The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	0	22369	2896381	capsid,tail,portal,terminase,holin,protease,head	Staphylococcus_phage(100.0%)	24	NA	NA
WP_000568449.1|0_1695_+|terminase	terminase	terminase	D2JLE4	Staphylococcus_phage	90.6	3.4e-301
WP_001052526.1|1708_1912_+	hypothetical protein	NA	D2JLE5	Staphylococcus_phage	75.4	4.3e-17
WP_073396983.1|1974_3171_+|portal	phage portal protein	portal	D2JLE6	Staphylococcus_phage	87.7	3.8e-198
WP_025173991.1|3589_4174_+|head,protease	HK97 family phage prohead protease	head,protease	D2JLE7	Staphylococcus_phage	95.9	3.0e-103
WP_000849953.1|4260_5496_+|capsid	phage major capsid protein	capsid	Q8SDK8	Staphylococcus_phage	79.5	1.0e-169
WP_001240639.1|5532_5691_+	hypothetical protein	NA	D2JLE9	Staphylococcus_phage	88.5	3.9e-18
WP_001177664.1|5699_6032_+|head,tail	phage head-tail adapter protein	head,tail	A7TWQ4	Staphylococcus_phage	80.9	4.6e-45
WP_000671501.1|6021_6354_+|head,tail	head-tail adaptor protein	head,tail	D2JLF1	Staphylococcus_phage	83.6	3.3e-51
WP_000501001.1|6353_6731_+	HK97 gp10 family phage protein	NA	D2JLF2	Staphylococcus_phage	86.4	6.2e-54
WP_000608369.1|6727_7108_+	hypothetical protein	NA	D2JLF3	Staphylococcus_phage	81.7	8.7e-56
WP_000570645.1|7108_8062_+|tail	phage tail protein	tail	A7TWD0	Staphylococcus_phage	95.0	6.9e-166
WP_000442604.1|8126_8573_+	hypothetical protein	NA	O80053	Staphylococcus_phage	93.9	8.7e-71
WP_000570353.1|8632_8755_+	hypothetical protein	NA	D2JLF6	Staphylococcus_phage	100.0	6.9e-15
WP_160198982.1|8810_13460_+|tail	phage tail tape measure protein	tail	R9QSQ8	Staphylococcus_phage	99.2	0.0e+00
WP_160198983.1|13459_14950_+|tail	phage tail protein	tail	D2JLF8	Staphylococcus_phage	99.8	9.0e-298
WP_031895030.1|14965_18751_+	phage minor structural protein	NA	A0EX05	Staphylococcus_phage	99.9	0.0e+00
WP_001153681.1|18740_18893_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040259.1|18939_19227_+	hypothetical protein	NA	G4KNR2	Staphylococcus_phage	100.0	9.9e-44
WP_000340977.1|19282_19657_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_000750406.1|20077_20851_+	staphylococcal enterotoxin type A	NA	A0EX09	Staphylococcus_phage	100.0	2.2e-146
WP_011447039.1|20959_21136_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_001791821.1|21188_21296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|21347_21602_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|21613_22369_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
>prophage 2
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	27041	29776	2896381		Tupanvirus(50.0%)	3	NA	NA
WP_000449073.1|27041_27842_+	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	44.4	1.5e-41
WP_001191936.1|27831_28776_+	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000280814.1|28753_29776_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.1	6.7e-10
>prophage 3
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	51150	51993	2896381		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209478.1|51150_51993_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.2	4.5e-12
>prophage 4
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	61914	82919	2896381	coat,terminase,integrase	Staphylococcus_phage(81.82%)	30	68525:68542	83626:83643
WP_000655687.1|61914_63018_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
WP_001573568.1|63681_64527_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000373076.1|64680_65562_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000157348.1|65591_65795_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_001218732.1|65806_66904_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001052483.1|66989_67181_-	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001261460.1|67424_67721_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000934799.1|67741_68245_+	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_000897044.1|68296_68539_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
68525:68542	attL	AAAGAAGAACAATAATAT	NA	NA	NA	NA
WP_000400841.1|68770_69490_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q4ZE81	Staphylococcus_phage	29.8	3.7e-23
WP_000270135.1|69602_70817_-|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	97.3	3.3e-221
WP_000230361.1|70977_71601_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001611932.1|71749_71914_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001138305.1|71914_72187_+	winged helix-turn-helix domain-containing protein	NA	Q4ZE77	Staphylococcus_phage	94.4	1.2e-43
WP_000784892.1|72198_72372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231376.1|72338_72542_+	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	98.5	2.0e-30
WP_000403837.1|72543_72927_+	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	4.8e-62
WP_001103967.1|72927_73254_+	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	96.3	3.5e-53
WP_154291490.1|73318_74188_+	mobile element-associated protein	NA	Q4ZE74	Staphylococcus_phage	97.2	9.6e-167
WP_000447468.1|74201_75911_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	92.8	8.2e-303
WP_000356942.1|76220_76601_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	96.8	1.7e-67
WP_001019762.1|76597_77239_+	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	92.5	4.7e-110
WP_001288442.1|77946_78291_+	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	91.7	1.3e-50
WP_000214170.1|78321_78975_+	hypothetical protein	NA	Q4ZE82	Staphylococcus_phage	99.5	7.6e-116
WP_000771361.1|79027_79555_+|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	100.0	6.8e-91
WP_001656917.1|79686_79899_+	hypothetical protein	NA	Q4ZE86	Staphylococcus_phage	97.1	5.4e-31
WP_001293071.1|79895_80465_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	4.6e-101
WP_000801980.1|80741_81710_+	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	2.7e-24
WP_073392942.1|81851_82289_+	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	58.2	9.8e-27
WP_000813311.1|82406_82919_+	hypothetical protein	NA	Q4ZE83	Staphylococcus_phage	100.0	1.4e-69
83626:83643	attR	AAAGAAGAACAATAATAT	NA	NA	NA	NA
>prophage 5
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	92071	93595	2896381		Enterococcus_phage(100.0%)	1	NA	NA
WP_160198984.1|92071_93595_-	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	32.9	5.5e-40
>prophage 6
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	102695	105728	2896381		Klosneuvirus(50.0%)	2	NA	NA
WP_000264071.1|102695_104162_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
WP_000424963.1|104186_105728_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
>prophage 7
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	109035	109362	2896381	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001799349.1|109035_109362_-|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	85.4	4.3e-11
>prophage 8
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	120792	123574	2896381		Staphylococcus_phage(100.0%)	2	NA	NA
WP_033858492.1|120792_122349_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.5	6.3e-286
WP_000072632.1|122341_123574_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	2.7e-45
>prophage 9
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	147111	153348	2896381		Lactococcus_phage(33.33%)	6	NA	NA
WP_000634110.1|147111_148017_+	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.4	7.2e-48
WP_001036658.1|148009_149152_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_000569267.1|149442_150468_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	1.4e-31
WP_000467992.1|150471_151131_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000825534.1|151167_152010_+	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_001170274.1|152343_153348_+	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.1	1.4e-23
>prophage 10
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	169985	171683	2896381		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109044.1|169985_171683_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 11
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	178827	182809	2896381	transposase	Paenibacillus_phage(50.0%)	3	NA	NA
WP_094409958.1|178827_180394_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000812850.1|180852_182190_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_001272126.1|182191_182809_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 12
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	186715	189813	2896381	tRNA	Streptococcus_phage(50.0%)	2	NA	NA
WP_000279925.1|186715_187555_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
WP_001051120.1|187839_189813_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.6	3.2e-93
>prophage 13
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	195696	198161	2896381		Tupanvirus(50.0%)	2	NA	NA
WP_001252534.1|195696_197049_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
WP_000933774.1|197195_198161_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
>prophage 14
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	207417	217875	2896381	tRNA	Klosneuvirus(16.67%)	10	NA	NA
WP_001176721.1|207417_208713_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.3	8.2e-13
WP_000551283.1|208717_209257_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001167888.1|209514_211608_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000148605.1|212021_212903_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_000057594.1|213081_214014_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_160198989.1|214229_215033_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	6.7e-21
WP_001154303.1|215010_215376_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000613720.1|215372_215849_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_016186812.1|216242_216335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288202.1|216387_217875_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
>prophage 15
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	236959	239416	2896381	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|236959_239416_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 16
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	245427	250210	2896381	tRNA	Catovirus(50.0%)	8	NA	NA
WP_160198990.1|245427_246828_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	1.5e-55
WP_000370181.1|246820_247225_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000390332.1|247232_247979_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000664740.1|247978_248503_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000872867.1|248583_249153_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_001791441.1|249267_249411_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001074473.1|249466_249649_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001288302.1|249661_250210_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
>prophage 17
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	253893	264847	2896381		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_000918664.1|253893_257445_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	6.1e-50
WP_001819727.1|257608_261205_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	4.3e-67
WP_000031892.1|261341_261596_+	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001142337.1|261693_262107_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001137495.1|262172_262643_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000090315.1|262765_264847_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
>prophage 18
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	267874	269062	2896381		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250820.1|267874_269062_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	1.5e-45
>prophage 19
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	275650	276313	2896381		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|275650_276313_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 20
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	296258	299580	2896381		Burkholderia_virus(50.0%)	2	NA	NA
WP_160198993.1|296258_297659_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.0	9.4e-55
WP_000382588.1|298203_299580_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	6.7e-21
>prophage 21
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	303247	303904	2896381		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455258.1|303247_303904_+	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	6.4e-46
>prophage 22
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	315208	316531	2896381		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860607.1|315208_316531_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	8.2e-109
>prophage 23
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	324061	327415	2896381		Cafeteria_roenbergensis_virus(50.0%)	3	NA	NA
WP_000180233.1|324061_325357_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
WP_001788287.1|325384_325906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001200748.1|326404_327415_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
>prophage 24
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	340511	341072	2896381	integrase	Streptococcus_phage(100.0%)	1	333112:333126	345753:345767
333112:333126	attL	TATTATCATTGCATT	NA	NA	NA	NA
WP_001044966.1|340511_341072_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
WP_001044966.1|340511_341072_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
345753:345767	attR	TATTATCATTGCATT	NA	NA	NA	NA
>prophage 25
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	353937	354681	2896381		Indivirus(100.0%)	1	NA	NA
WP_000894458.1|353937_354681_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-12
>prophage 26
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	361614	365573	2896381		Streptomyces_phage(33.33%)	3	NA	NA
WP_000832260.1|361614_362013_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
WP_000793055.1|362129_363425_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000817954.1|363845_365573_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
>prophage 27
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	368800	369598	2896381		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|368800_369598_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 28
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	376120	377164	2896381		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_001030763.1|376120_377164_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.1	3.8e-16
>prophage 29
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	381530	382292	2896381		Planktothrix_phage(100.0%)	1	NA	NA
WP_000153733.1|381530_382292_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.2e-33
>prophage 30
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	387013	387811	2896381		Lactobacillus_virus(100.0%)	1	NA	NA
WP_000731642.1|387013_387811_-	LysM peptidoglycan-binding domain-containing protein	NA	C1KFN7	Lactobacillus_virus	35.8	2.1e-06
>prophage 31
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	393060	393534	2896381		Pandoravirus(100.0%)	1	NA	NA
WP_000833480.1|393060_393534_+	cupin	NA	A0A291AU44	Pandoravirus	38.7	4.6e-14
>prophage 32
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	398838	429521	2896381	transposase,bacteriocin	Staphylococcus_phage(46.15%)	31	NA	NA
WP_001105942.1|398838_399513_+|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
WP_001035802.1|399547_399760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000120605.1|400475_400790_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4PQT4	Staphylococcus_phage	73.1	4.7e-39
WP_000153633.1|400789_402079_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	81.1	5.6e-187
WP_000358995.1|402096_402492_+	thioredoxin-dependent arsenate reductase	NA	A0A2H4PQT9	Staphylococcus_phage	86.3	8.5e-62
WP_000726502.1|402871_403165_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000713732.1|403239_405174_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000831610.1|405177_405489_+	YxeA family protein	NA	NA	NA	NA	NA
WP_160198997.1|405500_406127_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	8.0e-22
WP_000277741.1|406488_408135_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_001643491.1|408289_408667_+	recombinase	NA	NA	NA	NA	NA
WP_001582045.1|408606_408933_+	recombinase	NA	NA	NA	NA	NA
WP_000273007.1|408999_409500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145511.1|409864_410725_+	replication initiation protein	NA	NA	NA	NA	NA
WP_000761344.1|410811_411153_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001002795.1|411367_411463_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000843733.1|412012_412756_-	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_001157741.1|413063_413948_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_000397995.1|415164_415488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791613.1|415716_415809_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000377738.1|416110_416932_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000838599.1|417056_418052_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000690626.1|418386_418962_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	2.9e-42
WP_000069452.1|419228_421274_+	copper-translocating P-type ATPase CopB	NA	E4ZFI9	Streptococcus_phage	29.2	2.3e-65
WP_000277154.1|421288_422722_+	multi-copper oxidase Mco	NA	NA	NA	NA	NA
WP_000277738.1|422788_424435_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.4	1.0e-289
WP_000378396.1|424797_426978_-	cadmium-translocating P-type ATPase CadA	NA	E4ZFI9	Streptococcus_phage	63.7	9.3e-251
WP_000159128.1|426970_427336_-	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	47.8	8.5e-24
WP_001105942.1|427561_428236_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
WP_000361064.1|428330_428708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105942.1|428846_429521_+|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
>prophage 33
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	433052	439332	2896381		Enterococcus_phage(33.33%)	6	NA	NA
WP_000820892.1|433052_433619_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
WP_000148821.1|433620_434079_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000358501.1|434081_434765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000469883.1|434936_435812_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000737163.1|436030_437662_+	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	28.2	2.3e-12
WP_000857616.1|437658_439332_+	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	24.2	2.0e-11
>prophage 34
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	444309	445683	2896381		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000952030.1|444309_445683_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	1.2e-46
>prophage 35
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	457288	467134	2896381		Staphylococcus_phage(12.5%)	12	NA	NA
WP_000931237.1|457288_458128_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
WP_000702776.1|458259_459243_+	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.0	7.3e-62
WP_124009511.1|459314_460370_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.0	3.6e-14
WP_000149344.1|460369_461056_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001037807.1|461030_461504_-	DoxX family protein	NA	NA	NA	NA	NA
WP_001093552.1|461845_462286_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_000637686.1|462565_463150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062968.1|463248_463962_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000941336.1|463965_464385_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_000446724.1|464386_465055_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000604508.1|465405_465999_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
WP_001217804.1|465982_467134_+	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
>prophage 36
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	470273	493244	2896381		uncultured_Caudovirales_phage(35.71%)	18	NA	NA
WP_000098285.1|470273_472214_+	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
WP_000525101.1|472485_474369_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	8.8e-56
WP_000983677.1|474380_476162_+	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000589241.1|476382_477360_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.1e-25
WP_000180987.1|477352_478867_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000663016.1|479106_480165_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.5	5.7e-20
WP_000197262.1|480323_480866_+	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000429002.1|481417_482335_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	8.2e-07
WP_031788440.1|482425_482527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193750.1|482604_484110_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_000930016.1|484449_484950_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
WP_001068491.1|484969_485836_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000692521.1|486637_487036_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_000855505.1|486998_489104_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000562498.1|489223_490195_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000876311.1|490571_491543_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	80.2	7.8e-141
WP_001245566.1|491529_492486_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
WP_000616865.1|492482_493244_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
>prophage 37
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	502521	508226	2896381		Streptococcus_phage(66.67%)	5	NA	NA
WP_000460983.1|502521_503592_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
WP_000258151.1|503909_504965_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000192947.1|505128_505770_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
WP_000686342.1|505913_506780_+	DegV family protein	NA	NA	NA	NA	NA
WP_000370984.1|507143_508226_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.8	1.2e-44
>prophage 38
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	514664	515504	2896381		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000749385.1|514664_515504_+	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 39
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	518822	521669	2896381		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662687.1|518822_521669_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 40
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	526066	531882	2896381		Streptococcus_phage(40.0%)	5	NA	NA
WP_000134960.1|526066_527002_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	8.4e-84
WP_000369719.1|527769_528681_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_001248939.1|528677_529673_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000006551.1|529781_530726_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001049165.1|531294_531882_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
>prophage 41
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	542570	551327	2896381		Staphylococcus_phage(50.0%)	8	NA	NA
WP_001121760.1|542570_543875_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
WP_000785248.1|544211_544670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000556760.1|544736_544970_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_001165967.1|545098_545839_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001050041.1|545872_548245_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	1.9e-92
WP_075111649.1|548266_548731_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	99.4	9.6e-81
WP_000999096.1|549696_550311_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_001574560.1|550598_551327_-	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	4.8e-18
>prophage 42
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	560801	562045	2896381		Bacillus_phage(50.0%)	2	NA	NA
WP_001574556.1|560801_561488_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
WP_001059082.1|561844_562045_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
>prophage 43
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	565450	570628	2896381		Streptococcus_phage(50.0%)	8	NA	NA
WP_016187137.1|565450_566011_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	3.8e-31
WP_000255545.1|566083_566701_-	amino acid transporter	NA	NA	NA	NA	NA
WP_000569884.1|566856_567351_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000974455.1|567749_568172_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000150036.1|568319_569036_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.7	6.8e-17
WP_000422908.1|569118_569658_+	nitroreductase	NA	NA	NA	NA	NA
WP_001147955.1|569807_570128_-	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000589549.1|570271_570628_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
>prophage 44
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	573737	574763	2896381		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571209.1|573737_574763_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.2e-28
>prophage 45
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	578482	582005	2896381		Indivirus(50.0%)	3	NA	NA
WP_000168845.1|578482_579244_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
WP_000205572.1|579341_580649_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000807671.1|580763_582005_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.1e-110
>prophage 46
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	595216	597885	2896381		Tupanvirus(50.0%)	2	NA	NA
WP_000129645.1|595216_596674_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	4.4e-39
WP_000613541.1|596670_597885_+	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
>prophage 47
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	601928	605556	2896381		Lake_Baikal_phage(50.0%)	3	NA	NA
WP_001143497.1|601928_602288_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
WP_000046076.1|602741_603950_+	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001009683.1|604080_605556_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	1.2e-47
>prophage 48
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	615490	622540	2896381		Aureococcus_anophage(33.33%)	6	NA	NA
WP_126116979.1|615490_616084_+	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	42.4	1.5e-25
WP_001067294.1|616498_616876_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000838047.1|617237_618365_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000167321.1|618672_619863_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.0	1.3e-33
WP_000138487.1|619971_621216_+	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000185311.1|621610_622540_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.5	1.8e-38
>prophage 49
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	632695	640155	2896381	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_000154949.1|632695_636349_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
WP_000670753.1|636514_637417_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000902813.1|637742_638132_+	YisL family protein	NA	NA	NA	NA	NA
WP_000277741.1|638508_640155_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 50
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	643420	645235	2896381		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001044234.1|643420_645235_+	O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	8.8e-37
>prophage 51
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	649084	650230	2896381		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000619360.1|649084_650230_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
>prophage 52
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	658824	711788	2896381	protease,transposase,tRNA,holin	Bacillus_virus(18.18%)	48	NA	NA
WP_000140043.1|658824_659907_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	2.4e-18
WP_000786746.1|659896_660838_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	9.3e-06
WP_000197096.1|660856_662512_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517177.1|662723_662990_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000121211.1|662981_663929_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_073392975.1|664043_665513_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001067041.1|665563_666550_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
WP_000427776.1|666552_667533_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_001574526.1|667525_668176_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001180271.1|668187_669069_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_094409958.1|669140_670708_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_160176155.1|671003_672650_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.9	8.2e-292
WP_000448933.1|672676_673666_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000258003.1|673960_674356_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_001217728.1|674726_675446_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_000959276.1|675566_676553_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_000082722.1|676600_678409_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	9.3e-47
WP_000896691.1|678868_679675_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000214067.1|679697_680063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224620.1|680166_680760_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_001242102.1|680945_681293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077683.1|681309_681945_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_001270834.1|681961_682771_+	NAD kinase	NA	NA	NA	NA	NA
WP_000669938.1|682767_683622_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000062404.1|683642_685028_+	magnesium transporter	NA	NA	NA	NA	NA
WP_000395156.1|685037_686882_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_000933195.1|687159_687930_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000933105.1|688125_689211_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000570704.1|689552_691121_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_000889176.1|691263_692022_+	esterase family protein	NA	NA	NA	NA	NA
WP_001060545.1|692187_692913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160198999.1|692914_693766_+	base excision DNA repair protein	NA	NA	NA	NA	NA
WP_000600387.1|694507_695017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001794241.1|695129_696338_-	MFS transporter	NA	NA	NA	NA	NA
WP_160199000.1|696297_697473_-	diglucosyl diacylglycerol synthase	NA	NA	NA	NA	NA
WP_000340133.1|697904_699389_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_001794242.1|699369_699630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049957.1|699629_701192_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
WP_000928413.1|701493_702297_+	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001794169.1|702515_704840_+|protease	serine protease	protease	W5SAB9	Pithovirus	26.8	4.0e-10
WP_000021872.1|704856_706215_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_000414169.1|706353_707865_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000287265.1|708353_708923_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000876825.1|709132_709351_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000668820.1|709431_710418_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000214898.1|710616_710793_+	YkvS family protein	NA	NA	NA	NA	NA
WP_001033867.1|710807_711410_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_099119695.1|711710_711788_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 53
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	715039	715681	2896381		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571191.1|715039_715681_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	5.0e-19
>prophage 54
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	720310	720601	2896381		Enterococcus_phage(100.0%)	1	NA	NA
WP_001794164.1|720310_720601_-	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	2.6e-07
>prophage 55
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	728904	729978	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000676568.1|728904_729978_-	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	31.7	1.1e-15
>prophage 56
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	733645	737419	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001074519.1|733645_737419_-	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	38.0	1.1e-54
>prophage 57
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	747598	762361	2896381		Synechococcus_phage(22.22%)	14	NA	NA
WP_000225845.1|747598_748459_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	1.2e-39
WP_000861576.1|748659_749142_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_001010391.1|749128_750253_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000174050.1|750256_750961_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.6	7.3e-48
WP_000848351.1|750960_751224_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666808.1|751225_751897_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000032734.1|751889_754079_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.2	5.1e-140
WP_000483716.1|754057_755542_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.4	8.5e-46
WP_160199002.1|755534_756563_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	3.4e-62
WP_000238673.1|756565_757132_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
WP_000709288.1|757146_758625_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	9.2e-77
WP_001101912.1|758646_759894_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000273254.1|760161_760968_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000921981.1|760960_762361_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.4e-10
>prophage 58
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	765540	769920	2896381		Streptococcus_phage(50.0%)	5	NA	NA
WP_000685075.1|765540_766713_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.6	1.5e-74
WP_000505964.1|766766_767309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000437472.1|767462_767729_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000040041.1|767731_769450_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_001289622.1|769686_769920_-	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	1.3e-09
>prophage 59
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	775977	776529	2896381		Synechococcus_phage(100.0%)	1	NA	NA
WP_000957036.1|775977_776529_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 60
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	781170	784813	2896381		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_000260117.1|781170_782577_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000455584.1|782747_783023_+	UPF0223 family protein	NA	NA	NA	NA	NA
WP_001020627.1|783166_783706_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000433551.1|783718_784813_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
>prophage 61
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	806458	853512	2896381	plate,tail,capsid,portal,terminase,holin,head	Staphylococcus_phage(80.65%)	68	NA	NA
WP_000757584.1|806458_807388_-	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	6.5e-12
WP_001049150.1|807626_807881_+	YlbG family protein	NA	NA	NA	NA	NA
WP_000814565.1|807883_808273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001263793.1|808342_808885_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000401377.1|808886_809369_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_160199004.1|809430_810570_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000872158.1|810696_811254_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_000290472.1|811333_811507_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_047230699.1|811623_813009_-	recombinase family protein	NA	I1W625	Staphylococcus_phage	98.5	3.7e-261
WP_017804779.1|813201_813906_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	99.6	6.7e-126
WP_024936996.1|813941_814127_-	hypothetical protein	NA	Q9G041	Staphylococcus_virus	98.4	5.1e-25
WP_160199005.1|814281_815004_-	helix-turn-helix transcriptional regulator	NA	A0A1X9H038	Staphylococcus_phage	75.6	2.9e-92
WP_001198673.1|815145_815364_+	helix-turn-helix transcriptional regulator	NA	Q8SDX1	Staphylococcus_phage	100.0	2.9e-35
WP_047230698.1|815379_816168_+	phage antirepressor KilAC domain-containing protein	NA	A0A0E3XC38	Staphylococcus_phage	99.2	6.1e-144
WP_047230697.1|816184_816379_+	hypothetical protein	NA	S4SVC1	Staphylococcus_phage	100.0	2.7e-29
WP_000395457.1|816582_816813_-	hypothetical protein	NA	R4IG40	Staphylococcus_phage	100.0	2.3e-35
WP_000066026.1|816992_817154_+	DUF1270 family protein	NA	C8CGY5	Staphylococcus_phage	100.0	2.5e-20
WP_000291090.1|817247_817508_+	DUF1108 family protein	NA	Q4ZDA1	Staphylococcus_virus	100.0	1.2e-43
WP_001205732.1|817516_817780_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_160199074.1|817788_819732_+	AAA family ATPase	NA	A0EWX0	Staphylococcus_phage	99.4	0.0e+00
WP_000138472.1|819733_820654_+	recombinase	NA	S4SUN6	Staphylococcus_phage	100.0	2.3e-166
WP_072528355.1|820734_821352_+	MBL fold metallo-hydrolase	NA	A0A2I6PDI9	Staphylococcus_phage	99.4	2.7e-86
WP_029549393.1|821352_821823_+	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	96.8	4.8e-80
WP_160199006.1|821852_822704_+	DnaD domain protein	NA	A0EWX4	Staphylococcus_phage	93.9	2.9e-131
WP_000338528.1|822710_822929_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_061641040.1|822937_823342_+	RusA family crossover junction endodeoxyribonuclease	NA	I1W657	Staphylococcus_phage	95.5	1.1e-69
WP_061650592.1|823354_823726_+	hypothetical protein	NA	Q4ZAY2	Staphylococcus_virus	93.5	1.2e-52
WP_001126839.1|823726_823975_+	hypothetical protein	NA	A0A1W6JPX8	Staphylococcus_phage	100.0	2.5e-43
WP_000982695.1|824038_824386_+	hypothetical protein	NA	A0A1W6JPZ1	Staphylococcus_phage	100.0	5.9e-59
WP_000219085.1|824382_824772_+	acetyltransferase	NA	A0A1W6JPV7	Staphylococcus_phage	100.0	3.5e-68
WP_001065084.1|824764_825019_+	DUF1024 family protein	NA	A0A2I6PDI5	Staphylococcus_phage	96.4	2.1e-37
WP_075583749.1|824981_825176_+	hypothetical protein	NA	M1SVE4	Staphylococcus_phage	95.2	6.9e-25
WP_000185642.1|825168_825702_+	dUTP pyrophosphatase	NA	A0A059T5A7	Staphylococcus_phage	97.2	2.1e-92
WP_000195801.1|825738_826026_+	DUF1381 domain-containing protein	NA	Q4ZAB6	Staphylococcus_virus	100.0	1.1e-45
WP_000608279.1|826018_826255_+	hypothetical protein	NA	A0A0N7E0U3	Staphylococcus_phage	100.0	1.3e-36
WP_001834820.1|826238_826634_+	hypothetical protein	NA	A7TWI1	Staphylococcus_phage	97.7	1.8e-64
WP_000595303.1|826630_826804_+	transcriptional activator RinB	NA	A0A0H3U4U1	Staphylococcus_phage	98.2	1.7e-22
WP_000286968.1|826804_827206_+	hypothetical protein	NA	A0A2H4PQK5	Staphylococcus_phage	100.0	5.6e-69
WP_000594087.1|827557_828052_+	hypothetical protein	NA	A0A0N9BAX3	Staphylococcus_phage	99.4	2.2e-83
WP_001037578.1|828044_829268_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0N9BAX9	Staphylococcus_phage	100.0	7.5e-242
WP_000177422.1|829264_830689_+|portal	phage portal protein	portal	Q4ZBZ7	Staphylococcus_virus	100.0	6.2e-272
WP_160199007.1|830657_831611_+|head	phage head morphogenesis protein	head	A0A0N7E0U6	Staphylococcus_phage	99.4	2.5e-176
WP_000346033.1|831612_831819_+	hypothetical protein	NA	A0A0N9BB04	Staphylococcus_phage	100.0	3.2e-28
WP_001019219.1|831921_832506_+	DUF4355 domain-containing protein	NA	A0A0N7E0U8	Staphylococcus_phage	100.0	1.3e-77
WP_000235168.1|832522_833437_+|capsid	phage major capsid protein	capsid	A0A0H3U2U7	Staphylococcus_phage	100.0	1.2e-170
WP_000177351.1|833597_833948_+|head,tail	phage head-tail adapter protein	head,tail	A0A0H3U2R5	Staphylococcus_phage	100.0	1.9e-60
WP_000483041.1|833959_834295_+|head	phage head closure protein	head	A0A0E3TAH8	Staphylococcus_phage	100.0	8.8e-60
WP_001151330.1|834281_834695_+	HK97 gp10 family phage protein	NA	A0A0N9BAY5	Staphylococcus_phage	100.0	1.1e-75
WP_000270192.1|834707_835133_+	DUF3168 domain-containing protein	NA	Q4ZBQ9	Staphylococcus_phage	100.0	5.5e-75
WP_000057582.1|835133_835691_+|tail	tail protein	tail	Q4ZBQ8	Staphylococcus_phage	100.0	8.2e-103
WP_061839760.1|835757_836264_+	hypothetical protein	NA	Q4ZBQ7	Staphylococcus_phage	99.4	7.7e-92
WP_000880587.1|836308_836593_+	hypothetical protein	NA	A0A0N7E0V9	Staphylococcus_phage	100.0	8.8e-45
WP_061644681.1|836596_839740_+	hypothetical protein	NA	Q4ZBQ5	Staphylococcus_phage	99.7	0.0e+00
WP_015984522.1|839754_840696_+	hypothetical protein	NA	A1KXA7	Staphylococcus_virus	100.0	6.7e-182
WP_001122001.1|840706_842593_+	peptidase	NA	Q4ZBQ3	Staphylococcus_phage	100.0	0.0e+00
WP_160199008.1|842605_844504_+	hypothetical protein	NA	A0A2H4JCV8	uncultured_Caudovirales_phage	98.4	0.0e+00
WP_033861311.1|844503_846327_+|plate	BppU family phage baseplate upper protein	plate	A1KX42	Staphylococcus_virus	97.2	1.6e-288
WP_000705914.1|846326_846704_+	DUF2977 domain-containing protein	NA	W5R9M2	Staphylococcus_phage	99.2	3.4e-60
WP_001790193.1|846713_846887_+	XkdX family protein	NA	Q8LTH6	Staphylococcus_phage	100.0	1.7e-27
WP_000466784.1|846927_847227_+	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_033861356.1|847363_849238_+	CHAP domain-containing protein	NA	Q9FZY4	Staphylococcus_virus	99.7	0.0e+00
WP_015978297.1|849250_850423_+|plate	BppU family phage baseplate upper protein	plate	Q4ZBH2	Staphylococcus_virus	100.0	6.4e-198
WP_000398878.1|850428_850824_+	hypothetical protein	NA	Q4ZBP5	Staphylococcus_phage	100.0	2.7e-68
WP_000354128.1|850879_851317_+|holin	phage holin	holin	S4SVG2	Staphylococcus_phage	99.3	4.1e-73
WP_061641004.1|851297_852743_+	CHAP domain-containing protein	NA	A0A0H3U310	Staphylococcus_phage	97.7	1.8e-290
WP_078103528.1|852991_853144_+	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	96.0	5.8e-19
WP_031922866.1|853214_853325_+	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	94.4	1.2e-10
WP_001796941.1|853311_853512_+	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	97.0	4.0e-28
>prophage 62
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	863610	864669	2896381	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|863610_864669_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 63
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	869479	874037	2896381		Bodo_saltans_virus(33.33%)	3	NA	NA
WP_000161937.1|869479_871192_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
WP_001249264.1|871201_873550_+	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
WP_001018928.1|873722_874037_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
>prophage 64
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	885471	885822	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000669541.1|885471_885822_+	complement inhibitor SCIN-C	NA	A7TWS0	Staphylococcus_phage	50.0	1.9e-20
>prophage 65
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	889282	891458	2896381	transposase	Staphylococcus_virus(100.0%)	2	NA	NA
WP_001801391.1|889282_889510_+	hypothetical protein	NA	Q4ZBW5	Staphylococcus_virus	67.7	1.9e-18
WP_000277741.1|889811_891458_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 66
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	900369	900567	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245800.1|900369_900567_+	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	1.2e-19
>prophage 67
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	919922	922676	2896381	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384706.1|919922_922676_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	2.1e-90
>prophage 68
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	927607	932218	2896381		Enterobacteria_phage(33.33%)	4	NA	NA
WP_001178615.1|927607_928915_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
WP_160199013.1|928942_929824_+	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_000767018.1|929841_931116_+	dihydroorotase	NA	NA	NA	NA	NA
WP_001190910.1|931117_932218_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	9.6e-63
>prophage 69
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	936185	936797	2896381		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|936185_936797_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 70
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	940111	942368	2896381		Abalone_herpesvirus(50.0%)	3	NA	NA
WP_000368225.1|940111_940735_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	6.1e-22
WP_000933956.1|940734_940953_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000722165.1|941168_942368_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
>prophage 71
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	947377	948313	2896381	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|947377_948313_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 72
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	951460	953455	2896381		Moumouvirus(100.0%)	1	NA	NA
WP_160199014.1|951460_953455_+	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 73
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	963825	965946	2896381		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_000167269.1|963825_964560_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
WP_000426914.1|964865_965099_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000043237.1|965214_965946_+	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
>prophage 74
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	979330	982303	2896381		Emiliania_huxleyi_virus(50.0%)	3	NA	NA
WP_000176401.1|979330_980098_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
WP_001020801.1|980206_981373_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000110252.1|981394_982303_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	2.3e-17
>prophage 75
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	986136	993000	2896381	protease,tRNA	Indivirus(33.33%)	5	NA	NA
WP_001557331.1|986136_988212_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000195263.1|988367_989675_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001015609.1|990092_990989_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	6.1e-31
WP_000072681.1|990985_991531_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000379051.1|991596_993000_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	6.4e-27
>prophage 76
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	997774	998545	2896381		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|997774_998545_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 77
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1002818	1014633	2896381	tRNA	Clostridium_phage(33.33%)	9	NA	NA
WP_000139497.1|1002818_1007129_+	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
WP_000036631.1|1007418_1007886_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000097463.1|1007906_1009082_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000727423.1|1009102_1009387_+	YlxR family protein	NA	NA	NA	NA	NA
WP_000020856.1|1009383_1009701_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000043642.1|1009705_1011823_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000097322.1|1012209_1012560_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000282296.1|1012729_1013647_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000864182.1|1013661_1014633_+	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
>prophage 78
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1019773	1025317	2896381		Mycobacterium_phage(33.33%)	4	NA	NA
WP_042907377.1|1019773_1022017_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
WP_001293307.1|1022021_1022735_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000089941.1|1022765_1024031_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_000664777.1|1024030_1025317_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
>prophage 79
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1029517	1030561	2896381		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|1029517_1030561_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 80
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1039975	1046457	2896381		Cafeteria_roenbergensis_virus(33.33%)	4	NA	NA
WP_000073334.1|1039975_1042594_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	3.8e-41
WP_000516249.1|1042606_1044616_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.2	4.1e-59
WP_001077635.1|1044621_1045164_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_001103747.1|1045638_1046457_+	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	3.1e-26
>prophage 81
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1052400	1052877	2896381		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|1052400_1052877_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 82
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1057948	1064822	2896381	transposase	Staphylococcus_phage(50.0%)	8	NA	NA
WP_001659797.1|1057948_1058146_+	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
WP_078367270.1|1058437_1058974_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	1.3e-28
WP_160199015.1|1058954_1059458_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001255381.1|1059566_1059923_-	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_000810443.1|1059978_1060569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000247474.1|1060575_1061622_-	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	36.9	8.1e-19
WP_000681139.1|1061611_1063459_-	membrane protein	NA	NA	NA	NA	NA
WP_001251205.1|1063463_1064822_-	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	29.9	4.0e-42
>prophage 83
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1072210	1078816	2896381	transposase,capsid	Staphylococcus_phage(80.0%)	8	NA	NA
WP_001071312.1|1072210_1072423_+	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	3.6e-19
WP_001002343.1|1072719_1072926_+	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
WP_031788482.1|1073627_1073738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000006110.1|1074130_1074316_+	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_000121213.1|1074527_1075475_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	99.7	1.6e-183
WP_000477487.1|1075901_1076318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000585095.1|1077838_1078090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077670290.1|1078150_1078816_+|capsid	phage capsid protein	capsid	A0A1J0MF61	Staphylococcus_phage	53.0	4.6e-60
>prophage 84
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1082753	1083089	2896381	head	Staphylococcus_phage(100.0%)	1	NA	NA
WP_077670291.1|1082753_1083089_+|head	phage head morphogenesis protein	head	A0A1J0MFV1	Staphylococcus_phage	60.4	2.6e-27
>prophage 85
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1087043	1091319	2896381		Anomala_cuprea_entomopoxvirus(50.0%)	6	NA	NA
WP_001794121.1|1087043_1087952_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	9.8e-21
WP_000603961.1|1087920_1088652_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000670311.1|1088655_1089747_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000624452.1|1089743_1090346_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001027143.1|1090458_1090647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000841344.1|1090785_1091319_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
>prophage 86
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1101455	1107111	2896381		Tupanvirus(25.0%)	7	NA	NA
WP_000089857.1|1101455_1102973_+	catalase	NA	A0A2K9L0T1	Tupanvirus	43.8	2.7e-92
WP_001265708.1|1103063_1103213_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001085657.1|1103666_1103936_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_000688127.1|1104092_1105070_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001791425.1|1105066_1105171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380738.1|1105244_1106108_+	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	1.2e-15
WP_001208760.1|1106487_1107111_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
>prophage 87
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1111260	1112382	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691309.1|1111260_1112382_+	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.1	2.1e-09
>prophage 88
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1116051	1117698	2896381		Vibrio_phage(100.0%)	1	NA	NA
WP_001088983.1|1116051_1117698_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.5	1.9e-22
>prophage 89
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1123315	1127709	2896381		Bacillus_virus(50.0%)	2	NA	NA
WP_001574370.1|1123315_1125307_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
WP_001289586.1|1125306_1127709_+	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	1.1e-92
>prophage 90
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1136978	1138625	2896381	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_000277741.1|1136978_1138625_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 91
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1144863	1147216	2896381		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000604802.1|1144863_1145430_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	31.8	1.7e-23
WP_000153717.1|1146433_1147216_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.7	1.2e-27
>prophage 92
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1154697	1155399	2896381		Tupanvirus(100.0%)	1	NA	NA
WP_000571253.1|1154697_1155399_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.0e-13
>prophage 93
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1158813	1162267	2896381		Streptococcus_phage(50.0%)	3	NA	NA
WP_000077549.1|1158813_1160628_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.3	2.3e-154
WP_000974850.1|1160767_1161409_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000079448.1|1161415_1162267_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.8e-16
>prophage 94
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1165635	1169957	2896381	transposase	Paenibacillus_phage(50.0%)	3	NA	NA
WP_094409958.1|1165635_1167203_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_001162351.1|1167306_1168209_-	RNA-binding virulence regulatory protein CvfB	NA	NA	NA	NA	NA
WP_000942303.1|1168355_1169957_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 95
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1177799	1182825	2896381	lysis	Yellowstone_lake_phycodnavirus(33.33%)	7	NA	NA
WP_000216956.1|1177799_1179065_+	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.0	4.0e-12
WP_000876206.1|1179300_1179702_-	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000809131.1|1179898_1180099_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000269923.1|1180269_1180578_-	DUF1033 family protein	NA	NA	NA	NA	NA
WP_001215907.1|1180739_1181009_+	acylphosphatase	NA	NA	NA	NA	NA
WP_001794103.1|1181027_1181657_+|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_000138413.1|1181688_1182825_+	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
>prophage 96
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1186360	1187152	2896381		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|1186360_1187152_-	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 97
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1193520	1195532	2896381		Hokovirus(50.0%)	2	NA	NA
WP_000166793.1|1193520_1194876_-	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
WP_000192137.1|1194872_1195532_-	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
>prophage 98
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1198940	1209397	2896381	transposase	Staphylococcus_phage(50.0%)	14	NA	NA
WP_000342154.1|1198940_1200431_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	1.7e-22
WP_000121213.1|1200669_1201617_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	99.7	1.6e-183
WP_000801007.1|1201689_1201911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000473654.1|1201910_1202411_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000913317.1|1202422_1202851_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000159899.1|1202843_1203377_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000166055.1|1203462_1204302_-	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	5.1e-48
WP_000175746.1|1204316_1204796_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000934885.1|1204995_1205952_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000995290.1|1206375_1206813_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000404628.1|1206828_1207953_-	virulence factor C	NA	NA	NA	NA	NA
WP_001165814.1|1207990_1208242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001814377.1|1208253_1208448_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000282169.1|1208692_1209397_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.3	1.9e-11
>prophage 99
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1247989	1248868	2896381		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|1247989_1248868_-	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 100
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1258332	1258959	2896381		Bacillus_phage(100.0%)	1	NA	NA
WP_001108885.1|1258332_1258959_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 101
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1262650	1270157	2896381	tRNA	Temperate_phage(25.0%)	5	NA	NA
WP_000362222.1|1262650_1263337_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
WP_000858795.1|1263665_1264958_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	4.3e-54
WP_000525060.1|1265279_1267973_-	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000049917.1|1267996_1268968_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000361536.1|1268954_1270157_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	42.5	1.4e-35
>prophage 102
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1273529	1274105	2896381		Bacillus_virus(100.0%)	1	NA	NA
WP_000005208.1|1273529_1274105_-	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	4.6e-08
>prophage 103
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1277767	1282908	2896381		Pandoravirus(25.0%)	6	NA	NA
WP_001269937.1|1277767_1278934_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	1.5e-34
WP_000442480.1|1279402_1279852_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_001819897.1|1279943_1280888_-	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000774679.1|1280904_1281630_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_000450555.1|1281632_1282205_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_001043863.1|1282635_1282908_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
>prophage 104
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1292315	1294994	2896381		Acanthamoeba_polyphaga_moumouvirus(50.0%)	3	NA	NA
WP_000902107.1|1292315_1293695_-	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.3	2.9e-56
WP_001163814.1|1293684_1294638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151997.1|1294745_1294994_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
>prophage 105
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1301602	1307752	2896381		Hokovirus(33.33%)	7	NA	NA
WP_000987777.1|1301602_1303354_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
WP_000064078.1|1303334_1304060_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000159577.1|1304192_1304930_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000368652.1|1304922_1305465_-	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000273367.1|1305457_1306189_-	segregation and condensation protein A	NA	NA	NA	NA	NA
WP_001183424.1|1306280_1306787_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000447733.1|1306864_1307752_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
>prophage 106
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1313416	1314901	2896381		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|1313416_1314901_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 107
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1322248	1323655	2896381		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|1322248_1323655_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 108
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1330483	1337053	2896381		Indivirus(66.67%)	6	NA	NA
WP_001291540.1|1330483_1331905_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	6.6e-40
WP_000942216.1|1332055_1333735_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001124985.1|1333750_1334203_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000183386.1|1334633_1335515_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	5.8e-10
WP_000159866.1|1335492_1335723_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_001286928.1|1335715_1337053_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
>prophage 109
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1344573	1347385	2896381		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000202178.1|1344573_1346046_-	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.1	1.4e-80
WP_000019697.1|1346038_1347385_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.9	2.1e-64
>prophage 110
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1352929	1353553	2896381		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|1352929_1353553_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 111
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1359725	1373453	2896381	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_000863556.1|1359725_1360325_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
WP_001095260.1|1360600_1361011_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_000564316.1|1360997_1361861_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001213908.1|1361902_1362688_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000924211.1|1362813_1363704_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
WP_001062173.1|1363713_1365060_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	1.4e-55
WP_000683921.1|1365173_1366274_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
WP_000624581.1|1366276_1366954_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_001283055.1|1367084_1368191_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_001217253.1|1368414_1370214_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
WP_000411298.1|1370274_1371093_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001794939.1|1371103_1371727_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001030080.1|1372061_1373453_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
>prophage 112
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1376507	1377455	2896381		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117769.1|1376507_1377455_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	4.9e-47
>prophage 113
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1383924	1387032	2896381		Catovirus(50.0%)	2	NA	NA
WP_001119020.1|1383924_1385064_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.5	6.8e-27
WP_000034716.1|1385199_1387032_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
>prophage 114
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1390467	1396631	2896381		Streptococcus_phage(33.33%)	5	NA	NA
WP_000368338.1|1390467_1392291_-	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
WP_001274017.1|1392636_1392888_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001282570.1|1392932_1393907_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_000953291.1|1393963_1396111_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	9.1e-33
WP_000439692.1|1396169_1396631_-	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
>prophage 115
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1413094	1448692	2896381	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_000648617.1|1413094_1413718_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
WP_000848304.1|1413717_1414986_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000137775.1|1414997_1415921_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_000342267.1|1415923_1416562_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000134779.1|1416846_1417155_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000939059.1|1417169_1417598_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000426912.1|1417601_1417862_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000734077.1|1417924_1420555_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_001283316.1|1420897_1423375_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_000567025.1|1423376_1424045_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_000066097.1|1424726_1425845_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000409167.1|1425845_1426988_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000985898.1|1427297_1428311_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000008061.1|1428547_1428694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000752909.1|1428733_1428916_-	CsbD family protein	NA	NA	NA	NA	NA
WP_000704122.1|1429015_1429438_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000102741.1|1429522_1430797_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.9	6.3e-106
WP_000682640.1|1430957_1431731_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_001791215.1|1431730_1431859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000044796.1|1432191_1433958_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_000590826.1|1433973_1435236_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000717800.1|1435696_1436572_-	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000869979.1|1436568_1437021_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_160199021.1|1437032_1439222_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000364542.1|1439649_1440168_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_000595001.1|1440189_1442463_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
WP_000749802.1|1442665_1444945_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_001160682.1|1445219_1445480_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_001112045.1|1445498_1446638_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001019178.1|1446660_1447686_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001005767.1|1447687_1448692_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 116
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1458807	1461438	2896381	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000425358.1|1458807_1461438_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	3.7e-153
>prophage 117
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1471005	1482159	2896381	protease,tRNA	Bacillus_virus(20.0%)	12	NA	NA
WP_000472293.1|1471005_1472268_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	1.1e-139
WP_000127572.1|1472418_1473720_-	trigger factor	NA	NA	NA	NA	NA
WP_001790560.1|1473767_1473878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280014.1|1473882_1474812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000032653.1|1474830_1475439_-	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	36.4	1.7e-21
WP_001138360.1|1475580_1475937_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001125540.1|1475983_1476184_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001791219.1|1476212_1476740_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	5.3e-11
WP_000049150.1|1476968_1478462_-	amino acid permease	NA	NA	NA	NA	NA
WP_000435132.1|1478888_1480826_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_016186894.1|1481050_1481146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000808621.1|1481238_1482159_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
>prophage 118
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1486073	1494238	2896381		Bacillus_virus(25.0%)	5	NA	NA
WP_001114454.1|1486073_1486946_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
WP_001038301.1|1486961_1489592_-	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	32.7	1.8e-46
WP_000849445.1|1489884_1491372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073392727.1|1491872_1493534_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.0	1.7e-34
WP_000080025.1|1493536_1494238_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
>prophage 119
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1499121	1500879	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232655.1|1499121_1500879_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	3.3e-41
>prophage 120
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1505811	1509009	2896381		Streptomyces_phage(100.0%)	1	NA	NA
WP_160199023.1|1505811_1509009_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	9.4e-135
>prophage 121
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1526591	1530727	2896381		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_000174275.1|1526591_1527335_-	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.9	8.3e-18
WP_000553919.1|1527414_1527861_+	OsmC family protein	NA	NA	NA	NA	NA
WP_000291426.1|1527975_1529136_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000808837.1|1529122_1530727_+	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
>prophage 122
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1534495	1537126	2896381	protease,tRNA	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001279341.1|1534495_1535770_+|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
WP_000186029.1|1535863_1537126_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
>prophage 123
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1543730	1545437	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862084.1|1543730_1545437_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.8	2.1e-274
>prophage 124
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1554009	1559379	2896381		Mycobacterium_phage(50.0%)	3	NA	NA
WP_000118301.1|1554009_1557834_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
WP_001048374.1|1557854_1558493_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_001091387.1|1558521_1559379_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
>prophage 125
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1564962	1568899	2896381		Enterobacteria_phage(50.0%)	4	NA	NA
WP_000690628.1|1564962_1565556_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	1.1e-41
WP_001284656.1|1565819_1566200_-	penicillinase repressor BlaI	NA	NA	NA	NA	NA
WP_001096374.1|1566189_1567947_-	beta-lactam sensor/signal transducer BlaR1	NA	NA	NA	NA	NA
WP_000733283.1|1568053_1568899_+	BlaZ family penicillin-hydrolyzing class A beta-lactamase PC1	NA	A0A1B0VBP7	Salmonella_phage	34.0	1.5e-31
>prophage 126
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1577031	1578300	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000284993.1|1577031_1578300_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	5.9e-56
>prophage 127
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1585308	1647322	2896381	protease,tRNA	Staphylococcus_phage(92.86%)	63	NA	NA
WP_000836472.1|1585308_1585620_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
WP_160199024.1|1585641_1588056_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.7	0.0e+00
WP_001025064.1|1588347_1589529_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
WP_000526541.1|1589639_1590593_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
WP_000764425.1|1590589_1591153_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
WP_000757543.1|1591271_1591673_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000266099.1|1592245_1593073_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014937042.1|1593075_1593195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001196351.1|1593306_1594308_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.1	5.0e-183
WP_001008556.1|1594429_1594894_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	97.4	1.9e-68
WP_160199025.1|1594906_1596088_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	1.5e-226
WP_000493891.1|1596098_1596731_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
WP_078265038.1|1596737_1597769_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.0	2.9e-194
WP_001261683.1|1598261_1599764_-	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
WP_000221181.1|1600406_1600721_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	97.1	1.7e-52
WP_000989104.1|1600720_1602013_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	95.1	2.6e-216
WP_001032833.1|1602099_1602954_-	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000384171.1|1603229_1603454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000671059.1|1603652_1604123_+	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	85.8	7.7e-70
WP_001152695.1|1604235_1604679_+	competence protein ComK	NA	NA	NA	NA	NA
WP_001030476.1|1604665_1605109_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
WP_001168914.1|1605406_1606042_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000492901.1|1606208_1606829_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001096494.1|1607286_1608000_-	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_000091444.1|1608258_1608561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001200542.1|1608815_1609181_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000623481.1|1609177_1609531_+	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	97.4	4.2e-20
WP_000453316.1|1609780_1610614_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.6	1.2e-158
WP_000366165.1|1610825_1611734_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
WP_000933819.1|1611858_1613052_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000109909.1|1613423_1615016_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
WP_001801476.1|1615308_1616055_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.3e-139
WP_000672010.1|1616059_1616533_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	9.5e-84
WP_000718107.1|1616598_1616856_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000778539.1|1616852_1617854_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	96.7	8.5e-183
WP_000348372.1|1617858_1619337_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
WP_016186903.1|1619495_1619951_-	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	3.5e-75
WP_001794016.1|1620252_1620903_+	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	1.0e-51
WP_000070654.1|1620983_1621979_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	3.8e-74
WP_000669038.1|1622054_1622681_+	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
WP_000627550.1|1622721_1623066_+	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
WP_000414222.1|1623163_1623736_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
WP_160199026.1|1623884_1625252_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000125075.1|1625251_1625821_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
WP_000747804.1|1626013_1626460_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001801861.1|1626910_1627006_+	type I toxin-antitoxin system Fst family toxin PepA1	NA	NA	NA	NA	NA
WP_001791232.1|1627128_1627230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001037039.1|1627404_1627848_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000731421.1|1627847_1628291_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000182553.1|1629257_1631678_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_001819963.1|1631803_1632163_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000619920.1|1632390_1632840_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001053714.1|1632882_1634493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095390.1|1634507_1634807_+	secretion protein	NA	NA	NA	NA	NA
WP_160199027.1|1635068_1636886_-	NTPase	NA	NA	NA	NA	NA
WP_000072622.1|1636922_1638077_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.3	7.8e-39
WP_078072810.1|1638069_1639809_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.5	9.3e-286
WP_001038742.1|1639988_1640708_-|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	98.3	1.0e-129
WP_001038734.1|1640877_1641594_-|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	97.1	6.6e-129
WP_001038766.1|1642639_1643356_-|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	5.5e-83
WP_001039022.1|1643479_1644199_-|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.7	6.4e-124
WP_000595635.1|1645213_1645729_+	membrane protein	NA	NA	NA	NA	NA
WP_000711499.1|1645975_1647322_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	51.1	2.5e-65
>prophage 128
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1650576	1654856	2896381		Staphylococcus_phage(80.0%)	5	NA	NA
WP_001235656.1|1650576_1651332_-	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	40.8	2.3e-39
WP_000764684.1|1651370_1652156_-	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	42.7	2.9e-45
WP_000721567.1|1652309_1653038_-	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.8	1.3e-28
WP_000821649.1|1653072_1653792_-	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	34.6	4.9e-23
WP_147612242.1|1654073_1654856_-	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	38.6	8.7e-34
>prophage 129
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1662719	1663460	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|1662719_1663460_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 130
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1673048	1673393	2896381		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|1673048_1673393_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 131
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1684048	1684777	2896381		Planktothrix_phage(100.0%)	1	NA	NA
WP_001144055.1|1684048_1684777_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
>prophage 132
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1718456	1719086	2896381		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|1718456_1719086_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 133
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1723953	1724367	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001643743.1|1723953_1724367_-	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.5	3.0e-17
>prophage 134
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1727820	1847791	2896381	integrase,coat,transposase,tail,holin,capsid,portal,terminase,protease,tRNA,head	Staphylococcus_phage(84.0%)	144	1831079:1831098	1845813:1845832
WP_000613738.1|1727820_1728375_+	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
WP_000140179.1|1728441_1729512_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000548777.1|1729758_1730289_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_160199029.1|1730458_1731820_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	43.2	5.3e-103
WP_001231458.1|1731900_1732848_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.5e-16
WP_001791535.1|1733485_1733632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545373.1|1733670_1735098_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000027924.1|1735110_1736568_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_000170162.1|1736569_1736872_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_000957023.1|1737238_1738777_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000831695.1|1738865_1740065_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_000774552.1|1740077_1742081_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	9.8e-114
WP_000992924.1|1742084_1744277_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000272063.1|1744273_1744966_-	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_001165363.1|1745148_1745451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572878.1|1745559_1746855_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_000827736.1|1747703_1748870_+|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
WP_000434532.1|1748900_1749224_+	staphostatin A	NA	NA	NA	NA	NA
WP_000669861.1|1749517_1749691_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_000011542.1|1749671_1750274_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_000040861.1|1750543_1751365_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
WP_000284434.1|1751357_1752827_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.5	8.5e-107
WP_000897633.1|1753010_1754087_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_001177832.1|1754106_1754901_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_031788442.1|1754972_1755080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323171.1|1755090_1756653_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_000275719.1|1756857_1757955_-	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	8.7e-48
WP_000149686.1|1758327_1758888_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_001140871.1|1758940_1759870_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_001790680.1|1760061_1760235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021224.1|1760286_1761666_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000181322.1|1761785_1762814_-	lactonase family protein	NA	NA	NA	NA	NA
WP_000205106.1|1763084_1763486_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
WP_000267034.1|1763542_1763716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001188074.1|1764166_1765207_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_000713064.1|1765263_1766106_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_001033968.1|1766102_1766660_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000966288.1|1766719_1767244_-	membrane protein	NA	NA	NA	NA	NA
WP_000182842.1|1767364_1767928_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001221650.1|1767991_1768732_-	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
WP_000763048.1|1768731_1769604_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
WP_000645732.1|1769600_1770281_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000991315.1|1770281_1771178_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000691584.1|1771174_1771555_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000681966.1|1771812_1771989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990056.1|1772230_1772329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068528.1|1772528_1773815_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000277741.1|1774062_1775709_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_000669728.1|1776006_1778076_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000669789.1|1779033_1779213_+	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_001791826.1|1779523_1779784_+	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000702263.1|1779836_1780187_-	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_000727649.1|1780872_1781322_+	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_020444758.1|1781416_1781875_-	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	4.9e-85
WP_000919350.1|1782401_1782893_-	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
WP_000861038.1|1783083_1783839_-	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000611512.1|1783850_1784105_-|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_001791821.1|1784156_1784264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011447039.1|1784316_1784493_-|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_000750406.1|1784601_1785375_-	staphylococcal enterotoxin type A	NA	A0EX09	Staphylococcus_phage	100.0	2.2e-146
WP_000340977.1|1785795_1786170_-	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_001040259.1|1786225_1786513_-	hypothetical protein	NA	G4KNR2	Staphylococcus_phage	100.0	9.9e-44
WP_001153681.1|1786559_1786712_-	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_031895030.1|1786701_1790487_-	phage minor structural protein	NA	A0EX05	Staphylococcus_phage	99.9	0.0e+00
WP_000567413.1|1790502_1791987_-|tail	phage tail protein	tail	A0EX04	Staphylococcus_phage	100.0	4.5e-297
WP_160199030.1|1791983_1796513_-|tail	phage tail tape measure protein	tail	A0EX03	Staphylococcus_phage	99.9	0.0e+00
WP_001096355.1|1796757_1797108_-	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_071621395.1|1797157_1797382_-	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_000268735.1|1797423_1798068_-|tail	phage tail protein	tail	A0EWZ9	Staphylococcus_phage	100.0	3.8e-120
WP_000565498.1|1798068_1798476_-	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000114226.1|1798472_1798877_-	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
WP_160199031.1|1798873_1799236_-|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	99.2	2.2e-64
WP_000150936.1|1799219_1799504_-|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000238236.1|1799493_1799778_-	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000154559.1|1799797_1800943_-|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
WP_000642728.1|1800966_1801704_-|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000025274.1|1801687_1802875_-|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000625088.1|1802890_1804552_-|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000402904.1|1804548_1804893_-	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
WP_000988336.1|1805022_1805322_-	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
WP_000590122.1|1805553_1805970_-	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000265043.1|1805997_1806198_-	DUF1514 domain-containing protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
WP_000595265.1|1806197_1806347_-	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_001811577.1|1806343_1806709_-	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	4.3e-60
WP_000195803.1|1806727_1806934_-	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_000185659.1|1806970_1807513_-	dUTP pyrophosphatase	NA	A0EWY2	Staphylococcus_phage	100.0	1.1e-96
WP_000028422.1|1807505_1807688_-	hypothetical protein	NA	A0EWY1	Staphylococcus_phage	100.0	2.6e-26
WP_001065091.1|1807677_1807929_-	DUF1024 family protein	NA	A0EWY0	Staphylococcus_phage	100.0	1.9e-38
WP_000131366.1|1808100_1808343_-	hypothetical protein	NA	A0EWX8	Staphylococcus_phage	100.0	3.9e-41
WP_000101274.1|1808346_1808715_-	hypothetical protein	NA	W5RAK8	Staphylococcus_phage	100.0	8.2e-51
WP_000338531.1|1809045_1809264_-	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	98.6	1.2e-36
WP_000934764.1|1810173_1810644_-	single-stranded DNA-binding protein	NA	A0EWX3	Staphylococcus_phage	100.0	7.4e-81
WP_071621397.1|1810644_1811262_-	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
WP_000138472.1|1811342_1812263_-	recombinase	NA	S4SUN6	Staphylococcus_phage	100.0	2.3e-166
WP_000700577.1|1812264_1814208_-	AAA family ATPase	NA	A0EWX0	Staphylococcus_phage	100.0	0.0e+00
WP_001205732.1|1814216_1814480_-	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000291503.1|1814488_1814749_-	DUF1108 family protein	NA	A0EWW8	Staphylococcus_phage	100.0	8.9e-44
WP_000165375.1|1814729_1815056_-	DUF2482 family protein	NA	W5RAK4	Staphylococcus_phage	100.0	1.2e-53
WP_000066017.1|1815150_1815312_-	DUF1270 domain-containing protein	NA	D2JGJ6	Staphylococcus_phage	100.0	4.3e-20
WP_001120197.1|1815308_1815629_-	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_000275058.1|1815687_1816320_+	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
WP_000939496.1|1816334_1816475_-	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
WP_001148855.1|1816505_1816703_-	hypothetical protein	NA	Q8SDM8	Staphylococcus_phage	100.0	7.0e-33
WP_001148605.1|1816718_1817471_-	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_000128907.1|1817521_1817851_+	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
WP_001025874.1|1817839_1818055_-	DUF2829 domain-containing protein	NA	A0EWV9	Staphylococcus_phage	100.0	6.3e-35
WP_000854072.1|1818070_1818334_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
WP_001801500.1|1818330_1818504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001031454.1|1818466_1819180_+	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_000759682.1|1819195_1820128_+	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
WP_000591749.1|1820133_1820475_+	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
WP_000705248.1|1820678_1820861_+	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
WP_000825947.1|1820960_1821425_+	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
WP_000857191.1|1821483_1822521_+|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	100.0	9.1e-180
WP_000595617.1|1823660_1824680_-	beta-channel forming cytolysin	NA	A0A2I6PEU3	Staphylococcus_phage	39.6	3.4e-54
WP_000791402.1|1824701_1825757_-	succinyl-diaminopimelate desuccinylase	NA	A0A2I6PER8	Staphylococcus_phage	34.6	7.9e-38
WP_000206618.1|1826188_1827412_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_001045073.1|1827850_1829158_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_001573771.1|1829735_1830077_-	hypothetical protein	NA	C8CH40	Staphylococcus_phage	46.0	4.1e-20
WP_001573769.1|1830066_1830363_-	hypothetical protein	NA	C8CH40	Staphylococcus_phage	40.4	6.7e-11
WP_000201397.1|1830359_1830539_-	hypothetical protein	NA	NA	NA	NA	NA
1831079:1831098	attL	TTTTACATCATTCCTGGCAT	NA	NA	NA	NA
WP_001239269.1|1831657_1832593_+	TDT family transporter	NA	NA	NA	NA	NA
WP_000812237.1|1833447_1833675_-	hypothetical protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	47.4	1.9e-13
WP_001035597.1|1834093_1834798_+	toxic shock syndrome toxin TSST-1	NA	NA	NA	NA	NA
WP_001293073.1|1834952_1835522_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	3.5e-101
WP_000358778.1|1835518_1835860_-	hypothetical protein	NA	A0A1W6JQM3	Staphylococcus_phage	100.0	1.7e-58
WP_000771368.1|1835862_1836390_-|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_000448775.1|1836440_1836659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000846285.1|1836676_1837255_-	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
WP_001190608.1|1837266_1837608_-	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	98.2	7.1e-57
WP_001019766.1|1838143_1838785_-	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	94.8	3.5e-113
WP_000356937.1|1838781_1839162_-	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	100.0	6.9e-69
WP_160199032.1|1839473_1841183_-	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	99.8	0.0e+00
WP_001002721.1|1841196_1842066_-	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	99.3	6.0e-169
WP_001103930.1|1842129_1842447_-	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	58.2	1.6e-18
WP_000403839.1|1842447_1842831_-	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	9.7e-63
WP_001231378.1|1842832_1843036_-	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	97.0	7.5e-30
WP_000708433.1|1843020_1843176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000481967.1|1843172_1843490_-	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
WP_000153640.1|1843494_1843713_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
WP_000620857.1|1843885_1844560_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
WP_000179345.1|1844573_1845746_+|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	98.2	3.5e-220
WP_160199033.1|1845814_1847431_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
1845813:1845832	attR	TTTTACATCATTCCTGGCAT	NA	NA	NA	NA
WP_000917289.1|1847506_1847791_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
>prophage 135
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1854964	1869039	2896381	tRNA	uncultured_Caudovirales_phage(16.67%)	12	NA	NA
WP_000688492.1|1854964_1855681_+	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
WP_160199035.1|1856054_1857014_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_001791588.1|1857010_1858495_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.8	5.2e-19
WP_000790325.1|1858643_1859594_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_001052261.1|1859777_1861028_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	9.0e-41
WP_000581078.1|1861236_1861461_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_073392939.1|1861520_1862549_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_001283612.1|1862905_1863541_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_000602046.1|1863793_1865722_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.1	3.2e-53
WP_001791590.1|1865866_1865995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106312.1|1866089_1867700_+	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	27.4	5.1e-20
WP_160199036.1|1868013_1869039_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.2	1.1e-63
>prophage 136
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1872799	1877523	2896381		Yellowstone_lake_phycodnavirus(50.0%)	4	NA	NA
WP_000047828.1|1872799_1874569_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	4.1e-63
WP_000196911.1|1874568_1874823_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_072399972.1|1874944_1875964_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000094572.1|1875993_1877523_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.6	9.4e-08
>prophage 137
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1891636	1895020	2896381		Bacillus_phage(50.0%)	5	NA	NA
WP_001041107.1|1891636_1892407_-	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
WP_001190825.1|1892381_1892861_-	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001052491.1|1892862_1893189_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_000390829.1|1893307_1894309_-	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_000621176.1|1894657_1895020_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
>prophage 138
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1900170	1902198	2896381		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546609.1|1900170_1902198_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.6	3.9e-25
>prophage 139
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1907873	1909394	2896381		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178940.1|1907873_1909394_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 140
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1917586	1918234	2896381		Moumouvirus(100.0%)	1	NA	NA
WP_001187612.1|1917586_1918234_+	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	4.7e-09
>prophage 141
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1924343	1924739	2896381		Bacillus_phage(100.0%)	1	NA	NA
WP_000932696.1|1924343_1924739_-	single-stranded DNA-binding protein	NA	A0A1B1PAE7	Bacillus_phage	36.8	3.0e-14
>prophage 142
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1935455	1943208	2896381		Catovirus(25.0%)	9	NA	NA
WP_000723407.1|1935455_1936586_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.1	1.0e-27
WP_000048712.1|1936609_1937239_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_037585842.1|1937266_1938505_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	6.3e-103
WP_000654191.1|1938531_1939056_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000697334.1|1939162_1939582_-	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_001801520.1|1939578_1940676_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000248730.1|1940708_1941545_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000460244.1|1941531_1942608_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000273356.1|1942608_1943208_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
>prophage 143
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1951011	1952622	2896381		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|1951011_1952622_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 144
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1960555	1964388	2896381		Geobacillus_virus(50.0%)	4	NA	NA
WP_001242308.1|1960555_1961857_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.7	1.4e-132
WP_001083335.1|1962136_1962799_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000160304.1|1963113_1963824_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000070866.1|1963944_1964388_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
>prophage 145
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1972894	1980311	2896381	transposase	Staphylococcus_virus(33.33%)	6	NA	NA
WP_000277742.1|1972894_1974508_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	1.1e-285
WP_073392962.1|1974965_1975070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001792784.1|1975749_1975908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370937.1|1976566_1977424_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000908186.1|1977491_1978274_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	5.7e-09
WP_000334466.1|1978505_1980311_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.6	2.6e-97
>prophage 146
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	1997553	1998462	2896381		Klosneuvirus(100.0%)	1	NA	NA
WP_000162591.1|1997553_1998462_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.7	1.2e-26
>prophage 147
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2014262	2015231	2896381		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2014262_2015231_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 148
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2025434	2026997	2896381		Vibrio_phage(100.0%)	1	NA	NA
WP_000792332.1|2025434_2026997_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	3.5e-18
>prophage 149
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2030965	2032378	2896381		Pandoravirus(100.0%)	1	NA	NA
WP_000169223.1|2030965_2032378_-	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	5.0e-48
>prophage 150
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2038698	2041761	2896381		Orpheovirus(50.0%)	5	NA	NA
WP_001573518.1|2038698_2039439_+	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	30.3	7.3e-14
WP_000333457.1|2039696_2040305_-	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_001293423.1|2040318_2040612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001573519.1|2040566_2040692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160199047.1|2040912_2041761_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.4	1.3e-43
>prophage 151
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2045139	2053702	2896381		Clostridium_phage(33.33%)	8	NA	NA
WP_001044451.1|2045139_2045994_-	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	34.8	1.3e-06
WP_000044369.1|2046204_2047020_-	hydrolase	NA	NA	NA	NA	NA
WP_000769709.1|2047314_2047740_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000179061.1|2048130_2048835_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000130145.1|2048871_2050536_-	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	4.7e-45
WP_001791584.1|2051005_2051188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000136272.1|2051837_2052017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000204272.1|2052265_2053702_-	MarR family transcriptional regulator	NA	A0A088F7M4	Mycobacterium_phage	31.2	7.1e-58
>prophage 152
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2056743	2060352	2896381	transposase	Staphylococcus_phage(33.33%)	3	NA	NA
WP_000586768.1|2056743_2057604_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.4e-10
WP_000389651.1|2057600_2058410_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.8	1.4e-18
WP_094409958.1|2058785_2060352_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
>prophage 153
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2083534	2086702	2896381		Leptospira_phage(100.0%)	1	NA	NA
WP_000592290.1|2083534_2086702_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	4.3e-63
>prophage 154
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2098669	2099275	2896381		Pithovirus(100.0%)	1	NA	NA
WP_160199049.1|2098669_2099275_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.1	8.6e-13
>prophage 155
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2118249	2119059	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717395.1|2118249_2119059_+	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 156
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2122979	2127246	2896381		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000737700.1|2122979_2123471_+	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
WP_160199050.1|2123829_2124783_+	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.2	7.6e-32
WP_000684154.1|2124874_2125999_-	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.6e-12
WP_072460394.1|2126607_2127246_-	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	47.4	4.5e-36
>prophage 157
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2140250	2140886	2896381		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285452.1|2140250_2140886_-	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.6	7.1e-10
>prophage 158
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2148765	2149647	2896381		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730056.1|2148765_2149647_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	1.7e-62
>prophage 159
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2155338	2155758	2896381		Bacillus_phage(100.0%)	1	NA	NA
WP_000920241.1|2155338_2155758_+	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	7.7e-37
>prophage 160
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2163115	2164015	2896381		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524842.1|2163115_2164015_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.7e-15
>prophage 161
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2176671	2177880	2896381		Salmonella_phage(100.0%)	1	NA	NA
WP_000999130.1|2176671_2177880_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.5	3.0e-33
>prophage 162
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2181617	2188174	2896381		Planktothrix_phage(25.0%)	8	NA	NA
WP_001229922.1|2181617_2182283_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	7.2e-37
WP_000761409.1|2182282_2183338_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000249492.1|2183473_2184148_+	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	44.7	8.0e-52
WP_000477322.1|2184140_2185514_+	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.3	1.1e-12
WP_000977031.1|2185676_2186120_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000793166.1|2186116_2186572_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_000372857.1|2186748_2187312_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000388431.1|2187445_2188174_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	6.7e-28
>prophage 163
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2198636	2199671	2896381		Bacillus_virus(100.0%)	1	NA	NA
WP_000655979.1|2198636_2199671_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	1.7e-16
>prophage 164
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2210612	2212259	2896381	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_000277741.1|2210612_2212259_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 165
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2222990	2224550	2896381		Escherichia_phage(100.0%)	1	NA	NA
WP_000692650.1|2222990_2224550_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	3.4e-21
>prophage 166
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2241414	2242146	2896381		Bacillus_virus(100.0%)	1	NA	NA
WP_000615467.1|2241414_2242146_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	1.3e-23
>prophage 167
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2250038	2255792	2896381		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000594516.1|2250038_2250968_+	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.4	1.5e-120
WP_000916697.1|2251517_2252465_+	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	2.1e-138
WP_001056917.1|2252466_2253444_+	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	2.4e-142
WP_000200947.1|2253495_2253963_-	QueT transporter family protein	NA	NA	NA	NA	NA
WP_000286868.1|2253973_2254666_-	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000971554.1|2254676_2255792_-	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.9	7.1e-21
>prophage 168
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2259253	2265460	2896381		Bacillus_phage(66.67%)	5	NA	NA
WP_000486505.1|2259253_2260987_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.5e-30
WP_001064829.1|2261011_2262775_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	1.6e-35
WP_000482647.1|2263422_2263530_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000779351.1|2263663_2264050_-	GtrA family protein	NA	NA	NA	NA	NA
WP_001176855.1|2264317_2265460_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.9	2.6e-55
>prophage 169
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2283836	2285063	2896381		Mycoplasma_phage(100.0%)	1	NA	NA
WP_160199053.1|2283836_2285063_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 170
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2292188	2292851	2896381		Bacillus_phage(100.0%)	1	NA	NA
WP_000923514.1|2292188_2292851_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.5	2.2e-17
>prophage 171
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2299084	2300642	2896381		Bacillus_virus(50.0%)	2	NA	NA
WP_000590515.1|2299084_2299834_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
WP_000173876.1|2299826_2300642_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	6.1e-14
>prophage 172
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2308707	2309526	2896381		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824929.1|2308707_2309526_-	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.8	1.9e-10
>prophage 173
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2315202	2315898	2896381		Bacillus_phage(100.0%)	1	NA	NA
WP_000217452.1|2315202_2315898_-	oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	5.1e-09
>prophage 174
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2320341	2327499	2896381		Bacillus_phage(66.67%)	6	NA	NA
WP_160199054.1|2320341_2323185_-	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	1.2e-27
WP_000755954.1|2323186_2323579_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001793882.1|2323695_2325504_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.5	1.0e-93
WP_000678764.1|2325787_2326054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573690.1|2326197_2326506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000721330.1|2326632_2327499_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	4.4e-79
>prophage 175
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2346096	2346792	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382892.1|2346096_2346792_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	2.0e-37
>prophage 176
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2356208	2357201	2896381		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161541.1|2356208_2357201_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	9.7e-38
>prophage 177
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2366025	2372408	2896381		Powai_lake_megavirus(33.33%)	5	NA	NA
WP_001228158.1|2366025_2366994_-	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	3.1e-12
WP_000240663.1|2367114_2367471_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000206033.1|2367512_2367923_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000473682.1|2368302_2370369_-	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_001062662.1|2370668_2372408_-	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
>prophage 178
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2378832	2381822	2896381	protease	Streptococcus_phage(50.0%)	2	NA	NA
WP_000262597.1|2378832_2379354_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	2.4e-27
WP_001063330.1|2379716_2381822_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.5	6.9e-118
>prophage 179
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2391063	2395380	2896381		uncultured_virus(50.0%)	3	NA	NA
WP_000024137.1|2391063_2393472_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	2.9e-128
WP_000076662.1|2394085_2394292_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000161364.1|2394381_2395380_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	2.6e-35
>prophage 180
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2403813	2407013	2896381		Salmonella_virus(50.0%)	2	NA	NA
WP_000379825.1|2403813_2405625_-	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
WP_000751265.1|2406311_2407013_-	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.8	2.1e-39
>prophage 181
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2435168	2445279	2896381	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000030061.1|2435168_2436506_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	6.7e-18
WP_001237625.1|2436759_2437176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001031407.1|2437298_2438189_+	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001130051.1|2438381_2439878_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001793854.1|2440304_2440505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001172333.1|2440564_2442163_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.6	2.6e-77
WP_001028789.1|2442356_2442800_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000011688.1|2443079_2443292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066521.1|2443569_2445279_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
>prophage 182
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2450155	2452539	2896381		Enterococcus_phage(100.0%)	2	NA	NA
WP_000173336.1|2450155_2450692_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	47.5	1.1e-40
WP_001071721.1|2450688_2452539_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.9	1.3e-234
>prophage 183
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2457589	2458087	2896381		Canarypox_virus(100.0%)	1	NA	NA
WP_001065267.1|2457589_2458087_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	2.4e-21
>prophage 184
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2461524	2463275	2896381		Planktothrix_phage(50.0%)	2	NA	NA
WP_000923764.1|2461524_2462280_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.8e-31
WP_000143418.1|2462387_2463275_-	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	7.4e-05
>prophage 185
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2488950	2490810	2896381		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125631.1|2488950_2490810_+	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 186
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2514686	2515379	2896381		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185860.1|2514686_2515379_-	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 187
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2527770	2528784	2896381		Faustovirus(100.0%)	1	NA	NA
WP_000639198.1|2527770_2528784_-	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	22.2	8.2e-08
>prophage 188
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2534412	2536125	2896381		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138663.1|2534412_2536125_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	5.4e-20
>prophage 189
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2553268	2554027	2896381		Planktothrix_phage(100.0%)	1	NA	NA
WP_000154162.1|2553268_2554027_+	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 190
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2559820	2563120	2896381		Lactococcus_phage(33.33%)	5	NA	NA
WP_001059079.1|2559820_2560021_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
WP_001054111.1|2560147_2560717_-	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	34.8	2.8e-05
WP_000779134.1|2560969_2561365_-	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000491382.1|2561432_2561786_-	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000742840.1|2562280_2563120_-	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.4	1.4e-05
>prophage 191
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2573207	2582243	2896381	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000255583.1|2573207_2575142_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	4.4e-143
WP_000819098.1|2575178_2577839_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.8	4.6e-119
WP_000449218.1|2577926_2578739_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000177483.1|2579064_2580579_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	4.4e-90
WP_000884337.1|2580956_2582243_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
>prophage 192
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2588925	2598921	2896381		Bacillus_phage(40.0%)	7	NA	NA
WP_000375647.1|2588925_2590326_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
WP_000095328.1|2590603_2591887_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000101976.1|2593076_2593778_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000871610.1|2593790_2595617_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	2.1e-30
WP_001060146.1|2595609_2596944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104171.1|2596944_2597733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088649.1|2598120_2598921_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
>prophage 193
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2604801	2610136	2896381	transposase	Paenibacillus_phage(33.33%)	5	NA	NA
WP_088356251.1|2604801_2605930_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.0	6.4e-78
WP_000370465.1|2606118_2606634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|2606638_2607586_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_001794509.1|2607771_2608146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000649665.1|2608435_2610136_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	26.8	4.1e-20
>prophage 194
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2642111	2646321	2896381		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000136645.1|2642111_2643110_-	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.6e-14
WP_000925002.1|2643106_2644102_-	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_001045124.1|2644117_2645110_-	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000570808.1|2645340_2646321_+	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
>prophage 195
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2654587	2659682	2896381		Tupanvirus(50.0%)	5	NA	NA
WP_001223717.1|2654587_2655790_+	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.3	5.1e-09
WP_001015549.1|2655793_2656558_+	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_000414632.1|2656753_2657380_+	MFS transporter	NA	NA	NA	NA	NA
WP_000183771.1|2657590_2658367_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_001793810.1|2658701_2659682_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.3	1.3e-47
>prophage 196
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2664616	2665216	2896381		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|2664616_2665216_+	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 197
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2673102	2673876	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078278.1|2673102_2673876_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	6.4e-13
>prophage 198
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2679334	2680510	2896381		Clostridium_phage(100.0%)	1	NA	NA
WP_000469818.1|2679334_2680510_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.9	5.2e-30
>prophage 199
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2684533	2691098	2896381		Catovirus(50.0%)	6	NA	NA
WP_000037317.1|2684533_2685220_+	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	8.2e-28
WP_000565301.1|2685222_2685987_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000940769.1|2686006_2687830_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.4	3.0e-29
WP_000459062.1|2687819_2688848_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_001028294.1|2688860_2689970_+	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000413167.1|2689973_2691098_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	3.9e-128
>prophage 200
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2698115	2700600	2896381		Bacillus_phage(50.0%)	2	NA	NA
WP_000779509.1|2698115_2699378_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	2.5e-22
WP_000723445.1|2699454_2700600_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	3.2e-24
>prophage 201
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2703941	2706940	2896381		Indivirus(50.0%)	4	NA	NA
WP_001013476.1|2703941_2704901_+	cation transporter	NA	A0A1V0SED0	Indivirus	33.6	2.8e-10
WP_000356967.1|2704962_2705166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000171926.1|2705345_2705858_+	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000590840.1|2706199_2706940_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	6.5e-39
>prophage 202
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2710476	2720760	2896381		Catovirus(50.0%)	3	NA	NA
WP_000706134.1|2710476_2711502_+	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
WP_000826855.1|2711887_2713138_+	MFS transporter	NA	NA	NA	NA	NA
WP_160199076.1|2713584_2720760_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.9	4.5e-68
>prophage 203
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2725618	2726803	2896381		Klosneuvirus(100.0%)	1	NA	NA
WP_001084444.1|2725618_2726803_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.6	2.4e-35
>prophage 204
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2752296	2754355	2896381		Pontimonas_phage(50.0%)	2	NA	NA
WP_000166911.1|2752296_2752875_+	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	43.0	1.6e-13
WP_000818914.1|2753257_2754355_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
>prophage 205
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2764666	2770025	2896381		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000127979.1|2764666_2766223_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
WP_000837114.1|2766219_2767188_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000894660.1|2767775_2770025_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
>prophage 206
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2780986	2782492	2896381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008395.1|2780986_2782492_-	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 207
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2792177	2793707	2896381		Vibrio_phage(100.0%)	1	NA	NA
WP_000838204.1|2792177_2793707_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 208
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2800923	2801967	2896381		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645611.1|2800923_2801967_+	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.6	6.0e-14
>prophage 209
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2811836	2816380	2896381		Catovirus(50.0%)	3	NA	NA
WP_000975347.1|2811836_2813561_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
WP_000608835.1|2813700_2814375_+	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000925396.1|2814640_2816380_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	2.0e-62
>prophage 210
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2822888	2824325	2896381		Pandoravirus(100.0%)	1	NA	NA
WP_000163995.1|2822888_2824325_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.0	1.3e-30
>prophage 211
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2833132	2834794	2896381		Arthrobacter_phage(50.0%)	2	NA	NA
WP_000736790.1|2833132_2834083_+	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
WP_000570080.1|2834134_2834794_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	5.8e-23
>prophage 212
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2845398	2849847	2896381		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549309.1|2845398_2849847_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.7	1.7e-28
>prophage 213
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2863899	2864577	2896381		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911024.1|2863899_2864577_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.2e-31
>prophage 214
NZ_CP047791	Staphylococcus aureus strain UP_818 chromosome, complete genome	2896381	2878750	2895818	2896381	integrase	Staphylococcus_phage(84.62%)	39	2865651:2865666	2892690:2892705
2865651:2865666	attL	ATTTTTAGTAATGTTT	NA	NA	NA	NA
WP_000264743.1|2878750_2879956_-|integrase	site-specific integrase	integrase	A7YGM7	Staphylococcus_virus	99.5	6.5e-222
WP_160199067.1|2880081_2880696_+	ATPase	NA	M9QRQ8	Staphylococcus_phage	99.0	5.7e-105
WP_001013104.1|2880692_2880839_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	89.6	1.1e-14
WP_000705240.1|2880875_2881058_-	hypothetical protein	NA	A0A2I6PDR4	Staphylococcus_phage	100.0	5.3e-27
WP_020807995.1|2881127_2881859_-	helix-turn-helix transcriptional regulator	NA	S4SVC5	Staphylococcus_phage	100.0	6.9e-134
WP_000213811.1|2882010_2882223_+	helix-turn-helix transcriptional regulator	NA	A7TWF1	Staphylococcus_phage	100.0	1.6e-30
WP_000435343.1|2882270_2882531_+	hypothetical protein	NA	A0A2I6PDT7	Staphylococcus_phage	100.0	3.5e-40
WP_001662405.1|2882550_2882688_+	hypothetical protein	NA	A0ZS11	Staphylococcus_virus	97.8	3.7e-17
WP_001294156.1|2882764_2883004_+	hypothetical protein	NA	A0ZS12	Staphylococcus_virus	100.0	2.9e-33
WP_001025595.1|2883330_2883657_+	hypothetical protein	NA	G4KNN2	Staphylococcus_phage	100.0	5.4e-54
WP_001037095.1|2883653_2883872_+	hypothetical protein	NA	A0A2I6PDV4	Staphylococcus_phage	100.0	5.0e-32
WP_160199068.1|2883901_2884165_+	helix-turn-helix domain-containing protein	NA	A0A2I6PEL8	Staphylococcus_phage	98.9	1.3e-45
WP_160199069.1|2884176_2884338_+	DUF1270 domain-containing protein	NA	A9CR58	Staphylococcus_phage	98.1	3.3e-20
WP_000291089.1|2884429_2884690_+	DUF1108 family protein	NA	Q4ZBM7	Staphylococcus_phage	100.0	1.2e-43
WP_000815402.1|2884699_2884921_+	DUF2483 domain-containing protein	NA	B2ZYV2	Staphylococcus_phage	100.0	3.2e-34
WP_160199070.1|2884913_2885702_+	ATP-binding protein	NA	Q4ZBM5	Staphylococcus_phage	99.6	1.7e-141
WP_000704705.1|2885730_2886282_+	single-stranded DNA-binding protein	NA	Q4ZBM4	Staphylococcus_phage	100.0	3.4e-101
WP_085054053.1|2886294_2886966_+	hypothetical protein	NA	Q8SDM2	Staphylococcus_phage	99.1	1.7e-126
WP_000414755.1|2887104_2887386_-	hypothetical protein	NA	A0A1W6JPU7	Staphylococcus_phage	100.0	2.6e-49
WP_020808006.1|2887451_2888222_+	replication protein	NA	W5R8N2	Staphylococcus_phage	99.6	9.0e-116
WP_160199071.1|2888231_2889011_+	ATP-binding protein	NA	G4KNP1	Staphylococcus_phage	99.2	3.2e-145
WP_001123688.1|2889179_2889401_+	DUF3269 family protein	NA	Q9G021	Staphylococcus_phage	100.0	1.3e-35
WP_000451861.1|2889410_2889836_+	phage N-6-adenine-methyltransferase	NA	C8CGZ6	Staphylococcus_phage	100.0	4.7e-82
WP_000049780.1|2889832_2890237_+	DUF1064 domain-containing protein	NA	Q4ZAR7	Staphylococcus_virus	100.0	1.5e-66
WP_001187258.1|2890241_2890427_+	DUF3113 family protein	NA	A0A0H3U473	Staphylococcus_phage	98.4	1.6e-26
WP_000536050.1|2890427_2890790_+	hypothetical protein	NA	R4II61	Staphylococcus_phage	100.0	4.9e-48
WP_001126825.1|2890790_2891039_+	hypothetical protein	NA	Q4ZAR4	Staphylococcus_virus	100.0	1.2e-42
WP_001065102.1|2891052_2891289_+	DUF1024 family protein	NA	A0A0H3U313	Staphylococcus_phage	100.0	2.0e-34
WP_000454994.1|2891452_2891734_+	hypothetical protein	NA	A0A2I6PDX3	Staphylococcus_phage	100.0	8.5e-48
WP_001061835.1|2891910_2892468_+	hypothetical protein	NA	Q4ZA39	Staphylococcus_virus	95.1	8.0e-98
WP_001282074.1|2892504_2892750_+	hypothetical protein	NA	A0A2I6PDW7	Staphylococcus_phage	100.0	5.0e-36
2892690:2892705	attR	ATTTTTAGTAATGTTT	NA	NA	NA	NA
WP_000195767.1|2892746_2892983_+	DUF1381 domain-containing protein	NA	M1T303	Staphylococcus_phage	98.7	3.6e-36
WP_000483477.1|2893007_2893244_+	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
WP_000595238.1|2893236_2893386_+	transcriptional activator RinB	NA	A7TWB4	Staphylococcus_phage	100.0	4.8e-18
WP_001005262.1|2893544_2894195_+	hypothetical protein	NA	D2JLD8	Staphylococcus_phage	100.0	8.9e-117
WP_000265041.1|2894194_2894395_+	DUF1514 domain-containing protein	NA	R9QT57	Staphylococcus_phage	100.0	1.1e-28
WP_002955176.1|2894417_2894879_+	hypothetical protein	NA	R9QT84	Staphylococcus_phage	99.3	2.5e-73
WP_000406186.1|2894993_2895446_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	D2JLE1	Staphylococcus_phage	88.0	3.3e-70
WP_000026170.1|2895452_2895818_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	72.7	1.5e-49
