The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	0	45553	2738812	capsid,portal,tail,integrase,head,protease,terminase,holin	Staphylococcus_phage(93.55%)	47	39689:39705	47123:47139
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000154555.1|3609_4755_+|capsid	phage major capsid protein	capsid	A0A1X9H072	Staphylococcus_phage	100.0	5.6e-215
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114225.1|5675_6080_+	hypothetical protein	NA	A0A2I6PDJ6	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268741.1|6484_7129_+|tail	phage tail protein	tail	W5R9H4	Staphylococcus_phage	100.0	6.5e-120
WP_072050172.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	98.6	8.8e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_047928553.1|8039_12569_+|tail	phage tail tape measure protein	tail	A0A1X9H084	Staphylococcus_phage	99.9	0.0e+00
WP_000567408.1|12565_14050_+|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	100.0	1.2e-297
WP_000582177.1|14065_17848_+	hypothetical protein	NA	A0A068A201	Staphylococcus_phage	99.8	0.0e+00
WP_001000058.1|17840_17993_+	hypothetical protein	NA	A0A1W6JPL6	Staphylococcus_phage	100.0	7.6e-19
WP_001262620.1|18038_18326_+	hypothetical protein	NA	C5I682	Staphylococcus_phage	100.0	9.9e-44
WP_000340977.1|18381_18756_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_072357969.1|18898_19075_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	96.6	6.5e-22
WP_031762631.1|19127_19235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|19286_19541_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|19552_20308_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000920041.1|20498_20990_+	staphylokinase	NA	A7TWR8	Staphylococcus_phage	100.0	8.0e-86
WP_000727643.1|22067_22517_-	chemotaxis-inhibiting protein CHIPS	NA	A7TWR9	Staphylococcus_phage	100.0	1.5e-78
WP_000702262.1|23199_23550_+	complement inhibitor SCIN-A	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|23602_23863_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|24173_24353_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_053040876.1|25310_27359_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_001068542.1|27682_28969_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|29168_29267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681968.1|29509_29686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|29944_30325_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991302.1|30321_31218_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645728.1|31218_31899_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|31895_32768_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
WP_047928552.1|32767_33508_+	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
WP_000182842.1|33573_34137_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_160176424.1|34257_34782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033971.1|34841_35399_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000713072.1|35395_36238_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_001188077.1|36294_37335_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_000267034.1|37785_37959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905733.1|38981_40133_+|integrase	tyrosine-type recombinase/integrase	integrase	P97010	Streptococcus_pyogenes_phage	32.2	8.1e-12
39689:39705	attL	AATAGTTTTGAAAAATA	NA	NA	NA	NA
WP_106905822.1|40171_42199_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106905732.1|42557_43946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905731.1|43988_44408_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	50.4	1.5e-27
WP_020977410.1|44707_45553_-	penicillin-hydrolyzing class A beta-lactamase BlaZ	NA	A0A1B0VBP7	Salmonella_phage	33.9	1.3e-30
47123:47139	attR	AATAGTTTTGAAAAATA	NA	NA	NA	NA
>prophage 2
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	52172	54202	2738812		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|52172_52733_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275707.1|53104_54202_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.9	2.5e-47
>prophage 3
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	58231	60515	2738812		Bacillus_virus(100.0%)	2	NA	NA
WP_000284433.1|58231_59701_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	3.5e-108
WP_000040866.1|59693_60515_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 4
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	64176	70943	2738812		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|64176_65472_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|65580_65883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272071.1|66054_66747_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992921.1|66743_68936_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_047928545.1|68939_70943_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	35.9	3.7e-113
>prophage 5
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	78058	83087	2738812		Catovirus(33.33%)	5	NA	NA
WP_001231451.1|78058_79006_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-16
WP_001147869.1|79086_80448_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.8	1.1e-103
WP_000548775.1|80617_81148_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140172.1|81394_82465_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|82532_83087_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 6
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	86539	86953	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001670387.1|86539_86953_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	39.1	5.1e-17
>prophage 7
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	91946	92576	2738812		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|91946_92576_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 8
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	108056	109793	2738812		Bacillus_phage(100.0%)	1	NA	NA
WP_000597239.1|108056_109793_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 9
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	126240	126969	2738812		Planktothrix_phage(100.0%)	1	NA	NA
WP_078104172.1|126240_126969_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	1.3e-36
>prophage 10
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	137852	138197	2738812		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|137852_138197_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 11
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	147786	148527	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|147786_148527_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 12
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	156300	160564	2738812		Staphylococcus_phage(80.0%)	5	NA	NA
WP_129409671.1|156300_157083_+	staphylococcal enterotoxin type O	NA	A0A1X9H080	Staphylococcus_phage	36.7	1.4e-31
WP_047928530.1|157363_158083_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	35.8	2.3e-25
WP_000713847.1|158117_158846_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.2	1.1e-27
WP_000764689.1|158999_159770_+	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	43.2	1.4e-44
WP_001236364.1|159808_160564_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	41.0	1.0e-39
>prophage 13
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	164306	165401	2738812	transposase	Staphylococcus_phage(100.0%)	2	NA	NA
WP_001792814.1|164306_164435_-|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	66.7	6.6e-08
WP_000209099.1|164612_165401_-	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	95.0	1.3e-138
>prophage 14
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	168753	172545	2738812		Staphylococcus_phage(100.0%)	3	NA	NA
WP_001092773.1|168753_169335_-	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	63.2	4.6e-56
WP_047928525.1|169730_171287_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	97.7	6.3e-286
WP_000072555.1|171279_172545_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	34.3	5.2e-44
>prophage 15
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	177623	224727	2738812	protease,tRNA	Staphylococcus_phage(91.89%)	44	NA	NA
WP_000764922.1|177623_178376_-	hypothetical protein	NA	A0A097PAT7	Streptococcus_pyogenes_phage	47.2	4.4e-51
WP_031775015.1|178402_179128_-	enterotoxin	NA	A0EX09	Staphylococcus_phage	33.5	4.0e-25
WP_000669028.1|179172_179799_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	93.8	3.9e-93
WP_000070649.1|179872_180868_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	4.2e-73
WP_078104171.1|180948_181599_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	83.8	1.6e-41
WP_076692541.1|181901_182357_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	98.6	1.2e-78
WP_000348379.1|182515_183994_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	100.0	1.5e-289
WP_000778516.1|183998_185000_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	98.2	9.7e-187
WP_000718110.1|184996_185254_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	98.8	3.6e-45
WP_078098768.1|185319_185793_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	97.5	1.4e-82
WP_016169057.1|185797_186544_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	99.2	2.2e-143
WP_000109906.1|186921_188514_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
WP_000933822.1|188885_190079_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
WP_000366163.1|190203_191112_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
WP_000453298.1|191323_192157_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
WP_000623478.1|192540_192894_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	100.0	2.6e-22
WP_001200542.1|192890_193256_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_047928516.1|193511_193814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|194073_194787_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_001168907.1|195226_195862_-|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_047928515.1|196157_196601_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.0	9.2e-57
WP_001153742.1|196587_197031_-	competence protein ComK	NA	NA	NA	NA	NA
WP_047928513.1|197143_197614_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	98.7	3.0e-82
WP_000384171.1|197812_198037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|198312_199167_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000163235.1|199461_199857_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	100.0	6.3e-73
WP_000989121.1|199874_201167_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
WP_000221177.1|201166_201481_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
WP_001261669.1|202003_203506_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	100.0	2.3e-30
WP_025174259.1|203998_205030_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	2.0e-195
WP_000493888.1|205036_205669_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	100.0	3.4e-113
WP_001159035.1|205679_206861_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	100.0	1.7e-227
WP_001008549.1|206873_207338_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
WP_001196345.1|207459_208461_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	100.0	3.1e-185
WP_001790712.1|208572_208692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266096.1|208694_209522_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|210092_210494_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764419.1|210613_211177_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
WP_000526539.1|211173_212127_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_001025061.1|212236_213418_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	100.0	5.6e-218
WP_160176427.1|213708_216123_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.2	0.0e+00
WP_160176428.1|216144_216456_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	99.0	4.8e-52
WP_160176429.1|216781_223342_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	96.2	2.1e-298
WP_000285020.1|223458_224727_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	9.1e-57
>prophage 16
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	236160	241488	2738812		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|236160_237018_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048368.1|237046_237643_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_031775255.1|237663_241488_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.0e-83
>prophage 17
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	248239	251941	2738812		Tupanvirus(50.0%)	3	NA	NA
WP_047928504.1|248239_249409_-	acetoin utilization protein AcuC	NA	A0A2K9L0I3	Tupanvirus	37.0	7.4e-21
WP_001015996.1|249433_250066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000862083.1|250234_251941_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	100.0	1.2e-274
>prophage 18
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	258558	261189	2738812	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|258558_259821_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279338.1|259914_261189_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 19
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	264958	269093	2738812		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808837.1|264958_266563_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291419.1|266549_267710_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553927.1|267823_268270_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174285.1|268349_269093_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.0	4.9e-18
>prophage 20
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	286825	290023	2738812		Streptomyces_phage(100.0%)	1	NA	NA
WP_031586435.1|286825_290023_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	1.3e-136
>prophage 21
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	294956	296714	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232648.1|294956_296714_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
>prophage 22
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	303575	311739	2738812		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080028.1|303575_304280_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_072361851.1|304279_305941_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_000849439.1|306439_307927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038305.1|308220_310851_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_001114466.1|310866_311739_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	38.2	2.6e-42
>prophage 23
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	315654	326807	2738812	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|315654_316575_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_001790562.1|316667_316790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|316987_318925_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049154.1|319350_320844_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791162.1|321072_321600_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_001125540.1|321628_321829_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|321875_322232_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032657.1|322373_322982_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
WP_047928497.1|323000_323930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|323934_324045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127573.1|324092_325394_+	trigger factor	NA	NA	NA	NA	NA
WP_000472302.1|325544_326807_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.0	5.0e-140
>prophage 24
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	336374	339005	2738812	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000425353.1|336374_339005_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.7	3.7e-153
>prophage 25
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	348938	384435	2738812	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|348938_349943_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019178.1|349944_350970_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|350992_352132_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|352150_352411_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749795.1|352685_354965_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000594985.1|355167_357441_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	1.1e-63
WP_000364542.1|357462_357981_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058587.1|358408_360598_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869983.1|360609_361062_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|361058_361934_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_061743889.1|362394_363657_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044799.1|363672_365439_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001808039.1|365771_365900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682646.1|365899_366673_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102731.1|366833_368108_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.7	1.4e-105
WP_000704122.1|368192_368615_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|368714_368897_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000009238.1|368936_369083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985895.1|369319_370333_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409167.1|370644_371787_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000066097.1|371787_372906_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567018.1|373484_374153_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_047928487.1|374154_376632_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.4	1.1e-66
WP_047928486.1|376974_379605_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|379667_379928_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|379931_380360_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|380374_380683_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342266.1|380967_381606_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137779.1|381608_382532_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|382543_383812_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|383811_384435_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 26
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	399284	405448	2738812		Bacillus_phage(33.33%)	5	NA	NA
WP_000439693.1|399284_399746_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_000953299.1|399804_401952_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	1.6e-32
WP_001282563.1|402008_402983_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|403027_403279_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368345.1|403624_405448_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	8.0e-22
>prophage 27
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	408938	412046	2738812		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|408938_410771_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_047928473.1|410906_412046_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
>prophage 28
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	418516	419464	2738812		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|418516_419464_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 29
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	422517	436263	2738812	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|422517_423909_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001797828.1|424243_424867_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411301.1|424877_425696_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217244.1|425756_427574_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.6e-54
WP_001283055.1|427797_428904_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_023914705.1|429034_429712_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683936.1|429714_430815_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	29.6	5.2e-08
WP_001062177.1|430928_432275_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
WP_000924220.1|432284_433175_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	36.0	3.4e-26
WP_031775221.1|433300_434086_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	1.0e-18
WP_000564316.1|434127_434991_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|434977_435388_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|435663_436263_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 30
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	442436	443060	2738812		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|442436_443060_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 31
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	448604	451416	2738812		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019690.1|448604_449951_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.9	5.7e-65
WP_000202188.1|449943_451416_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
>prophage 32
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	458915	465484	2738812		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|458915_460253_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159865.1|460245_460476_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183375.1|460453_461335_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	26.1	8.9e-11
WP_001124985.1|461766_462219_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942210.1|462234_463914_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_047928467.1|464062_465484_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	3.9e-40
>prophage 33
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	472313	473720	2738812		Synechococcus_phage(100.0%)	1	NA	NA
WP_160176431.1|472313_473720_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	30.8	4.7e-30
>prophage 34
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	480147	481632	2738812		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|480147_481632_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 35
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	485159	493444	2738812		Klosneuvirus(20.0%)	10	NA	NA
WP_001171351.1|485159_486068_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.5	3.4e-05
WP_000365246.1|486149_486692_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_047928465.1|486796_487246_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000447733.1|487294_488182_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183436.1|488259_488766_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273371.1|488857_489589_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	7.9e-05
WP_160176432.1|489581_490124_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|490116_490854_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|490986_491712_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987774.1|491692_493444_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.2	2.2e-21
>prophage 36
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	497073	499752	2738812		Bacillus_phage(50.0%)	3	NA	NA
WP_001151997.1|497073_497322_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_047928464.1|497429_498383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902099.1|498372_499752_+	ATP-dependent DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	33.6	1.4e-55
>prophage 37
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	509176	514643	2738812		Bacillus_phage(25.0%)	7	NA	NA
WP_001043863.1|509176_509449_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|509879_510452_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_047928462.1|510454_511180_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001817755.1|511196_512141_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|512232_512682_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_000789522.1|512890_513091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001269921.1|513476_514643_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	31.8	5.8e-34
>prophage 38
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	518305	518881	2738812		Bacillus_virus(100.0%)	1	NA	NA
WP_000005212.1|518305_518881_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.1e-08
>prophage 39
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	522251	529757	2738812	tRNA	unidentified_phage(25.0%)	5	NA	NA
WP_000361552.1|522251_523454_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	1.9e-35
WP_000049923.1|523440_524412_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525078.1|524435_527129_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858789.1|527450_528743_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	1.9e-54
WP_000362220.1|529070_529757_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
>prophage 40
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	533497	534124	2738812		Bacillus_phage(100.0%)	1	NA	NA
WP_001108889.1|533497_534124_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 41
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	543449	544328	2738812		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|543449_544328_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 42
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	570309	579696	2738812		Staphylococcus_phage(60.0%)	13	NA	NA
WP_000282171.1|570309_571014_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
WP_001795441.1|571258_571453_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000691942.1|571464_571716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404645.1|571753_572878_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995287.1|572893_573331_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934887.1|573754_574711_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.3e-167
WP_000175746.1|574910_575390_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_047928450.1|575404_576244_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	77.3	2.3e-48
WP_000159900.1|576329_576863_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|576855_577284_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473653.1|577295_577796_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|577795_578017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342144.1|578205_579696_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.8	5.9e-23
>prophage 43
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	583105	585117	2738812		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|583105_583765_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166801.1|583761_585117_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 44
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	591282	592074	2738812		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|591282_592074_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 45
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	595614	600645	2738812	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138413.1|595614_596751_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001788788.1|596782_597412_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|597430_597700_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|597862_598171_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|598341_598542_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876201.1|598738_599140_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216946.1|599379_600645_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	6.2e-13
>prophage 46
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	608692	610294	2738812		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|608692_610294_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 47
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	615382	618836	2738812		Indivirus(50.0%)	3	NA	NA
WP_000079447.1|615382_616234_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-16
WP_000974847.1|616240_616882_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_160176435.1|617021_618836_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.0	1.1e-153
>prophage 48
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	622250	622952	2738812		Tupanvirus(100.0%)	1	NA	NA
WP_000571259.1|622250_622952_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	2.0e-13
>prophage 49
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	631050	633405	2738812		Acinetobacter_phage(100.0%)	3	NA	NA
WP_000153613.1|631050_631833_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	35.9	2.7e-27
WP_047928445.1|631834_632833_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.9	8.5e-34
WP_000604816.1|632838_633405_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
>prophage 50
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	637723	638986	2738812		Bacillus_phage(100.0%)	1	NA	NA
WP_000283016.1|637723_638986_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	2.6e-96
>prophage 51
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	648645	653039	2738812		Bacillus_phage(50.0%)	2	NA	NA
WP_001289579.1|648645_651048_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.7	4.2e-95
WP_001548666.1|651047_653039_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 52
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	658859	660506	2738812		Vibrio_phage(100.0%)	1	NA	NA
WP_001088978.1|658859_660506_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.5e-22
>prophage 53
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	664175	665297	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691284.1|664175_665297_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 54
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	669446	675102	2738812		Phage_Wrath(25.0%)	7	NA	NA
WP_001208760.1|669446_670070_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
WP_000380719.1|670449_671313_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	4.1e-16
WP_001791425.1|671386_671491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688122.1|671487_672465_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085655.1|672621_672891_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|673344_673494_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000082539.1|673584_675102_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
>prophage 55
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	685240	689517	2738812		Bacillus_phage(50.0%)	6	NA	NA
WP_061743908.1|685240_685774_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_047928441.1|685912_686101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202390.1|686214_686817_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670303.1|686813_687905_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603964.1|687908_688640_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072384901.1|688608_689517_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	3.4e-21
>prophage 56
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	693481	729432	2738812	portal,tail,integrase,head,terminase,holin,plate	Staphylococcus_phage(56.82%)	49	694851:694888	729587:729624
WP_001065797.1|693481_694822_-	hypothetical protein	NA	A0A1J0MF61	Staphylococcus_phage	58.9	1.1e-140
694851:694888	attL	GTACTGATCTCTTTCCCATTCAGATACTTGAGTTCTGT	NA	NA	NA	NA
WP_076692498.1|695064_695289_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	75.4	1.6e-20
WP_000477485.1|695715_696132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001808025.1|696579_697515_-	Abi family protein	NA	A0A059NT88	Lactococcus_phage	44.0	5.3e-70
WP_001808024.1|697735_697933_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	3.7e-10
WP_001140244.1|698401_699322_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JQL2	Staphylococcus_phage	50.8	1.0e-65
WP_000438657.1|699386_699776_-|holin	phage holin family protein	holin	A0A1S6L1J2	Staphylococcus_phage	38.2	5.3e-16
WP_006190235.1|699788_701186_-|plate	phage baseplate upper protein	plate	A0A1J0MFK8	Staphylococcus_phage	44.7	2.6e-105
WP_000700623.1|701204_702218_-	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	52.6	6.5e-98
WP_047928440.1|702235_703921_-	hypothetical protein	NA	Q4ZE19	Staphylococcus_virus	46.5	1.4e-108
WP_000350618.1|703929_704865_-|tail	phage tail protein	tail	A0A1J0MF79	Staphylococcus_phage	55.9	2.1e-98
WP_160176437.1|704879_708050_-	hypothetical protein	NA	Q4ZE24	Staphylococcus_virus	54.5	1.6e-94
WP_001808026.1|708061_708415_-	hypothetical protein	NA	Q4ZE25	Staphylococcus_virus	72.3	1.7e-37
WP_000256347.1|708465_708810_-	hypothetical protein	NA	A0A1J0MFH0	Staphylococcus_phage	58.9	7.7e-35
WP_000276225.1|708871_709471_-|tail	phage major tail protein, TP901-1 family	tail	H9A0N8	Staphylococcus_phage	47.5	7.4e-17
WP_000680037.1|709482_709878_-	hypothetical protein	NA	H9A0N7	Staphylococcus_phage	42.3	1.9e-21
WP_001198140.1|709887_710238_-	hypothetical protein	NA	H9A0N6	Staphylococcus_phage	60.0	9.3e-36
WP_001106897.1|710238_710544_-	hypothetical protein	NA	Q4ZE30	Staphylococcus_virus	40.6	6.4e-17
WP_001010139.1|710543_710870_-|head,tail	phage head-tail connector protein	head,tail	Q4ZE31	Staphylococcus_virus	56.4	2.1e-26
WP_000104116.1|710885_711359_-	hypothetical protein	NA	A0A2H4J9T3	uncultured_Caudovirales_phage	31.6	9.7e-12
WP_000200243.1|711436_712348_-	hypothetical protein	NA	Q4ZE33	Staphylococcus_virus	59.7	6.5e-97
WP_000429653.1|712366_712945_-	DUF4355 domain-containing protein	NA	Q4ZE34	Staphylococcus_virus	50.8	1.9e-09
WP_031811279.1|712911_713040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078064796.1|713239_714229_-|head	head morphogenesis protein	head	Q4ZE35	Staphylococcus_virus	68.9	3.8e-50
WP_000158570.1|714758_716207_-|portal	phage portal protein	portal	Q4ZE36	Staphylococcus_virus	69.4	3.7e-195
WP_000207538.1|716219_717494_-|terminase	PBSX family phage terminase large subunit	terminase	Q4ZE37	Staphylococcus_virus	76.2	3.2e-195
WP_000090969.1|717480_717909_-	helix-turn-helix domain-containing protein	NA	A1EAE0	Streptococcus_phage	45.1	1.1e-25
WP_000653931.1|718061_718550_-	hypothetical protein	NA	R9TMH4	Paenibacillus_phage	28.3	8.7e-08
WP_000835355.1|718826_719291_-	hypothetical protein	NA	C9E2P0	Enterococcus_phage	43.0	3.2e-20
WP_106905708.1|719287_719395_-	DUF1381 domain-containing protein	NA	C8CH06	Staphylococcus_phage	87.5	1.2e-07
WP_031587073.1|719525_720056_-	nucleotide pyrophosphohydrolase	NA	A0A1P8VVP1	Streptococcus_phage	39.1	2.3e-22
WP_000860978.1|720048_720360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714411.1|720365_720524_-	hypothetical protein	NA	A0A0E3T9L7	Staphylococcus_phage	90.4	6.7e-18
WP_000946005.1|720538_720829_-	hypothetical protein	NA	A0A223LIA9	Staphylococcus_phage	58.1	7.2e-18
WP_000929466.1|720829_721732_-	DnaD domain protein	NA	A0A1P8L6F0	Staphylococcus_phage	52.0	2.9e-49
WP_072433566.1|721744_722239_-	single-stranded DNA-binding protein	NA	A7TWM8	Staphylococcus_phage	94.0	6.4e-83
WP_000907597.1|722319_723099_-	ATP-binding protein	NA	A0A1W6JPW0	Staphylococcus_phage	88.0	2.3e-127
WP_001004327.1|723099_723636_-	hypothetical protein	NA	A0A0H3U480	Staphylococcus_phage	82.5	1.7e-76
WP_000786634.1|723640_723907_-	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	53.6	3.0e-18
WP_000786993.1|723896_724214_-	DUF2482 family protein	NA	W5RAK4	Staphylococcus_phage	80.6	1.6e-39
WP_047928438.1|724300_724462_-	DUF1270 family protein	NA	R4IH12	Staphylococcus_phage	69.8	1.1e-12
WP_001157025.1|724560_725244_-	phage repressor protein	NA	A9CR56	Staphylococcus_phage	85.6	5.2e-107
WP_000800341.1|725304_725511_+	hypothetical protein	NA	A1BTY8	Staphylococcus_virus	75.0	3.3e-25
WP_000932238.1|725934_726210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001209962.1|726236_726455_-	DUF739 family protein	NA	A0A2I6PE94	Staphylococcus_phage	62.5	4.9e-19
WP_000664917.1|726622_727015_+	helix-turn-helix domain-containing protein	NA	A0A2I6PE55	Staphylococcus_phage	53.6	1.6e-28
WP_000554410.1|727161_727545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031587096.1|727556_728252_+	hypothetical protein	NA	A0A2H4J5B8	uncultured_Caudovirales_phage	50.3	1.4e-06
WP_001836882.1|728304_729432_+|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	31.4	6.2e-33
729587:729624	attR	GTACTGATCTCTTTCCCATTCAGATACTTGAGTTCTGT	NA	NA	NA	NA
>prophage 57
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	734148	734625	2738812		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|734148_734625_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 58
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	740567	747049	2738812		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_160176438.1|740567_741386_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
WP_001077635.1|741860_742403_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516264.1|742408_744418_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.7	2.8e-60
WP_000073352.1|744430_747049_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	8.5e-41
>prophage 59
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	756463	757507	2738812		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|756463_757507_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 60
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	761706	767250	2738812		Bacillus_virus(33.33%)	4	NA	NA
WP_000664766.1|761706_762993_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
WP_000089946.1|762992_764258_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.6e-40
WP_001293307.1|764288_765002_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001806691.1|765006_767250_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 61
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	772390	784204	2738812	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864185.1|772390_773362_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282302.1|773376_774294_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|774463_774814_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_031587224.1|775199_777317_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	1.8e-25
WP_000020853.1|777321_777639_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|777635_777920_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097461.1|777940_779116_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036633.1|779136_779604_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_078064366.1|779893_784204_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 62
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	788452	789223	2738812		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|788452_789223_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 63
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	794001	805206	2738812	protease,tRNA	Erwinia_phage(20.0%)	9	NA	NA
WP_000379049.1|794001_795405_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.8	1.3e-27
WP_000072681.1|795470_796016_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015597.1|796012_796909_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.5	3.6e-31
WP_047928434.1|797325_798633_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_078170908.1|798788_800864_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.1	6.6e-105
WP_000931872.1|801037_801910_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000110253.1|802233_803142_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_001020801.1|803163_804330_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176406.1|804438_805206_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	1.9e-25
>prophage 64
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	818759	820880	2738812		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|818759_819491_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|819606_819840_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|820145_820880_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 65
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	831250	833245	2738812		Moumouvirus(100.0%)	1	NA	NA
WP_000579564.1|831250_833245_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 66
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	836392	837328	2738812	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161281.1|836392_837328_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.9	3.6e-10
>prophage 67
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	842341	844598	2738812		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|842341_843541_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|843756_843975_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368227.1|843974_844598_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.7	3.6e-22
>prophage 68
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	847912	848524	2738812		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|847912_848524_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 69
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	852491	857102	2738812		Halovirus(33.33%)	4	NA	NA
WP_001190913.1|852491_853592_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
WP_000767028.1|853593_854868_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|854885_855767_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178619.1|855794_857102_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 70
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	861566	864320	2738812	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384691.1|861566_864320_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 71
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	883903	884092	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245802.1|883903_884092_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	86.9	3.8e-20
>prophage 72
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	893175	895146	2738812		Staphylococcus_phage(100.0%)	3	NA	NA
WP_076692497.1|893175_893400_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
WP_000765709.1|893356_893503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857488.1|894186_895146_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	7.4e-35
>prophage 73
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	901944	902532	2738812		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000659313.1|901944_902532_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	28.9	1.3e-10
>prophage 74
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	909255	913813	2738812		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|909255_909570_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_047928316.1|909742_912091_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
WP_000161940.1|912100_913813_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	8.9e-15
>prophage 75
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	918820	919879	2738812	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003563.1|918820_919879_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 76
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	931814	934722	2738812		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|931814_932297_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263796.1|932298_932841_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_047928303.1|932910_933300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|933302_933557_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757570.1|933795_934722_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	1.7e-12
>prophage 77
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	946239	948087	2738812		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000182654.1|946239_948087_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 78
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	956220	965052	2738812		Mycoplasma_phage(25.0%)	9	NA	NA
WP_000433551.1|956220_957315_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020625.1|957327_957867_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000455596.1|958010_958286_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|958452_959859_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000863440.1|959862_961155_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_000068176.1|961245_962223_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000035320.1|962226_963339_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000668339.1|963509_964136_-	cell-wall-binding lipoprotein	NA	NA	NA	NA	NA
WP_000957036.1|964500_965052_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 79
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	971064	975444	2738812		Bacillus_virus(50.0%)	5	NA	NA
WP_001289618.1|971064_971298_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
WP_000040052.1|971534_973253_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|973255_973522_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505966.1|973675_974218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685067.1|974271_975444_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	4.0e-75
>prophage 80
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	978559	993321	2738812		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921965.1|978559_979960_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273253.1|979952_980759_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101899.1|981025_982273_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_047928251.1|982294_983773_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	3.2e-77
WP_000238669.1|983787_984354_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
WP_000030811.1|984356_985385_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
WP_000483713.1|985377_986862_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	3.2e-45
WP_000032740.1|986840_989030_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
WP_000666806.1|989022_989694_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000848350.1|989695_989959_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174053.1|989958_990663_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
WP_001010413.1|990666_991791_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861572.1|991777_992260_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
WP_000225837.1|992460_993321_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.2	5.3e-40
>prophage 81
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1003774	1007545	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047928230.1|1003774_1007545_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.1e-54
>prophage 82
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1011211	1012222	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_031775067.1|1011211_1012222_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	32.3	6.2e-16
>prophage 83
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1020527	1024249	2738812		Enterococcus_phage(50.0%)	6	NA	NA
WP_001788574.1|1020527_1020818_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
WP_001790177.1|1020881_1021013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000766009.1|1022506_1022863_+	DoxX family protein	NA	NA	NA	NA	NA
WP_001792054.1|1022951_1023089_-	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
WP_001795266.1|1023229_1023520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571167.1|1023607_1024249_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.7e-19
>prophage 84
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1034443	1039654	2738812	protease	Pithovirus(33.33%)	3	NA	NA
WP_001795272.1|1034443_1036768_-|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.8e-11
WP_000928413.1|1036986_1037790_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049951.1|1038091_1039654_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
>prophage 85
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1058584	1060393	2738812		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082725.1|1058584_1060393_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
>prophage 86
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1067189	1068176	2738812		Bacillus_virus(100.0%)	1	NA	NA
WP_001067040.1|1067189_1068176_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
>prophage 87
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1071827	1073841	2738812		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000786736.1|1071827_1072769_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	1.6e-05
WP_000140050.1|1072758_1073841_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
>prophage 88
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1082436	1089246	2738812		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619360.1|1082436_1083582_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047069.1|1083691_1084561_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353954.1|1084619_1087229_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044219.1|1087431_1089246_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	34.2	3.0e-37
>prophage 89
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1094856	1098510	2738812		Bacillus_phage(100.0%)	1	NA	NA
WP_000154923.1|1094856_1098510_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
>prophage 90
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1108664	1115742	2738812		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185319.1|1108664_1109594_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.9	3.7e-39
WP_000138487.1|1110016_1111261_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047928208.1|1111369_1112560_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.3e-33
WP_000838039.1|1112868_1113996_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1114356_1114734_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1115148_1115742_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 91
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1125664	1129292	2738812		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009687.1|1125664_1127140_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	6.9e-48
WP_000046076.1|1127270_1128479_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143497.1|1128932_1129292_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 92
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1133335	1136004	2738812		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1133335_1134550_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129653.1|1134546_1136004_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	4.4e-39
>prophage 93
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1149212	1152735	2738812		environmental_halophage(50.0%)	3	NA	NA
WP_001807949.1|1149212_1150454_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	6.3e-111
WP_000205582.1|1150568_1151876_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1151973_1152735_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 94
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1156222	1165360	2738812		Streptococcus_phage(40.0%)	14	NA	NA
WP_047928199.1|1156222_1157248_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	3.9e-26
WP_001065801.1|1157497_1157794_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001018962.1|1157786_1158173_-	topiosmerase	NA	NA	NA	NA	NA
WP_000932211.1|1158587_1159466_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000662306.1|1159467_1159581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290489.1|1159644_1160025_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000589549.1|1160182_1160539_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001190695.1|1160682_1161003_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1161152_1161692_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150016.1|1161774_1162491_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.6	1.0e-17
WP_000974460.1|1162638_1163061_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1163459_1163954_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255553.1|1164109_1164727_+	amino acid transporter	NA	NA	NA	NA	NA
WP_072353886.1|1164799_1165360_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	2.2e-31
>prophage 95
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1168764	1170008	2738812		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1168764_1168965_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001641381.1|1169321_1170008_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 96
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1179174	1186917	2738812		Staphylococcus_phage(50.0%)	7	NA	NA
WP_000757401.1|1179174_1179903_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	1.4e-17
WP_001085185.1|1180767_1181232_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_047928197.1|1181253_1183626_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.0	2.3e-93
WP_001165964.1|1183659_1184400_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000556760.1|1184515_1184749_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|1184815_1185274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1185612_1186917_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 97
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1196035	1201797	2738812		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1196035_1196623_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1197196_1198141_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1198251_1199247_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369722.1|1199243_1200155_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134963.1|1200861_1201797_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 98
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1206306	1209153	2738812		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662681.1|1206306_1209153_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	0.0e+00
>prophage 99
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1212471	1213311	2738812		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000753320.1|1212471_1213311_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 100
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1219389	1225102	2738812		Streptococcus_phage(66.67%)	5	NA	NA
WP_001793589.1|1219389_1220472_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.5	2.0e-44
WP_000686342.1|1220835_1221702_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192949.1|1221845_1222487_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	47.7	5.3e-37
WP_000258151.1|1222658_1223714_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_160176442.1|1224031_1225102_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.5	3.0e-16
>prophage 101
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1234382	1257890	2738812		uncultured_Caudovirales_phage(35.71%)	19	NA	NA
WP_000616842.1|1234382_1235144_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	8.5e-18
WP_001245577.1|1235140_1236097_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000876318.1|1236083_1237055_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
WP_000499195.1|1237093_1237249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562498.1|1237762_1238734_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1238851_1240957_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1240919_1241318_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068494.1|1242118_1242985_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|1243004_1243505_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_000193751.1|1243845_1245351_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_001790641.1|1245428_1245530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160176444.1|1245620_1246538_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	2.8e-07
WP_000197271.1|1247161_1247704_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_061743932.1|1247998_1249057_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	1.4e-21
WP_000180991.1|1249296_1250811_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589260.1|1250803_1251781_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	5.4e-25
WP_000983677.1|1252002_1253784_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_076692510.1|1253795_1255679_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	2.0e-55
WP_000098285.1|1255949_1257890_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 102
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1261029	1270875	2738812		Pandoravirus(12.5%)	12	NA	NA
WP_001217802.1|1261029_1262181_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	1.2e-23
WP_000604514.1|1262164_1262758_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
WP_000446724.1|1263108_1263777_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1263778_1264198_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062972.1|1264201_1264915_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000604990.1|1265013_1265598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093562.1|1265877_1266318_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1266659_1267133_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1267107_1267794_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244417.1|1267793_1268849_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.5	1.6e-14
WP_000702781.1|1268920_1269904_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.3	1.5e-62
WP_000931237.1|1270035_1270875_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
>prophage 103
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1282487	1283861	2738812		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000952026.1|1282487_1283861_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	33.6	5.1e-45
>prophage 104
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1288838	1295118	2738812		Bacillus_phage(33.33%)	6	NA	NA
WP_160176445.1|1288838_1290512_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.4	4.5e-11
WP_000737150.1|1290508_1292140_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.8	6.7e-12
WP_000469890.1|1292358_1293234_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358498.1|1293405_1294089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148828.1|1294091_1294550_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1294551_1295118_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
>prophage 105
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1302040	1302514	2738812		Pandoravirus(100.0%)	1	NA	NA
WP_000833486.1|1302040_1302514_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 106
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1307776	1308574	2738812		Bacillus_phage(100.0%)	1	NA	NA
WP_000731644.1|1307776_1308574_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	1.2e-06
>prophage 107
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1313404	1314166	2738812		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|1313404_1314166_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 108
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1318540	1319584	2738812		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001030771.1|1318540_1319584_-	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-17
>prophage 109
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1326105	1326903	2738812		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1326105_1326903_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 110
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1330128	1334087	2738812		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1330128_1331856_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793067.1|1332276_1333572_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1333688_1334087_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 111
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1341021	1341765	2738812		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|1341021_1341765_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 112
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1352915	1353476	2738812	integrase	Streptococcus_phage(100.0%)	1	1347069:1347083	1357064:1357078
1347069:1347083	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044915.1|1352915_1353476_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
WP_001044915.1|1352915_1353476_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
1357064:1357078	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 113
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1366366	1369720	2738812		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1366366_1367377_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1367875_1368397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180145.1|1368424_1369720_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	2.1e-24
>prophage 114
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1377028	1378351	2738812		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860587.1|1377028_1378351_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.1	2.4e-108
>prophage 115
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1389655	1390312	2738812		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455256.1|1389655_1390312_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 116
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1393953	1397274	2738812		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001100835.1|1393953_1395330_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	3.9e-21
WP_031588860.1|1395873_1397274_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
>prophage 117
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1416248	1416911	2738812		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067255.1|1416248_1416911_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.1e-24
>prophage 118
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1423490	1424678	2738812		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250823.1|1423490_1424678_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	4.4e-45
>prophage 119
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1427706	1438660	2738812		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1427706_1429788_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1429910_1430381_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1430446_1430860_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1430957_1431212_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001788197.1|1431348_1434945_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
WP_000918667.1|1435108_1438660_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 120
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1442343	1447126	2738812	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1442343_1442892_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1442904_1443087_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|1443142_1443286_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872876.1|1443400_1443970_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664738.1|1444050_1444575_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1444574_1445321_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370182.1|1445328_1445733_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631973.1|1445725_1447126_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	2.5e-55
>prophage 121
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1453136	1455593	2738812	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1453136_1455593_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 122
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1474793	1485065	2738812	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1474793_1476281_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_001790128.1|1476333_1476426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613716.1|1476819_1477296_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|1477292_1477658_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167924.1|1477635_1478439_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.3	1.3e-21
WP_000057594.1|1478654_1479587_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148594.1|1479765_1480647_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_047928175.1|1480875_1482969_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1483225_1483765_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176728.1|1483769_1485065_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	8.2e-13
>prophage 123
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1494321	1496786	2738812		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1494321_1495287_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_047928174.1|1495433_1496786_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 124
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1502670	1505768	2738812	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_001051129.1|1502670_1504644_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	1.5e-93
WP_000279926.1|1504928_1505768_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 125
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1509674	1510292	2738812		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1509674_1510292_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 126
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1519465	1521163	2738812		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109047.1|1519465_1521163_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 127
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1537815	1544056	2738812		Lactobacillus_phage(33.33%)	6	NA	NA
WP_047928170.1|1537815_1538820_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	42.2	3.3e-25
WP_031589187.1|1539151_1539994_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467991.1|1540030_1540690_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569289.1|1540693_1541719_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	3.1e-31
WP_001036648.1|1542015_1543158_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000634098.1|1543150_1544056_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.7	3.8e-49
>prophage 128
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1567836	1570612	2738812		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072580.1|1567836_1569063_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.1	4.8e-47
WP_000028670.1|1569055_1570612_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.3	1.4e-288
>prophage 129
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1584996	1588015	2738812		Staphylococcus_phage(33.33%)	3	NA	NA
WP_000212549.1|1584996_1585329_-	hypothetical protein	NA	A0A0N9SJ02	Staphylococcus_phage	54.8	1.7e-10
WP_047928163.1|1585828_1586674_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	40.1	7.7e-52
WP_000800379.1|1587262_1588015_+	S8 family serine peptidase	NA	A0A1W6JND5	Lactococcus_phage	32.2	9.6e-14
>prophage 130
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1592931	1595964	2738812		Hokovirus(50.0%)	2	NA	NA
WP_000424964.1|1592931_1594473_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1594497_1595964_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 131
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1604923	1606447	2738812		Enterococcus_phage(100.0%)	1	NA	NA
WP_047928162.1|1604923_1606447_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.6	4.2e-40
>prophage 132
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1613916	1622333	2738812	integrase	Staphylococcus_phage(66.67%)	12	1611955:1611969	1618370:1618384
1611955:1611969	attL	TTTAATGCAATAACA	NA	NA	NA	NA
WP_001808003.1|1613916_1614054_+	hypothetical protein	NA	Q4ZE80	Staphylococcus_phage	75.6	2.8e-12
WP_115304765.1|1614152_1614380_+|integrase	tyrosine-type recombinase/integrase	integrase	Q4ZE80	Staphylococcus_phage	66.0	5.1e-11
WP_001817700.1|1614501_1615440_+	Abi family protein	NA	NA	NA	NA	NA
WP_000897044.1|1615705_1615948_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_047928160.1|1615999_1616503_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.1	3.5e-60
WP_001261460.1|1616523_1616820_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1617063_1617255_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1617340_1618438_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
1618370:1618384	attR	TGTTATTGCATTAAA	NA	NA	NA	NA
WP_000157345.1|1618449_1618653_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_001077602.1|1618682_1619564_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001566903.1|1619720_1620566_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655707.1|1621229_1622333_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	29.0	4.6e-12
>prophage 133
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1632269	1633112	2738812		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209566.1|1632269_1633112_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	7.7e-12
>prophage 134
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1654382	1657117	2738812		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280799.1|1654382_1655405_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	6.7e-10
WP_001191945.1|1655382_1656327_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449066.1|1656316_1657117_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.9	1.2e-41
>prophage 135
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1675353	1676031	2738812		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911017.1|1675353_1676031_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-31
>prophage 136
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1698167	1709483	2738812	transposase	Streptococcus_phage(25.0%)	8	NA	NA
WP_001251201.1|1698167_1699526_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	29.9	8.9e-42
WP_000681143.1|1699530_1701378_+	membrane protein	NA	NA	NA	NA	NA
WP_000247473.1|1701367_1702414_+	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	36.9	4.8e-19
WP_000810443.1|1702420_1703011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001255377.1|1703066_1703408_+	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_000746372.1|1703516_1704020_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_107399907.1|1704000_1704537_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	9.9e-29
WP_000549287.1|1705043_1709483_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	25.6	6.3e-28
>prophage 137
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1720088	1721750	2738812		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_141060963.1|1720088_1720748_+	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
WP_000736783.1|1720799_1721750_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 138
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1730987	1732424	2738812		Pandoravirus(100.0%)	1	NA	NA
WP_000164009.1|1730987_1732424_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.8	2.8e-30
>prophage 139
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1736184	1740723	2738812		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925394.1|1736184_1737924_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
WP_047928141.1|1738183_1738858_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975345.1|1739001_1740723_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 140
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1750673	1751717	2738812		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645615.1|1750673_1751717_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.0	1.2e-14
>prophage 141
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1758931	1760461	2738812		Vibrio_phage(100.0%)	1	NA	NA
WP_000838204.1|1758931_1760461_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 142
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1769337	1770843	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047928108.1|1769337_1770843_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	2.3e-38
>prophage 143
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1781987	1787346	2738812		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1781987_1784237_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837103.1|1784824_1785793_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127982.1|1785789_1787346_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 144
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1797556	1799616	2738812		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818915.1|1797556_1798654_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166921.1|1799037_1799616_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	40.1	4.3e-14
>prophage 145
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1808150	1811292	2738812		Planktothrix_phage(50.0%)	2	NA	NA
WP_047928087.1|1808150_1809743_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.5e-16
WP_001558793.1|1810614_1811292_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.4	1.6e-20
>prophage 146
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1815208	1815889	2738812		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571406.1|1815208_1815889_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	3.8e-33
>prophage 147
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1832678	1833863	2738812		Klosneuvirus(100.0%)	1	NA	NA
WP_001084436.1|1832678_1833863_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.2	9.2e-35
>prophage 148
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1838697	1848981	2738812		Tupanvirus(50.0%)	3	NA	NA
WP_031590254.1|1838697_1845873_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.2	5.9e-68
WP_047928060.1|1846319_1847570_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706137.1|1847955_1848981_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 149
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1852520	1855751	2738812		Bacillus_virus(50.0%)	4	NA	NA
WP_000590844.1|1852520_1853261_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	2.2e-39
WP_000171919.1|1853602_1854115_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356963.1|1854293_1854497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013481.1|1854791_1855751_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
>prophage 150
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1859091	1861576	2738812		Catovirus(50.0%)	2	NA	NA
WP_000723449.1|1859091_1860237_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.1	3.2e-24
WP_000779492.1|1860313_1861576_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	3.3e-22
>prophage 151
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1868411	1874976	2738812		Catovirus(50.0%)	6	NA	NA
WP_000413171.1|1868411_1869536_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
WP_001028286.1|1869539_1870649_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1870661_1871690_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_160176458.1|1871679_1873503_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	28.1	6.8e-29
WP_000565293.1|1873522_1874287_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037328.1|1874289_1874976_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 152
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1879001	1880177	2738812		Clostridium_phage(100.0%)	1	NA	NA
WP_047928035.1|1879001_1880177_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	28.1	2.3e-30
>prophage 153
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1885635	1886409	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078092.1|1885635_1886409_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 154
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1894446	1895046	2738812		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1894446_1895046_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 155
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1899982	1900963	2738812		Catovirus(100.0%)	1	NA	NA
WP_001789408.1|1899982_1900963_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.0	1.0e-47
>prophage 156
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1904332	1905535	2738812		Tupanvirus(100.0%)	1	NA	NA
WP_047928032.1|1904332_1905535_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.1	5.1e-09
>prophage 157
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1913801	1918011	2738812		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1913801_1914782_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045111.1|1915012_1916005_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000925005.1|1916020_1917016_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136636.1|1917012_1918011_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.2e-14
>prophage 158
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1948688	1949756	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000816127.1|1948688_1949756_-	persulfide response sulfurtransferase CstA	NA	A0A2H4PQR9	Staphylococcus_phage	41.5	3.5e-09
>prophage 159
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1957347	1967358	2738812		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|1957347_1958148_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104166.1|1958543_1959332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047928008.1|1959332_1960667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|1960659_1962486_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000101976.1|1962498_1963200_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_047928004.1|1964396_1965680_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	2.3e-68
WP_000375647.1|1965957_1967358_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 160
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1974047	1983087	2738812	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884326.1|1974047_1975334_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177462.1|1975712_1977227_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	1.5e-90
WP_000449218.1|1977552_1978365_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_047927991.1|1978452_1981116_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	2.1e-119
WP_031588484.1|1981152_1983087_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	7.4e-143
>prophage 161
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	1993169	1999594	2738812		Faecalibacterium_phage(25.0%)	8	NA	NA
WP_000742837.1|1993169_1994009_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
WP_000491382.1|1994326_1994680_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|1994747_1995143_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054118.1|1995402_1995972_+	helix-turn-helix domain-containing protein	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|1996089_1996290_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
WP_000672041.1|1996682_1996874_-	peptide resistance ABC transporter activity modulator VraH	NA	NA	NA	NA	NA
WP_000143651.1|1996965_1998846_-	peptide resistance ABC transporter permease subunit VraE	NA	NA	NA	NA	NA
WP_000154162.1|1998835_1999594_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 162
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2015276	2016290	2738812		Faustovirus(100.0%)	1	NA	NA
WP_000639185.1|2015276_2016290_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	25.9	9.6e-09
>prophage 163
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2028514	2029207	2738812		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185863.1|2028514_2029207_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 164
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2055319	2057179	2738812		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125611.1|2055319_2057179_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 165
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2082929	2084681	2738812		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143426.1|2082929_2083817_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	3.3e-05
WP_000923760.1|2083925_2084681_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 166
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2088101	2088599	2738812		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|2088101_2088599_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 167
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2093647	2096031	2738812		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071717.1|2093647_2095498_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	1.2e-235
WP_000173329.1|2095494_2096031_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.6	1.3e-41
>prophage 168
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2100908	2111021	2738812	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2100908_2102618_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2102895_2103108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708241.1|2103387_2103831_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172340.1|2104024_2105623_+	acetyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
WP_031775001.1|2105682_2106012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2106307_2107804_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031402.1|2107996_2108887_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.6e-07
WP_001807954.1|2109009_2109426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030070.1|2109683_2111021_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	3.0e-18
>prophage 169
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2139820	2143739	2738812		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751276.1|2139820_2140522_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	45.9	4.4e-37
WP_031588406.1|2141927_2143739_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 170
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2152163	2156491	2738812		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001807953.1|2152163_2153162_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	9.1e-36
WP_000076661.1|2153251_2153458_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024129.1|2154082_2156491_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	41.0	2.9e-128
>prophage 171
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2165725	2168761	2738812	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001058990.1|2165725_2167831_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.3	1.2e-117
WP_000455986.1|2168239_2168761_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.7	1.2e-26
>prophage 172
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2176108	2182478	2738812		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062652.1|2176108_2177848_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	1.3e-34
WP_000473680.1|2178148_2180215_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2180580_2180991_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_047928640.1|2181032_2181377_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228169.1|2181509_2182478_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	5.2e-12
>prophage 173
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2192191	2193184	2738812		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161536.1|2192191_2193184_-	D-lactate dehydrogenase	NA	M1HYB0	Acanthocystis_turfacea_Chlorella_virus	31.5	1.1e-36
>prophage 174
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2202468	2203164	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382893.1|2202468_2203164_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.4	2.3e-38
>prophage 175
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2223880	2232173	2738812		Streptococcus_phage(66.67%)	8	NA	NA
WP_000721335.1|2223880_2224747_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	7.5e-79
WP_000966095.1|2224922_2226116_+	MFS transporter	NA	NA	NA	NA	NA
WP_072398205.1|2226126_2226330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000217714.1|2226437_2226746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678764.1|2226889_2227156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078104177.1|2227439_2229248_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	38.1	1.9e-95
WP_000446878.1|2229365_2230835_+	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
WP_001033636.1|2230934_2232173_+	DNA cytosine methyltransferase	NA	A0A141E0F9	Streptococcus_phage	29.5	8.4e-31
>prophage 176
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2240871	2241567	2738812		Bacillus_phage(100.0%)	1	NA	NA
WP_031586057.1|2240871_2241567_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	8.6e-09
>prophage 177
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2246490	2247309	2738812		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824946.1|2246490_2247309_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	28.7	1.0e-08
>prophage 178
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2255238	2256796	2738812		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173866.1|2255238_2256054_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	1.8e-13
WP_000590515.1|2256046_2256796_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 179
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2263938	2268367	2738812		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000923524.1|2263938_2264601_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.3	5.5e-21
WP_000072147.1|2264593_2265370_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_047928624.1|2265765_2266953_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700923.1|2267014_2268367_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 180
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2272175	2274034	2738812		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000948981.1|2272175_2273402_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
WP_000569120.1|2273398_2274034_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	9.0e-05
>prophage 181
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2291759	2297936	2738812		Bacillus_phage(66.67%)	5	NA	NA
WP_001176863.1|2291759_2292902_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
WP_000779360.1|2293159_2293546_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2293679_2293787_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064816.1|2294414_2296178_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	8.5e-37
WP_000486494.1|2296202_2297936_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.0e-31
>prophage 182
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2301397	2307169	2738812		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971547.1|2301397_2302513_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	7.1e-21
WP_000286879.1|2302523_2303216_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200945.1|2303226_2303694_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_047928619.1|2303745_2304723_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	75.9	9.2e-142
WP_000916704.1|2304724_2305672_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	3.2e-139
WP_000594519.1|2306239_2307169_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 183
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2314993	2315725	2738812		Bacillus_virus(100.0%)	1	NA	NA
WP_000615461.1|2314993_2315725_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.1e-25
>prophage 184
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2332373	2333933	2738812		Escherichia_phage(100.0%)	1	NA	NA
WP_160176465.1|2332373_2333933_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 185
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2355375	2356410	2738812		Bacillus_virus(100.0%)	1	NA	NA
WP_000655972.1|2355375_2356410_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 186
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2367975	2371872	2738812		Hokovirus(33.33%)	4	NA	NA
WP_000477332.1|2367975_2369349_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	1.3e-13
WP_000249497.1|2369341_2370016_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
WP_000761395.1|2370151_2371207_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229920.1|2371206_2371872_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.6e-36
>prophage 187
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2375611	2376820	2738812		Salmonella_phage(100.0%)	1	NA	NA
WP_031775239.1|2375611_2376820_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	7.9e-34
>prophage 188
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2388910	2389810	2738812		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524830.1|2388910_2389810_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	1.2e-15
>prophage 189
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2397177	2397597	2738812		Bacillus_phage(100.0%)	1	NA	NA
WP_000920238.1|2397177_2397597_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.1	1.0e-36
>prophage 190
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2403230	2404112	2738812		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730034.1|2403230_2404112_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	45.9	3.8e-62
>prophage 191
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2411990	2412626	2738812		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|2411990_2412626_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 192
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2426191	2430160	2738812		Staphylococcus_phage(50.0%)	4	NA	NA
WP_011447058.1|2426191_2426830_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JQU5	Staphylococcus_phage	48.1	2.6e-36
WP_000684145.1|2427140_2428265_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.2e-12
WP_160176466.1|2428344_2429298_-	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.3	2.9e-31
WP_000737705.1|2429659_2430160_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 193
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2434077	2434887	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717388.1|2434077_2434887_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 194
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2453869	2454475	2738812		Pithovirus(100.0%)	1	NA	NA
WP_000913019.1|2453869_2454475_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 195
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2466558	2469726	2738812		Leptospira_phage(100.0%)	1	NA	NA
WP_000592305.1|2466558_2469726_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	1.1e-61
>prophage 196
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2493410	2495077	2738812		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000389660.1|2493410_2494220_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	1.7e-19
WP_047928595.1|2494216_2495077_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	1.3e-09
>prophage 197
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2498723	2500388	2738812		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_047928593.1|2498723_2500388_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.8	1.8e-44
>prophage 198
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2505472	2508570	2738812		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001015492.1|2505472_2506321_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.4	1.7e-43
WP_160176468.1|2506540_2506666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333461.1|2506927_2507536_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_025174343.1|2507829_2508570_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.9	1.5e-14
>prophage 199
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2514891	2516304	2738812		Pandoravirus(100.0%)	1	NA	NA
WP_000169224.1|2514891_2516304_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	3.0e-48
>prophage 200
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2520270	2521833	2738812		Vibrio_phage(100.0%)	1	NA	NA
WP_000792342.1|2520270_2521833_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	1.2e-18
>prophage 201
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2532034	2533003	2738812		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989083.1|2532034_2533003_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.3e-15
>prophage 202
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2548889	2549798	2738812		Klosneuvirus(100.0%)	1	NA	NA
WP_000167871.1|2548889_2549798_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.3	1.4e-27
>prophage 203
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2553388	2560885	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047928587.1|2553388_2560885_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	24.9	3.1e-19
>prophage 204
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2567141	2569961	2738812		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334463.1|2567141_2568947_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.8	5.2e-98
WP_000908180.1|2569178_2569961_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.7	2.6e-09
>prophage 205
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2581152	2584984	2738812		Clostridium_phage(50.0%)	4	NA	NA
WP_000070866.1|2581152_2581596_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_000160304.1|2581716_2582427_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083325.1|2582741_2583404_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242319.1|2583682_2584984_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.7	6.1e-133
>prophage 206
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2592924	2594535	2738812		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2592924_2594535_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 207
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2602337	2610087	2738812		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2602337_2602937_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460242.1|2602937_2604014_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248735.1|2604000_2604837_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_072362259.1|2604869_2605967_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697335.1|2605963_2606386_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654185.1|2606489_2607014_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2607040_2608279_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2608306_2608936_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_047928577.1|2608959_2610087_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.6	1.8e-27
>prophage 208
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2620491	2620887	2738812		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000932694.1|2620491_2620887_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 209
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2626995	2627643	2738812		Moumouvirus(100.0%)	1	NA	NA
WP_031590210.1|2626995_2627643_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	8.0e-09
>prophage 210
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2634842	2636363	2738812		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178942.1|2634842_2636363_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 211
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2642034	2644062	2738812		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546584.1|2642034_2644062_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	5.6e-24
>prophage 212
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2649212	2652597	2738812		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621175.1|2649212_2649575_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2649924_2650926_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2651044_2651371_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190829.1|2651372_2651852_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041102.1|2651826_2652597_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 213
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2666651	2671375	2738812		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_031588337.1|2666651_2668181_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
WP_020978284.1|2668210_2669230_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2669351_2669606_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_160176471.1|2669605_2671375_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	5.3e-63
>prophage 214
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2675135	2689911	2738812	tRNA	Moraxella_phage(16.67%)	11	NA	NA
WP_000159040.1|2675135_2676161_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	5.3e-63
WP_000106313.1|2676589_2678200_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	25.2	6.2e-18
WP_000602069.1|2679154_2681083_-	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	30.4	2.4e-53
WP_001283612.1|2681335_2681971_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_072414299.1|2682325_2683354_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581077.1|2683413_2683638_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052270.1|2683845_2685096_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	4.5e-40
WP_000790330.1|2685278_2686229_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000141414.1|2686377_2687862_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.6	4.0e-19
WP_001253314.1|2687858_2688818_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688498.1|2689194_2689911_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	3.0e-25
>prophage 215
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2697089	2712291	2738812	capsid,integrase	Staphylococcus_phage(46.15%)	17	2699049:2699068	2713378:2713397
WP_000917289.1|2697089_2697374_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240642.1|2697449_2699066_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
2699049:2699068	attL	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
WP_031912621.1|2699134_2700307_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	94.6	2.0e-212
WP_049949256.1|2700316_2700940_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049949255.1|2701072_2701330_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_031912618.1|2701310_2701952_+	Bro-N domain-containing protein	NA	A0A2H4JB17	uncultured_Caudovirales_phage	83.6	1.0e-96
WP_031912617.1|2701965_2702283_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	96.2	2.3e-49
WP_031912616.1|2702418_2702643_+	hypothetical protein	NA	A0A1W6JPA6	Staphylococcus_phage	61.8	6.8e-16
WP_001103961.1|2702643_2702943_+	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	66.7	5.9e-31
WP_141060971.1|2703034_2705398_+	DNA primase	NA	A0A2H4JCU9	uncultured_Caudovirales_phage	41.2	2.3e-146
WP_001081424.1|2705818_2706163_+	hypothetical protein	NA	A0A1W6JQD5	Staphylococcus_phage	65.2	9.4e-41
WP_047928558.1|2706387_2706594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047928557.1|2706580_2707639_+|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_049949340.1|2707821_2708310_+	pathogenicity island protein	NA	A0A2H4JB26	uncultured_Caudovirales_phage	41.8	9.3e-26
WP_000801979.1|2708730_2709699_+	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	5.9e-24
WP_031792985.1|2710855_2711656_+	staphylococcal enterotoxin type B	NA	A0A097PAT7	Streptococcus_pyogenes_phage	45.9	2.3e-53
WP_001035619.1|2711733_2712291_-	DUF4888 domain-containing protein	NA	A0A1W6JQE5	Staphylococcus_phage	74.3	8.6e-68
2713378:2713397	attR	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
>prophage 216
NZ_CP047841	Staphylococcus aureus strain UP_644 chromosome, complete genome	2738812	2719247	2738341	2738812	integrase	Staphylococcus_phage(100.0%)	32	2722090:2722104	2730480:2730494
WP_031588767.1|2719247_2720303_+	bi-component leukocidin LukGH subunit H	NA	A0A2I6PDF3	Staphylococcus_phage	32.1	1.3e-35
WP_000595394.1|2720324_2721341_+	bi-component leukocidin LukGH subunit G	NA	A0A1X9IGW5	Staphylococcus_phage	30.6	8.7e-26
2722090:2722104	attL	CTATCATTATCGAAT	NA	NA	NA	NA
WP_000857176.1|2722459_2723497_-|integrase	site-specific integrase	integrase	A7TWL3	Staphylococcus_phage	100.0	3.4e-179
WP_000191460.1|2723604_2724219_+	hypothetical protein	NA	A0A2I6PDE9	Staphylococcus_phage	100.0	1.3e-106
WP_001013104.1|2724215_2724362_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	89.6	1.1e-14
WP_000694772.1|2724397_2724580_-	hypothetical protein	NA	A0A2I6PDF8	Staphylococcus_phage	100.0	6.9e-27
WP_001208482.1|2724779_2725550_-	helix-turn-helix domain-containing protein	NA	A0A1P8L6G7	Staphylococcus_phage	100.0	6.2e-141
WP_000338186.1|2725708_2725933_+	DUF739 family protein	NA	A7TW90	Staphylococcus_phage	100.0	4.5e-36
WP_000435341.1|2725950_2726211_+	transcriptional regulator	NA	A7TW91	Staphylococcus_phage	100.0	2.7e-40
WP_000351243.1|2726234_2726774_-	hypothetical protein	NA	A7TW92	Staphylococcus_phage	100.0	1.7e-97
WP_024928163.1|2726830_2727583_+	oxidoreductase	NA	G4KNN1	Staphylococcus_phage	99.2	3.3e-139
WP_000939496.1|2727826_2727967_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
WP_000275058.1|2727981_2728614_-	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
WP_001120197.1|2728672_2728993_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_000066020.1|2728989_2729151_+	DUF1270 domain-containing protein	NA	A0A2I6PDF7	Staphylococcus_phage	100.0	1.9e-20
WP_047928555.1|2729243_2729504_+	DUF1108 family protein	NA	A0A2I6PDH1	Staphylococcus_phage	98.8	2.9e-42
WP_001205732.1|2729512_2729776_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700557.1|2729784_2731728_+	AAA family ATPase	NA	A0A2I6PDH3	Staphylococcus_phage	98.0	0.0e+00
2730480:2730494	attR	ATTCGATAATGATAG	NA	NA	NA	NA
WP_000138475.1|2731729_2732650_+	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	100.0	2.3e-166
WP_160176472.1|2732778_2733348_+	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	99.4	2.5e-86
WP_000934770.1|2733348_2733819_+	single-stranded DNA-binding protein	NA	A0A0E3T9H6	Staphylococcus_phage	99.4	4.8e-80
WP_000148301.1|2733848_2734733_+	DnaD domain protein	NA	S4V6D4	Staphylococcus_phage	95.9	3.1e-136
WP_000338528.1|2734739_2734958_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_000401964.1|2734966_2735371_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0E3XBN4	Staphylococcus_phage	100.0	1.4e-72
WP_031929144.1|2735383_2735755_+	phage protein	NA	A0A2I6PDG3	Staphylococcus_phage	92.7	9.8e-52
WP_001126836.1|2735755_2736004_+	hypothetical protein	NA	A0A2I6PDI0	Staphylococcus_phage	100.0	3.2e-43
WP_000982708.1|2736068_2736518_+	hypothetical protein	NA	A0A2I6PDH2	Staphylococcus_phage	100.0	9.3e-81
WP_001105620.1|2736514_2736799_+	hypothetical protein	NA	A0A2I6PDI3	Staphylococcus_phage	100.0	9.4e-47
WP_000370292.1|2736791_2737046_+	DUF1024 family protein	NA	A0A2I6PDI5	Staphylococcus_phage	100.0	6.5e-39
WP_000265042.1|2737165_2737366_+	DUF1514 domain-containing protein	NA	A0A2I6PDJ9	Staphylococcus_phage	100.0	1.4e-28
WP_000590124.1|2737393_2737810_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	99.3	3.7e-76
WP_000988332.1|2738041_2738341_+	HNH endonuclease	NA	A0A2I6PDH9	Staphylococcus_phage	100.0	3.5e-52
