NA	NA
WP_000388431.1|2544739_2545468_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	6.7e-28
WP_160176537.1|2545601_2546165_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000793166.1|2546341_2546797_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_000977031.1|2546793_2547237_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_031880689.1|2547399_2548773_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.3	8.7e-13
WP_000249492.1|2548765_2549440_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	44.7	8.0e-52
WP_000761409.1|2549575_2550631_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229922.1|2550630_2551296_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	7.2e-37
>prophage 185
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2555033	2556242	2933430		Salmonella_phage(100.0%)	1	NA	NA
WP_000999130.1|2555033_2556242_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.5	3.0e-33
>prophage 186
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2568897	2569797	2933430		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524842.1|2568897_2569797_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.7e-15
>prophage 187
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2577154	2577574	2933430		Bacillus_phage(100.0%)	1	NA	NA
WP_000920241.1|2577154_2577574_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	7.7e-37
>prophage 188
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2583205	2584087	2933430		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730056.1|2583205_2584087_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	1.7e-62
>prophage 189
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2591966	2592602	2933430		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285452.1|2591966_2592602_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.6	7.1e-10
>prophage 190
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2605606	2609873	2933430		Staphylococcus_phage(50.0%)	4	NA	NA
WP_072460394.1|2605606_2606245_+	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	47.4	4.5e-36
WP_000684154.1|2606853_2607978_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.6e-12
WP_000417008.1|2608069_2609023_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.2	5.8e-32
WP_000737700.1|2609381_2609873_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 191
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2613793	2614603	2933430		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717395.1|2613793_2614603_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 192
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2633576	2634182	2933430		Pithovirus(100.0%)	1	NA	NA
WP_000913006.1|2633576_2634182_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 193
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2646149	2649317	2933430		Leptospira_phage(100.0%)	1	NA	NA
WP_000592290.1|2646149_2649317_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	4.3e-63
>prophage 194
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2672496	2676106	2933430	transposase	Paenibacillus_phage(33.33%)	3	NA	NA
WP_094409958.1|2672496_2674064_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000389651.1|2674439_2675249_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.8	1.4e-18
WP_000586768.1|2675245_2676106_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.4e-10
>prophage 195
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2679147	2687710	2933430		Mycobacterium_phage(33.33%)	8	NA	NA
WP_000204271.1|2679147_2680584_+	MarR family transcriptional regulator	NA	A0A088F7M4	Mycobacterium_phage	31.2	5.5e-58
WP_000136272.1|2680832_2681012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791584.1|2681661_2681844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130145.1|2682313_2683978_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	4.7e-45
WP_000179061.1|2684014_2684719_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000769709.1|2685109_2685535_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044369.1|2685829_2686645_+	hydrolase	NA	NA	NA	NA	NA
WP_001044451.1|2686855_2687710_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	34.8	1.3e-06
>prophage 196
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2691088	2694151	2933430		Staphylococcus_phage(50.0%)	5	NA	NA
WP_001015495.1|2691088_2691937_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.4	1.3e-43
WP_001573519.1|2692157_2692283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293423.1|2692237_2692531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333457.1|2692544_2693153_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_001573518.1|2693410_2694151_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	30.3	7.3e-14
>prophage 197
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2700471	2701884	2933430		Pandoravirus(100.0%)	1	NA	NA
WP_000169223.1|2700471_2701884_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	5.0e-48
>prophage 198
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2705852	2707415	2933430		Vibrio_phage(100.0%)	1	NA	NA
WP_000792332.1|2705852_2707415_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	3.5e-18
>prophage 199
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2717618	2718587	2933430		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2717618_2718587_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 200
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2734387	2735296	2933430		Klosneuvirus(100.0%)	1	NA	NA
WP_000162591.1|2734387_2735296_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.7	1.2e-26
>prophage 201
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2738648	2740295	2933430	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_000277741.1|2738648_2740295_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 202
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2754354	2761772	2933430	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000334466.1|2754354_2756160_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.6	2.6e-97
WP_000908186.1|2756391_2757174_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	5.7e-09
WP_000370937.1|2757241_2758099_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001792784.1|2758757_2758916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073392962.1|2759595_2759700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277741.1|2760125_2761772_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 203
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2770278	2775774	2933430	transposase	Clostridium_phage(33.33%)	5	NA	NA
WP_000070866.1|2770278_2770722_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_094409958.1|2770827_2772395_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000160304.1|2772505_2773216_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083335.1|2773530_2774193_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242308.1|2774472_2775774_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.7	1.4e-132
>prophage 204
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2783707	2785318	2933430		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2783707_2785318_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 205
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2793121	2800874	2933430		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2793121_2793721_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460244.1|2793721_2794798_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248730.1|2794784_2795621_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001801520.1|2795653_2796751_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697334.1|2796747_2797167_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654191.1|2797273_2797798_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2797824_2799063_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2799090_2799720_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723407.1|2799743_2800874_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.1	1.0e-27
>prophage 206
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2811591	2811987	2933430		Bacillus_phage(100.0%)	1	NA	NA
WP_000932696.1|2811591_2811987_+	single-stranded DNA-binding protein	NA	A0A1B1PAE7	Bacillus_phage	36.8	3.0e-14
>prophage 207
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2818096	2818744	2933430		Moumouvirus(100.0%)	1	NA	NA
WP_001187612.1|2818096_2818744_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	4.7e-09
>prophage 208
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2826936	2828457	2933430		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_160176545.1|2826936_2828457_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	1.2e-58
>prophage 209
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2834131	2836159	2933430		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546609.1|2834131_2836159_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.6	3.9e-25
>prophage 210
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2841309	2844693	2933430		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621176.1|2841309_2841672_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2842020_2843022_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2843140_2843467_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190825.1|2843468_2843948_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041107.1|2843922_2844693_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 211
NZ_CP047801	Staphylococcus aureus strain UP_248 chromosome, complete genome	2933430	2858806	2932960	2933430	integrase,protease,tRNA,transposase,coat,terminase	Staphylococcus_phage(77.27%)	94	2904029:2904045	2925564:2925580
WP_000094572.1|2858806_2860336_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.6	9.4e-08
WP_072399972.1|2860365_2861385_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2861506_2861761_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047828.1|2861760_2863530_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	4.1e-63
WP_001255785.1|2863557_2865246_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_001791591.1|2865563_2865719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072435118.1|2865783_2866218_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_001086735.1|2866198_2866861_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000372755.1|2866833_2867298_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000159047.1|2867290_2868316_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	3.1e-63
WP_000106312.1|2868629_2870240_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	27.4	5.1e-20
WP_001791590.1|2870334_2870463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602046.1|2870607_2872536_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.1	3.2e-53
WP_001283612.1|2872788_2873424_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_073392939.1|2873780_2874809_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581078.1|2874868_2875093_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052261.1|2875301_2876552_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	9.0e-41
WP_000790325.1|2876735_2877686_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791588.1|2877834_2879319_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.8	5.2e-19
WP_001253292.1|2879315_2880275_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688492.1|2880648_2881365_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
WP_073392933.1|2881383_2882619_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_000735197.1|2882700_2882841_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_001105709.1|2882844_2883408_-	accessory gene regulator AgrB	NA	NA	NA	NA	NA
WP_001549197.1|2883643_2883778_+	delta-lysin family phenol-soluble modulin	NA	NA	NA	NA	NA
WP_094409958.1|2884143_2885710_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000867948.1|2886043_2886829_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_000522388.1|2887189_2887816_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_000120330.1|2888012_2889227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197638.1|2889251_2889995_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917289.1|2890169_2890454_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240651.1|2890529_2892146_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
WP_000179345.1|2892214_2893387_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	98.2	3.5e-220
WP_000620857.1|2893400_2894075_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
WP_000153640.1|2894247_2894466_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
WP_000481967.1|2894470_2894788_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
WP_000708433.1|2894784_2894940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231378.1|2894924_2895128_+	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	97.0	7.5e-30
WP_000403839.1|2895129_2895513_+	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	9.7e-63
WP_001103930.1|2895513_2895831_+	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	58.2	1.6e-18
WP_001002721.1|2895894_2896764_+	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	99.3	6.0e-169
WP_000447451.1|2896777_2898487_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	100.0	0.0e+00
WP_000356937.1|2898798_2899179_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	100.0	6.9e-69
WP_001019766.1|2899175_2899817_+	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	94.8	3.5e-113
WP_001190608.1|2900352_2900694_+	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	98.2	7.1e-57
WP_000846285.1|2900705_2901284_+	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
WP_000448775.1|2901301_2901520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000771368.1|2901570_2902098_+|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_000358778.1|2902100_2902442_+	hypothetical protein	NA	A0A1W6JQM3	Staphylococcus_phage	100.0	1.7e-58
WP_001293073.1|2902438_2903008_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	3.5e-101
2904029:2904045	attL	AACATTTTAAAGTTACA	NA	NA	NA	NA
WP_000812237.1|2904285_2904513_+	hypothetical protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	47.4	1.9e-13
WP_001239269.1|2905367_2906303_-	TDT family transporter	NA	NA	NA	NA	NA
WP_000201397.1|2907421_2907601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573769.1|2907597_2907894_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	40.4	6.7e-11
WP_001573771.1|2907883_2908225_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	46.0	4.1e-20
WP_001045073.1|2908802_2910110_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_000206618.1|2910548_2911772_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_000791402.1|2912204_2913260_+	succinyl-diaminopimelate desuccinylase	NA	A0A2I6PER8	Staphylococcus_phage	34.6	7.9e-38
WP_000595617.1|2913281_2914301_+	beta-channel forming cytolysin	NA	A0A2I6PEU3	Staphylococcus_phage	39.6	3.4e-54
WP_000857191.1|2915440_2916478_-|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	100.0	9.1e-180
WP_000825947.1|2916536_2917001_-	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
WP_000705248.1|2917100_2917283_-	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
WP_000591749.1|2917486_2917828_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
WP_000759682.1|2917833_2918766_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
WP_001031454.1|2918781_2919495_-	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_001801500.1|2919457_2919631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854072.1|2919627_2919891_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
WP_001025874.1|2919906_2920122_+	DUF2829 domain-containing protein	NA	A0EWV9	Staphylococcus_phage	100.0	6.3e-35
WP_000128907.1|2920110_2920440_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
WP_001148605.1|2920490_2921243_+	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_001148855.1|2921258_2921456_+	hypothetical protein	NA	Q8SDM8	Staphylococcus_phage	100.0	7.0e-33
WP_000939496.1|2921486_2921627_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
WP_000275058.1|2921641_2922274_-	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
WP_001120197.1|2922332_2922653_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_000066017.1|2922649_2922811_+	DUF1270 domain-containing protein	NA	D2JGJ6	Staphylococcus_phage	100.0	4.3e-20
WP_000165375.1|2922905_2923232_+	DUF2482 family protein	NA	W5RAK4	Staphylococcus_phage	100.0	1.2e-53
WP_000291503.1|2923212_2923473_+	DUF1108 family protein	NA	A0EWW8	Staphylococcus_phage	100.0	8.9e-44
WP_001205732.1|2923481_2923745_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700577.1|2923753_2925697_+	AAA family ATPase	NA	A0EWX0	Staphylococcus_phage	100.0	0.0e+00
2925564:2925580	attR	AACATTTTAAAGTTACA	NA	NA	NA	NA
WP_000138472.1|2925698_2926619_+	recombinase	NA	S4SUN6	Staphylococcus_phage	100.0	2.3e-166
WP_071621397.1|2926699_2927317_+	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
WP_000934764.1|2927317_2927788_+	single-stranded DNA-binding protein	NA	A0EWX3	Staphylococcus_phage	100.0	7.4e-81
WP_000338531.1|2928719_2928938_+	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	98.6	1.2e-36
WP_000101274.1|2929268_2929637_+	hypothetical protein	NA	W5RAK8	Staphylococcus_phage	100.0	8.2e-51
WP_000131366.1|2929640_2929883_+	hypothetical protein	NA	A0EWX8	Staphylococcus_phage	100.0	3.9e-41
WP_001065091.1|2930054_2930306_+	DUF1024 family protein	NA	A0EWY0	Staphylococcus_phage	100.0	1.9e-38
WP_000028422.1|2930295_2930478_+	hypothetical protein	NA	A0EWY1	Staphylococcus_phage	100.0	2.6e-26
WP_000185659.1|2930470_2931013_+	dUTP pyrophosphatase	NA	A0EWY2	Staphylococcus_phage	100.0	1.1e-96
WP_000195803.1|2931049_2931256_+	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_000592207.1|2931252_2931639_+	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	3.0e-64
WP_000595265.1|2931635_2931785_+	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_000265043.1|2931784_2931985_+	DUF1514 domain-containing protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
WP_000590122.1|2932012_2932429_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988336.1|2932660_2932960_+	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
