The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	0	35821	2819041	protease,tail,capsid,holin,head,terminase,transposase,portal	Staphylococcus_phage(96.77%)	38	NA	NA
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000154559.1|3609_4755_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114226.1|5675_6080_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268735.1|6484_7129_+|tail	phage tail protein	tail	A0EWZ9	Staphylococcus_phage	100.0	3.8e-120
WP_071621395.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_001643732.1|8039_12569_+|tail	phage tail tape measure protein	tail	A0EX03	Staphylococcus_phage	100.0	0.0e+00
WP_000567413.1|12565_14050_+|tail	phage tail protein	tail	A0EX04	Staphylococcus_phage	100.0	4.5e-297
WP_000582190.1|14065_17851_+	hypothetical protein	NA	A0EX05	Staphylococcus_phage	100.0	0.0e+00
WP_001153681.1|17840_17993_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040259.1|18039_18327_+	hypothetical protein	NA	G4KNR2	Staphylococcus_phage	100.0	9.9e-44
WP_000340977.1|18382_18757_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_000750406.1|19177_19951_+	staphylococcal enterotoxin type A	NA	A0EX09	Staphylococcus_phage	100.0	2.2e-146
WP_011447039.1|20059_20236_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_001791821.1|20288_20396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|20447_20702_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|20713_21469_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000919350.1|21659_22151_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
WP_020444758.1|22677_23136_+	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	4.9e-85
WP_000727649.1|23230_23680_-	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_000702263.1|24365_24716_+	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|24768_25029_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|25339_25519_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_000669728.1|26476_28546_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000277741.1|28843_30490_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_001068528.1|30737_32024_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|32223_32322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681966.1|32563_32740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|32997_33378_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991315.1|33374_34271_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645732.1|34271_34952_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|34948_35821_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
>prophage 2
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	41066	41468	2819041		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000205106.1|41066_41468_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
>prophage 3
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	45664	46225	2819041		Bacillus_virus(100.0%)	1	NA	NA
WP_000149686.1|45664_46225_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
>prophage 4
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	51724	54008	2819041		Bacillus_virus(100.0%)	2	NA	NA
WP_000284434.1|51724_53194_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.5	8.5e-107
WP_000040861.1|53186_54008_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 5
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	57698	64476	2819041		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|57698_58994_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|59102_59405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272063.1|59587_60280_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|60276_62469_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774552.1|62472_64476_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	9.8e-114
>prophage 6
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	71705	76733	2819041		Catovirus(33.33%)	5	NA	NA
WP_001231458.1|71705_72653_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.5e-16
WP_001147874.1|72733_74095_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	43.0	1.5e-102
WP_000548777.1|74264_74795_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140179.1|75041_76112_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|76178_76733_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 7
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	80186	80600	2819041		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001643743.1|80186_80600_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.5	3.0e-17
>prophage 8
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	85581	86211	2819041		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|85581_86211_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 9
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	101692	103429	2819041		Bacillus_phage(100.0%)	1	NA	NA
WP_000597238.1|101692_103429_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 10
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	119833	120562	2819041		Planktothrix_phage(100.0%)	1	NA	NA
WP_001144055.1|119833_120562_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
>prophage 11
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	131217	131562	2819041		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|131217_131562_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 12
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	141150	141891	2819041		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|141150_141891_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 13
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	149754	154034	2819041		Staphylococcus_phage(80.0%)	5	NA	NA
WP_147612242.1|149754_150537_+	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	38.6	8.7e-34
WP_000821649.1|150818_151538_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	34.6	4.9e-23
WP_000721567.1|151572_152301_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.8	1.3e-28
WP_000764684.1|152454_153240_+	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	42.7	2.9e-45
WP_001235656.1|153278_154034_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	40.8	2.3e-39
>prophage 14
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	157288	227577	2819041	protease,tRNA	Staphylococcus_phage(93.18%)	65	NA	NA
WP_000711499.1|157288_158635_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	51.1	2.5e-65
WP_000595635.1|158881_159397_-	membrane protein	NA	NA	NA	NA	NA
WP_001039022.1|160411_161131_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.7	6.4e-124
WP_001038766.1|161254_161971_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	5.5e-83
WP_001038734.1|163016_163733_+|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	97.1	6.6e-129
WP_001038742.1|163902_164622_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	98.3	1.0e-129
WP_001794363.1|164801_166541_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.6	3.2e-286
WP_000072622.1|166533_167688_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.3	7.8e-39
WP_000413389.1|167724_169542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095390.1|169803_170103_-	secretion protein	NA	NA	NA	NA	NA
WP_001053714.1|170117_171728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000619920.1|171770_172220_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001819963.1|172447_172807_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000182553.1|172932_175353_-	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_000731421.1|176319_176763_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001037039.1|176762_177206_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001791232.1|177380_177482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115390996.1|177604_177700_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000747804.1|178150_178597_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000125075.1|178789_179359_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
WP_001093574.1|179358_180726_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000414222.1|180874_181447_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
WP_000627550.1|181544_181889_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
WP_000669038.1|181929_182556_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
WP_000070654.1|182631_183627_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	3.8e-74
WP_001794016.1|183707_184358_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	1.0e-51
WP_016186903.1|184659_185115_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	3.5e-75
WP_000348372.1|185273_186752_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
WP_000778539.1|186756_187758_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	96.7	8.5e-183
WP_000718107.1|187754_188012_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672010.1|188077_188551_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	9.5e-84
WP_001801476.1|188555_189302_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.3e-139
WP_000109909.1|189594_191187_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
WP_000933819.1|191556_192750_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000366165.1|192874_193783_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
WP_000453316.1|193994_194828_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.6	1.2e-158
WP_000623481.1|195077_195431_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	97.4	4.2e-20
WP_001200542.1|195427_195793_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091444.1|196047_196350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|196608_197322_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_000492901.1|197779_198400_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001168914.1|198566_199202_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001030476.1|199499_199943_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
WP_001152695.1|199929_200373_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671059.1|200485_200956_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	85.8	7.7e-70
WP_000384171.1|201154_201379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|201654_202509_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989104.1|202595_203888_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	95.1	2.6e-216
WP_000221181.1|203887_204202_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	97.1	1.7e-52
WP_160175408.1|204844_206347_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
WP_001819953.1|206839_207871_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.3	5.8e-195
WP_000493891.1|207877_208510_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
WP_001159032.1|208520_209702_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
WP_001008556.1|209714_210179_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	97.4	1.9e-68
WP_001196351.1|210300_211302_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.1	5.0e-183
WP_014937042.1|211413_211533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266099.1|211535_212363_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|212935_213337_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764425.1|213455_214019_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
WP_000526541.1|214015_214969_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
WP_001025064.1|215078_216260_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
WP_001108722.1|216551_218966_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.8	0.0e+00
WP_000836472.1|218987_219299_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
WP_160175409.1|219622_226192_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	88.7	1.7e-295
WP_000284993.1|226308_227577_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	5.9e-56
>prophage 15
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	235714	239651	2819041		Salmonella_phage(50.0%)	4	NA	NA
WP_000733283.1|235714_236560_-	BlaZ family penicillin-hydrolyzing class A beta-lactamase PC1	NA	A0A1B0VBP7	Salmonella_phage	34.0	1.5e-31
WP_001096374.1|236666_238424_+	beta-lactam sensor/signal transducer BlaR1	NA	NA	NA	NA	NA
WP_001284656.1|238413_238794_+	penicillinase repressor BlaI	NA	NA	NA	NA	NA
WP_000690628.1|239057_239651_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	1.1e-41
>prophage 16
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	245234	250604	2819041		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|245234_246092_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048374.1|246120_246759_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000118301.1|246779_250604_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 17
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	259176	260883	2819041		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862084.1|259176_260883_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.8	2.1e-274
>prophage 18
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	267488	270119	2819041	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|267488_268751_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279341.1|268844_270119_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 19
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	273887	278023	2819041		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808837.1|273887_275492_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291426.1|275478_276639_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553919.1|276753_277200_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174275.1|277279_278023_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.9	8.3e-18
>prophage 20
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	295605	298803	2819041		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226930.1|295605_298803_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	5.5e-135
>prophage 21
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	303735	305493	2819041		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232655.1|303735_305493_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	3.3e-41
>prophage 22
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	310376	318541	2819041		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080025.1|310376_311078_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_073392727.1|311080_312742_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.0	1.7e-34
WP_000849445.1|313242_314730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038301.1|315022_317653_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	32.7	1.8e-46
WP_001114454.1|317668_318541_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
>prophage 23
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	322455	333609	2819041	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|322455_323376_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_016186894.1|323468_323564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|323788_325726_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049150.1|326152_327646_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791219.1|327874_328402_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	5.3e-11
WP_001125540.1|328430_328631_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|328677_329034_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032653.1|329175_329784_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	36.4	1.7e-21
WP_001280014.1|329802_330732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|330736_330847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127572.1|330894_332196_+	trigger factor	NA	NA	NA	NA	NA
WP_160175411.1|332346_333609_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	3.3e-139
>prophage 24
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	342625	347439	2819041	transposase,tRNA	Paenibacillus_phage(50.0%)	2	NA	NA
WP_094409958.1|342625_344193_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000425358.1|344808_347439_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	3.7e-153
>prophage 25
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	357554	393038	2819041	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|357554_358559_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019178.1|358560_359586_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|359608_360748_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|360766_361027_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749802.1|361301_363581_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000595001.1|363783_366057_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
WP_000364542.1|366078_366597_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058583.1|367024_369214_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869979.1|369225_369678_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|369674_370550_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590826.1|371010_372273_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044796.1|372288_374055_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001791215.1|374387_374516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682640.1|374515_375289_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102741.1|375449_376724_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.9	6.3e-106
WP_000704122.1|376808_377231_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|377330_377513_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000008061.1|377552_377699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985898.1|377935_378949_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409167.1|379258_380401_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000066097.1|380401_381520_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567025.1|382087_382756_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_160175412.1|382757_385235_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.9	5.5e-66
WP_160175413.1|385577_388208_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.9	4.2e-64
WP_000426912.1|388270_388531_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|388534_388963_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|388977_389286_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342267.1|389570_390209_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137775.1|390211_391135_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|391146_392415_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|392414_393038_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 26
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	409502	415666	2819041		Bacillus_phage(33.33%)	5	NA	NA
WP_000439692.1|409502_409964_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_000953291.1|410022_412170_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	9.1e-33
WP_001282570.1|412226_413201_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|413245_413497_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|413842_415666_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 27
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	419101	422209	2819041		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|419101_420934_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_160175415.1|421069_422209_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.5	8.8e-27
>prophage 28
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	428678	429626	2819041		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117769.1|428678_429626_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	4.9e-47
>prophage 29
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	432680	446408	2819041	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|432680_434072_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001794939.1|434406_435030_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|435040_435859_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217253.1|435919_437719_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
WP_001283055.1|437942_439049_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624581.1|439179_439857_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683921.1|439859_440960_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
WP_001062173.1|441073_442420_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	1.4e-55
WP_000924211.1|442429_443320_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
WP_001213908.1|443445_444231_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564316.1|444272_445136_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|445122_445533_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|445808_446408_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 30
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	452580	453204	2819041		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|452580_453204_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 31
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	458748	461560	2819041		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019697.1|458748_460095_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.9	2.1e-64
WP_000202178.1|460087_461560_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.1	1.4e-80
>prophage 32
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	469080	475650	2819041		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|469080_470418_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159866.1|470410_470641_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183386.1|470618_471500_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	5.8e-10
WP_001124985.1|471930_472383_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942216.1|472398_474078_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291540.1|474228_475650_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	6.6e-40
>prophage 33
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	482478	483885	2819041		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|482478_483885_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 34
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	491232	492717	2819041		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|491232_492717_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 35
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	498381	507879	2819041		Brevibacillus_phage(20.0%)	9	NA	NA
WP_000447733.1|498381_499269_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183424.1|499346_499853_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_160175417.1|499944_500676_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	22.2	3.6e-05
WP_000368652.1|500668_501211_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|501203_501941_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|502073_502799_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987777.1|502779_504531_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
WP_001574168.1|504782_505715_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_160175418.1|505701_507879_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	40.5	1.7e-31
>prophage 36
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	511138	513817	2819041		Bacillus_phage(50.0%)	3	NA	NA
WP_001151997.1|511138_511387_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_115283854.1|511494_512448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902107.1|512437_513817_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.3	2.9e-56
>prophage 37
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	523224	528365	2819041		Bacillus_phage(25.0%)	6	NA	NA
WP_001043863.1|523224_523497_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|523927_524500_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774679.1|524502_525228_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001819897.1|525244_526189_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|526280_526730_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_001269937.1|527198_528365_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	1.5e-34
>prophage 38
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	532027	532603	2819041		Bacillus_virus(100.0%)	1	NA	NA
WP_000005208.1|532027_532603_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	4.6e-08
>prophage 39
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	535974	543481	2819041	tRNA	unidentified_phage(25.0%)	5	NA	NA
WP_000361536.1|535974_537177_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	42.5	1.4e-35
WP_000049917.1|537163_538135_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525060.1|538158_540852_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858795.1|541173_542466_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	4.3e-54
WP_000362222.1|542794_543481_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
>prophage 40
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	547172	547799	2819041		Bacillus_phage(100.0%)	1	NA	NA
WP_001108885.1|547172_547799_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 41
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	557263	558142	2819041		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|557263_558142_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 42
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	596733	607190	2819041	transposase	Staphylococcus_phage(50.0%)	14	NA	NA
WP_000282169.1|596733_597438_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.3	1.9e-11
WP_001814377.1|597682_597877_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001165814.1|597888_598140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404628.1|598177_599302_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995290.1|599317_599755_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934885.1|600178_601135_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|601334_601814_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166055.1|601828_602668_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	5.1e-48
WP_000159899.1|602753_603287_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|603279_603708_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473654.1|603719_604220_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|604219_604441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|604513_605461_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_160175420.1|605699_607190_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.8	7.7e-23
>prophage 43
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	610598	612610	2819041		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|610598_611258_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166793.1|611254_612610_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 44
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	618978	619770	2819041		Halovirus(100.0%)	1	NA	NA
WP_160175422.1|618978_619770_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	5.6e-12
>prophage 45
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	623305	628331	2819041	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_031764193.1|623305_624442_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	1.7e-33
WP_001794103.1|624473_625103_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|625121_625391_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|625552_625861_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|626031_626232_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_160175423.1|626428_626830_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216956.1|627065_628331_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.0	4.0e-12
>prophage 46
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	636173	637775	2819041		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|636173_637775_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 47
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	642200	645654	2819041		Indivirus(50.0%)	3	NA	NA
WP_000079448.1|642200_643052_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.8e-16
WP_000974850.1|643058_643700_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077549.1|643839_645654_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.3	2.3e-154
>prophage 48
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	649068	649770	2819041		Tupanvirus(100.0%)	1	NA	NA
WP_000571253.1|649068_649770_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.0e-13
>prophage 49
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	657251	659604	2819041		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000153717.1|657251_658034_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.7	1.2e-27
WP_000604802.1|659037_659604_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	31.8	1.7e-23
>prophage 50
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	663931	667497	2819041	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_000283027.1|663931_665194_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	1.7e-95
WP_001123276.1|665341_665527_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_000277741.1|665850_667497_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 51
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	676766	681160	2819041		Bacillus_phage(50.0%)	2	NA	NA
WP_001289586.1|676766_679169_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	1.1e-92
WP_001574370.1|679168_681160_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 52
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	686777	688424	2819041		Vibrio_phage(100.0%)	1	NA	NA
WP_001088983.1|686777_688424_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.5	1.9e-22
>prophage 53
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	692093	693215	2819041		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691309.1|692093_693215_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.1	2.1e-09
>prophage 54
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	697364	703020	2819041		Phage_Wrath(25.0%)	7	NA	NA
WP_001208760.1|697364_697988_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
WP_000380738.1|698367_699231_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	1.2e-15
WP_001791425.1|699304_699409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688127.1|699405_700383_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085657.1|700539_700809_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|701262_701412_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000089857.1|701502_703020_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.8	2.7e-92
>prophage 55
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	713156	717432	2819041		Bacillus_phage(50.0%)	6	NA	NA
WP_000841344.1|713156_713690_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|713828_714017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000624452.1|714129_714732_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670311.1|714728_715820_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603961.1|715823_716555_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001794121.1|716523_717432_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	9.8e-21
>prophage 56
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	721386	748185	2819041	capsid,transposase,head	Staphylococcus_phage(63.64%)	35	NA	NA
WP_077670291.1|721386_721722_-|head	phage head morphogenesis protein	head	A0A1J0MFV1	Staphylococcus_phage	60.4	2.6e-27
WP_000600810.1|721789_721927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574384.1|721923_722190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429703.1|722235_722514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000906224.1|722664_722913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217295.1|723669_723864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791418.1|723874_724048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000414196.1|724716_725301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791415.1|725267_725396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000905625.1|725460_725658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077670290.1|725659_726325_-|capsid	phage capsid protein	capsid	A0A1J0MF61	Staphylococcus_phage	53.0	4.6e-60
WP_000585095.1|726385_726637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094409958.1|727403_728970_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000477487.1|729820_730237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121213.1|730663_731611_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	99.7	1.6e-183
WP_000006110.1|731822_732008_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_031788482.1|732400_732511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002343.1|733212_733419_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
WP_001071312.1|733715_733928_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	3.6e-19
WP_000134547.1|734613_734898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805733.1|735048_735369_+	DUF961 domain-containing protein	NA	NA	NA	NA	NA
WP_000386891.1|735382_735685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000388596.1|735926_736952_+	replication initiation factor domain-containing protein	NA	NA	NA	NA	NA
WP_000692007.1|737012_738068_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_000015642.1|738072_738333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000358146.1|738344_738728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049264.1|738762_741258_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_001251205.1|741311_742670_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	29.9	4.0e-42
WP_000681139.1|742674_744522_+	membrane protein	NA	NA	NA	NA	NA
WP_000247474.1|744511_745558_+	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	36.9	8.1e-19
WP_000810443.1|745564_746155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001255381.1|746210_746567_+	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_000746372.1|746675_747179_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078367270.1|747159_747696_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	1.3e-28
WP_001659797.1|747987_748185_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
>prophage 57
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	753256	753733	2819041		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|753256_753733_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 58
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	759676	766158	2819041		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_160175427.1|759676_760495_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	34.7	9.1e-26
WP_001077635.1|760969_761512_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516249.1|761517_763527_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.2	4.1e-59
WP_000073334.1|763539_766158_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	3.8e-41
>prophage 59
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	775571	776615	2819041		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|775571_776615_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 60
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	780814	786358	2819041		Bacillus_virus(33.33%)	4	NA	NA
WP_000664777.1|780814_782101_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
WP_000089941.1|782100_783366_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_001293307.1|783396_784110_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042907377.1|784114_786358_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 61
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	791498	803227	2819041	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864182.1|791498_792470_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282296.1|792484_793402_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|793571_793922_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043642.1|794222_796340_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020856.1|796344_796662_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|796658_796943_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097463.1|796963_798139_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036631.1|798159_798627_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000139497.1|798916_803227_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 62
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	807500	808271	2819041		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|807500_808271_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 63
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	813045	826716	2819041	protease,tRNA	Erwinia_phage(16.67%)	11	NA	NA
WP_000379051.1|813045_814449_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	6.4e-27
WP_000072681.1|814514_815060_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015609.1|815056_815953_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	6.1e-31
WP_000195263.1|816370_817678_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001557331.1|817833_819909_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000620184.1|820082_820955_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000672864.1|821126_822371_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_001041658.1|822398_823517_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000110252.1|823743_824652_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	2.3e-17
WP_001020801.1|824673_825840_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176401.1|825948_826716_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 64
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	840100	842221	2819041		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|840100_840832_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|840947_841181_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|841486_842221_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 65
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	852592	854587	2819041		Moumouvirus(100.0%)	1	NA	NA
WP_000579564.1|852592_854587_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 66
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	857734	858670	2819041	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|857734_858670_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 67
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	863679	865936	2819041		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|863679_864879_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|865094_865313_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368225.1|865312_865936_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	6.1e-22
>prophage 68
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	869250	869862	2819041		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|869250_869862_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 69
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	873829	878440	2819041		Halovirus(33.33%)	4	NA	NA
WP_001190910.1|873829_874930_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	9.6e-63
WP_000767018.1|874931_876206_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|876223_877105_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178615.1|877132_878440_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 70
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	883371	886125	2819041	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384706.1|883371_886125_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	2.1e-90
>prophage 71
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	905481	905679	2819041		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245800.1|905481_905679_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	1.2e-19
>prophage 72
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	914590	916766	2819041	transposase	Staphylococcus_virus(100.0%)	2	NA	NA
WP_000277709.1|914590_916237_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
WP_001801391.1|916538_916766_-	hypothetical protein	NA	Q4ZBW5	Staphylococcus_virus	67.7	1.9e-18
>prophage 73
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	920264	922240	2819041	transposase	Paenibacillus_phage(50.0%)	2	NA	NA
WP_094409958.1|920264_921832_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000669541.1|921889_922240_-	complement inhibitor SCIN-C	NA	A7TWS0	Staphylococcus_phage	50.0	1.9e-20
>prophage 74
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	933674	938232	2819041		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|933674_933989_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249264.1|934161_936510_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
WP_000161937.1|936519_938232_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
>prophage 75
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	943110	944169	2819041	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|943110_944169_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 76
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	956148	959059	2819041		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|956148_956631_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263793.1|956632_957175_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|957244_957634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|957636_957891_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757584.1|958129_959059_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	6.5e-12
>prophage 77
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	980707	984350	2819041		Mycoplasma_phage(50.0%)	4	NA	NA
WP_000433551.1|980707_981802_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020627.1|981814_982354_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000455584.1|982497_982773_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|982943_984350_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
>prophage 78
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	988991	989543	2819041		Synechococcus_phage(100.0%)	1	NA	NA
WP_000957036.1|988991_989543_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 79
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	995657	1000037	2819041		Bacillus_virus(50.0%)	5	NA	NA
WP_001289622.1|995657_995891_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	1.3e-09
WP_000040041.1|996127_997846_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|997848_998115_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505964.1|998268_998811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685075.1|998864_1000037_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.6	1.5e-74
>prophage 80
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1003216	1017979	2819041		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921981.1|1003216_1004617_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.4e-10
WP_000273254.1|1004609_1005416_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101912.1|1005683_1006931_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709288.1|1006952_1008431_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	9.2e-77
WP_000238673.1|1008445_1009012_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
WP_000030814.1|1009014_1010043_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	7.6e-62
WP_000483716.1|1010035_1011520_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.4	8.5e-46
WP_000032734.1|1011498_1013688_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.2	5.1e-140
WP_000666808.1|1013680_1014352_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000848351.1|1014353_1014617_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174050.1|1014616_1015321_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.6	7.3e-48
WP_001010391.1|1015324_1016449_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861576.1|1016435_1016918_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_000225845.1|1017118_1017979_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	1.2e-39
>prophage 81
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1028216	1031990	2819041		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001074519.1|1028216_1031990_+	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	38.0	1.1e-54
>prophage 82
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1035656	1066003	2819041	holin,bacteriocin,protease	Staphylococcus_phage(16.67%)	33	NA	NA
WP_000676568.1|1035656_1036730_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	31.7	1.1e-15
WP_001088791.1|1036811_1037993_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_000284455.1|1038030_1038360_+	staphostatin B	NA	NA	NA	NA	NA
WP_000184947.1|1038595_1039417_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150205.1|1039409_1040213_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000526678.1|1040199_1041873_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_001814117.1|1041859_1043071_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_072357920.1|1043174_1043252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070967.1|1043402_1044341_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000620943.1|1044392_1044944_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001794164.1|1045033_1045324_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	2.6e-07
WP_001794249.1|1045387_1045519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081338.1|1045565_1046525_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766009.1|1047015_1047372_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000719183.1|1047460_1048942_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000410718.1|1048947_1049235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791476.1|1049575_1049866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571191.1|1049953_1050595_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	5.0e-19
WP_000873929.1|1050591_1050912_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000870819.1|1050914_1052879_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_001794574.1|1052922_1053195_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_001790623.1|1053204_1053306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119695.1|1053844_1053922_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_001033867.1|1054222_1054825_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000214898.1|1054839_1055016_-	YkvS family protein	NA	NA	NA	NA	NA
WP_000668820.1|1055214_1056201_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000876825.1|1056281_1056500_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000287265.1|1056709_1057279_+	competence protein ComK	NA	NA	NA	NA	NA
WP_000414169.1|1057767_1059279_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000021872.1|1059417_1060776_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_160175436.1|1060792_1063117_-|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	26.8	4.0e-10
WP_000928413.1|1063335_1064139_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049957.1|1064440_1066003_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
>prophage 83
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1087222	1089031	2819041		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082722.1|1087222_1089031_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	9.3e-47
>prophage 84
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1093013	1106823	2819041	transposase	Bacillus_virus(28.57%)	12	NA	NA
WP_160175441.1|1093013_1094627_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.3	4.1e-280
WP_094409958.1|1094922_1096489_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_001180271.1|1096578_1097460_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001574526.1|1097471_1098122_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000427776.1|1098114_1099095_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_001067041.1|1099097_1100084_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
WP_073392975.1|1100134_1101604_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000121211.1|1101718_1102666_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000517177.1|1102657_1102924_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000197096.1|1103135_1104791_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000786746.1|1104809_1105751_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	9.3e-06
WP_000140043.1|1105740_1106823_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	2.4e-18
>prophage 85
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1115418	1122229	2819041		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619360.1|1115418_1116564_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047061.1|1116674_1117544_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353950.1|1117602_1120212_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044234.1|1120414_1122229_-	O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	8.8e-37
>prophage 86
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1129299	1132953	2819041		Bacillus_phage(100.0%)	1	NA	NA
WP_000154949.1|1129299_1132953_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
>prophage 87
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1143108	1150158	2819041		Staphylococcus_phage(33.33%)	5	NA	NA
WP_000185311.1|1143108_1144038_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.5	1.8e-38
WP_000138487.1|1144432_1145677_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000167321.1|1145785_1146976_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.0	1.3e-33
WP_001067294.1|1148772_1149150_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1149564_1150158_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 88
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1160092	1163720	2819041		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009683.1|1160092_1161568_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	1.2e-47
WP_000046076.1|1161698_1162907_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143497.1|1163360_1163720_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 89
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1167763	1170432	2819041		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1167763_1168978_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129645.1|1168974_1170432_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	4.4e-39
>prophage 90
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1183643	1187166	2819041		environmental_halophage(50.0%)	3	NA	NA
WP_160175493.1|1183643_1184885_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.1e-110
WP_000205572.1|1184999_1186307_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1186404_1187166_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 91
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1191115	1192141	2819041		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571209.1|1191115_1192141_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.2e-28
>prophage 92
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1195250	1200428	2819041		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1195250_1195607_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147955.1|1195750_1196071_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1196220_1196760_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150036.1|1196842_1197559_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.7	6.8e-17
WP_000974455.1|1197706_1198129_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1198527_1199022_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255545.1|1199177_1199795_+	amino acid transporter	NA	NA	NA	NA	NA
WP_016187137.1|1199867_1200428_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	3.8e-31
>prophage 93
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1203833	1205077	2819041		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1203833_1204034_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001574556.1|1204390_1205077_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 94
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1214531	1223287	2819041		Staphylococcus_phage(50.0%)	8	NA	NA
WP_001574560.1|1214531_1215260_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	4.8e-18
WP_000999096.1|1215547_1216162_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_001085185.1|1217127_1217592_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_001050041.1|1217613_1219986_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	1.9e-92
WP_001165967.1|1220019_1220760_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000556760.1|1220888_1221122_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785248.1|1221188_1221647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1221982_1223287_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 95
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1233975	1239675	2819041		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1233975_1234563_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1235131_1236076_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1236184_1237180_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369719.1|1237176_1238088_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134960.1|1238739_1239675_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	8.4e-84
>prophage 96
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1244072	1246919	2819041		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662687.1|1244072_1246919_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 97
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1250237	1251077	2819041		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000749385.1|1250237_1251077_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 98
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1257515	1263220	2819041		Streptococcus_phage(66.67%)	5	NA	NA
WP_000370984.1|1257515_1258598_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.8	1.2e-44
WP_000686342.1|1258961_1259828_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192947.1|1259971_1260613_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
WP_000258151.1|1260776_1261832_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1262149_1263220_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 99
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1273202	1295415	2819041		uncultured_Caudovirales_phage(38.46%)	17	NA	NA
WP_001245566.1|1273202_1274159_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
WP_000876311.1|1274145_1275117_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	80.2	7.8e-141
WP_000562498.1|1275493_1276465_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1276584_1278690_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1278652_1279051_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068491.1|1279852_1280719_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930016.1|1280738_1281239_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
WP_000193750.1|1281578_1283084_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031788440.1|1283161_1283263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429002.1|1283353_1284271_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	8.2e-07
WP_000197262.1|1284822_1285365_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663016.1|1285523_1286582_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.5	5.7e-20
WP_000180987.1|1286821_1288336_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589241.1|1288328_1289306_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.1e-25
WP_000983677.1|1289526_1291308_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525101.1|1291319_1293203_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	8.8e-56
WP_000098285.1|1293474_1295415_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 100
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1298554	1367735	2819041	transposase,bacteriocin,tRNA	Staphylococcus_phage(24.0%)	72	NA	NA
WP_001217804.1|1298554_1299706_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
WP_000604508.1|1299689_1300283_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
WP_000446724.1|1300633_1301302_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1301303_1301723_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_160175449.1|1301726_1302440_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	3.8e-52
WP_000637686.1|1302538_1303123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093552.1|1303402_1303843_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1304184_1304658_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1304632_1305319_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244416.1|1305318_1306374_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_094409958.1|1306452_1308019_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000702776.1|1308108_1309092_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.0	7.3e-62
WP_000931237.1|1309223_1310063_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
WP_000450253.1|1310276_1311626_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001292237.1|1311846_1313028_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_001266540.1|1313330_1315289_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_000640738.1|1315294_1316215_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_001574605.1|1316211_1316976_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001107240.1|1317225_1317708_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_000216727.1|1317881_1318334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041284.1|1318630_1319797_-	multidrug efflux MFS transporter NorA	NA	NA	NA	NA	NA
WP_000776010.1|1320006_1320429_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001191871.1|1320615_1321233_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_000154465.1|1321229_1321514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952030.1|1321668_1323042_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	1.2e-46
WP_000005632.1|1323127_1324681_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_000180420.1|1324963_1325251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160175450.1|1325285_1326194_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_000794424.1|1326296_1327223_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001283444.1|1327449_1327893_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000857616.1|1328019_1329693_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	24.2	2.0e-11
WP_000737163.1|1329689_1331321_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	28.2	2.3e-12
WP_000469883.1|1331539_1332415_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358501.1|1332586_1333270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148821.1|1333272_1333731_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1333732_1334299_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
WP_000638614.1|1334393_1334936_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000545116.1|1335015_1335315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000733427.1|1335452_1335842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259673.1|1335908_1336352_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160175451.1|1336478_1337168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105942.1|1337830_1338505_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
WP_000361064.1|1338599_1338977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159128.1|1339214_1339580_+	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	47.8	8.5e-24
WP_000378396.1|1339572_1341753_+	cadmium-translocating P-type ATPase CadA	NA	E4ZFI9	Streptococcus_phage	63.7	9.3e-251
WP_000277738.1|1342115_1343762_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.4	1.0e-289
WP_000277154.1|1343828_1345262_-	multi-copper oxidase Mco	NA	NA	NA	NA	NA
WP_000069452.1|1345276_1347322_-	copper-translocating P-type ATPase CopB	NA	E4ZFI9	Streptococcus_phage	29.2	2.3e-65
WP_000690626.1|1347588_1348164_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	2.9e-42
WP_000838599.1|1348498_1349494_-	YeiH family protein	NA	NA	NA	NA	NA
WP_000377738.1|1349618_1350440_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791613.1|1350741_1350834_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000397995.1|1351062_1351386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998976.1|1352602_1353028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160175452.1|1353024_1353510_-	replication protein A	NA	NA	NA	NA	NA
WP_000843733.1|1353817_1354561_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_001002795.1|1355110_1355206_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000761344.1|1355420_1355762_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000145511.1|1355848_1356709_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000273007.1|1357073_1357574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001582045.1|1357640_1357967_-	recombinase	NA	NA	NA	NA	NA
WP_001643491.1|1357906_1358284_-	recombinase	NA	NA	NA	NA	NA
WP_000277741.1|1358438_1360085_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_000593106.1|1360446_1361073_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.1e-22
WP_000831610.1|1361084_1361396_-	YxeA family protein	NA	NA	NA	NA	NA
WP_160175453.1|1361399_1363334_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000726502.1|1363408_1363702_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000358995.1|1364081_1364477_-	thioredoxin-dependent arsenate reductase	NA	A0A2H4PQT9	Staphylococcus_phage	86.3	8.5e-62
WP_000153633.1|1364494_1365784_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	81.1	5.6e-187
WP_000120605.1|1365783_1366098_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4PQT4	Staphylococcus_phage	73.1	4.7e-39
WP_001035802.1|1366813_1367026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105942.1|1367060_1367735_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
>prophage 101
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1373039	1373513	2819041		Pandoravirus(100.0%)	1	NA	NA
WP_000833480.1|1373039_1373513_-	cupin	NA	A0A291AU44	Pandoravirus	38.7	4.6e-14
>prophage 102
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1378762	1379560	2819041		Lactobacillus_virus(100.0%)	1	NA	NA
WP_000731642.1|1378762_1379560_+	LysM peptidoglycan-binding domain-containing protein	NA	C1KFN7	Lactobacillus_virus	35.8	2.1e-06
>prophage 103
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1384281	1385043	2819041		Planktothrix_phage(100.0%)	1	NA	NA
WP_000153733.1|1384281_1385043_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.2e-33
>prophage 104
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1389409	1390453	2819041		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_001030763.1|1389409_1390453_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.1	3.8e-16
>prophage 105
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1396975	1397773	2819041		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1396975_1397773_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 106
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1401000	1404959	2819041		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1401000_1402728_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793055.1|1403148_1404444_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1404560_1404959_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 107
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1411892	1412636	2819041		Indivirus(100.0%)	1	NA	NA
WP_000894458.1|1411892_1412636_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-12
>prophage 108
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1425490	1426051	2819041	integrase	Streptococcus_phage(100.0%)	1	1419644:1419658	1429633:1429647
1419644:1419658	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044966.1|1425490_1426051_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
WP_001044966.1|1425490_1426051_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
1429633:1429647	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 109
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1439004	1442358	2819041		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1439004_1440015_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1440513_1441035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180233.1|1441062_1442358_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 110
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1449889	1451212	2819041		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860607.1|1449889_1451212_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	8.2e-109
>prophage 111
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1462516	1463173	2819041		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455258.1|1462516_1463173_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	6.4e-46
>prophage 112
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1466840	1468217	2819041		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382588.1|1466840_1468217_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	6.7e-21
>prophage 113
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1493084	1493747	2819041		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|1493084_1493747_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 114
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1500335	1501523	2819041		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250820.1|1500335_1501523_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	1.5e-45
>prophage 115
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1504550	1515504	2819041		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1504550_1506632_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1506754_1507225_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1507290_1507704_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1507801_1508056_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001819727.1|1508192_1511789_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	4.3e-67
WP_000918664.1|1511952_1515504_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	6.1e-50
>prophage 116
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1519187	1523970	2819041	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1519187_1519736_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1519748_1519931_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001791441.1|1519986_1520130_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872867.1|1520244_1520814_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664740.1|1520894_1521419_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1521418_1522165_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370181.1|1522172_1522577_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631982.1|1522569_1523970_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	2.5e-55
>prophage 117
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1529981	1532438	2819041	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1529981_1532438_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 118
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1551522	1562125	2819041	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1551522_1553010_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_160175458.1|1553062_1553155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613720.1|1553548_1554025_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154303.1|1554021_1554387_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167936.1|1554364_1555168_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	6.7e-21
WP_000057594.1|1555383_1556316_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1556494_1557376_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1557934_1560028_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1560285_1560825_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176721.1|1560829_1562125_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.3	8.2e-13
>prophage 119
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1571381	1573846	2819041		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1571381_1572347_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_160175460.1|1572493_1573846_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 120
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1579730	1582828	2819041	tRNA	Hokovirus(50.0%)	2	NA	NA
WP_160175461.1|1579730_1581704_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.6	5.5e-93
WP_000279925.1|1581988_1582828_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 121
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1586734	1587352	2819041		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1586734_1587352_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 122
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1596063	1597761	2819041		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109044.1|1596063_1597761_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 123
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1614398	1620635	2819041		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170274.1|1614398_1615403_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.1	1.4e-23
WP_000825534.1|1615736_1616579_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467992.1|1616615_1617275_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569267.1|1617278_1618304_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	1.4e-31
WP_001036658.1|1618594_1619737_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_000634110.1|1619729_1620635_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.4	7.2e-48
>prophage 124
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1644172	1646954	2819041		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072632.1|1644172_1645405_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	2.7e-45
WP_000028598.1|1645397_1646954_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.5	1.7e-286
>prophage 125
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1658378	1658705	2819041	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001799349.1|1658378_1658705_+|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	85.4	4.3e-11
>prophage 126
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1662013	1665046	2819041		Hokovirus(50.0%)	2	NA	NA
WP_000424963.1|1662013_1663555_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1663579_1665046_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 127
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1674146	1675670	2819041		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930503.1|1674146_1675670_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.2	5.5e-40
>prophage 128
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1684822	1705827	2819041	terminase,integrase,coat	Staphylococcus_phage(81.82%)	30	1684099:1684116	1699200:1699217
1684099:1684116	attL	ATATTATTGTTCTTCTTT	NA	NA	NA	NA
WP_000813311.1|1684822_1685335_-	hypothetical protein	NA	Q4ZE83	Staphylococcus_phage	100.0	1.4e-69
WP_073392942.1|1685452_1685890_-	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	58.2	9.8e-27
WP_000801980.1|1686031_1687000_-	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	2.7e-24
WP_001293071.1|1687276_1687846_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	4.6e-101
WP_001656917.1|1687842_1688055_-	hypothetical protein	NA	Q4ZE86	Staphylococcus_phage	97.1	5.4e-31
WP_000771361.1|1688186_1688714_-|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	100.0	6.8e-91
WP_000214170.1|1688766_1689420_-	hypothetical protein	NA	Q4ZE82	Staphylococcus_phage	99.5	7.6e-116
WP_001288442.1|1689450_1689795_-	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	91.7	1.3e-50
WP_001019762.1|1690502_1691144_-	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	92.5	4.7e-110
WP_000356942.1|1691140_1691521_-	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	96.8	1.7e-67
WP_160175467.1|1691830_1693540_-	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	92.6	1.1e-302
WP_001002709.1|1693553_1694423_-	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	96.2	5.3e-165
WP_001103967.1|1694487_1694814_-	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	96.3	3.5e-53
WP_000403837.1|1694814_1695198_-	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	4.8e-62
WP_001231376.1|1695199_1695403_-	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	98.5	2.0e-30
WP_000784892.1|1695369_1695543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138305.1|1695554_1695827_-	winged helix-turn-helix domain-containing protein	NA	Q4ZE77	Staphylococcus_phage	94.4	1.2e-43
WP_001611932.1|1695827_1695992_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000230361.1|1696140_1696764_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000270135.1|1696924_1698139_+|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	97.3	3.3e-221
WP_000400841.1|1698251_1698971_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q4ZE81	Staphylococcus_phage	29.8	3.7e-23
WP_000897044.1|1699202_1699445_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
1699200:1699217	attR	ATATTATTGTTCTTCTTT	NA	NA	NA	NA
WP_000934799.1|1699496_1700000_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1700020_1700317_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1700560_1700752_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1700837_1701935_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1701946_1702150_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373076.1|1702179_1703061_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001573568.1|1703214_1704060_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655687.1|1704723_1705827_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 129
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1715748	1716591	2819041		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209478.1|1715748_1716591_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.2	4.5e-12
>prophage 130
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1738001	1740736	2819041		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280814.1|1738001_1739024_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.1	6.7e-10
WP_001191936.1|1739001_1739946_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449073.1|1739935_1740736_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	44.4	1.5e-41
>prophage 131
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1758973	1759651	2819041		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911024.1|1758973_1759651_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.2e-31
>prophage 132
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1773703	1778152	2819041		Mycobacterium_phage(100.0%)	1	NA	NA
WP_160175470.1|1773703_1778152_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.7	1.7e-28
>prophage 133
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1788756	1790418	2819041		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000570080.1|1788756_1789416_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	5.8e-23
WP_160175471.1|1789467_1790418_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 134
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1799225	1800662	2819041		Pandoravirus(100.0%)	1	NA	NA
WP_000163995.1|1799225_1800662_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.0	1.3e-30
>prophage 135
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1807170	1811714	2819041		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925396.1|1807170_1808910_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	2.0e-62
WP_000608835.1|1809175_1809850_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975347.1|1809989_1811714_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 136
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1821583	1822627	2819041		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645611.1|1821583_1822627_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.6	6.0e-14
>prophage 137
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1829843	1831373	2819041		Vibrio_phage(100.0%)	1	NA	NA
WP_000838204.1|1829843_1831373_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 138
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1841058	1842564	2819041		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008395.1|1841058_1842564_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 139
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1853525	1858884	2819041		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1853525_1855775_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837114.1|1856362_1857331_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127979.1|1857327_1858884_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 140
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1869195	1871254	2819041		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818914.1|1869195_1870293_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166911.1|1870675_1871254_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	43.0	1.6e-13
>prophage 141
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1879066	1880659	2819041		Planktothrix_phage(100.0%)	1	NA	NA
WP_000067363.1|1879066_1880659_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	5.4e-22
>prophage 142
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1896751	1897936	2819041		Klosneuvirus(100.0%)	1	NA	NA
WP_001084444.1|1896751_1897936_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.6	2.4e-35
>prophage 143
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1902794	1913078	2819041		Tupanvirus(50.0%)	3	NA	NA
WP_000605273.1|1902794_1909970_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.9	3.4e-68
WP_000826855.1|1910416_1911667_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706134.1|1912052_1913078_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 144
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1916614	1919613	2819041		Bacillus_virus(50.0%)	4	NA	NA
WP_000590840.1|1916614_1917355_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	6.5e-39
WP_000171926.1|1917696_1918209_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356967.1|1918388_1918592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013476.1|1918653_1919613_-	cation transporter	NA	A0A1V0SED0	Indivirus	33.6	2.8e-10
>prophage 145
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1922954	1925439	2819041		Catovirus(50.0%)	2	NA	NA
WP_000723445.1|1922954_1924100_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	3.2e-24
WP_000779509.1|1924176_1925439_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	2.5e-22
>prophage 146
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1932456	1939021	2819041		Catovirus(50.0%)	6	NA	NA
WP_000413167.1|1932456_1933581_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	3.9e-128
WP_001028294.1|1933584_1934694_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1934706_1935735_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940769.1|1935724_1937548_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.4	3.0e-29
WP_000565301.1|1937567_1938332_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037317.1|1938334_1939021_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	8.2e-28
>prophage 147
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1943044	1944220	2819041		Clostridium_phage(100.0%)	1	NA	NA
WP_000469818.1|1943044_1944220_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.9	5.2e-30
>prophage 148
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1949678	1950452	2819041		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078278.1|1949678_1950452_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	6.4e-13
>prophage 149
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1958338	1958938	2819041		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1958338_1958938_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 150
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1963872	1968967	2819041		Catovirus(50.0%)	5	NA	NA
WP_001793810.1|1963872_1964853_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.3	1.3e-47
WP_000183771.1|1965187_1965964_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414632.1|1966174_1966801_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|1966996_1967761_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223717.1|1967764_1968967_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.3	5.1e-09
>prophage 151
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	1977233	1981443	2819041		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1977233_1978214_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045124.1|1978444_1979437_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000925002.1|1979452_1980448_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136645.1|1980444_1981443_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.6e-14
>prophage 152
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2013465	2018800	2819041	transposase	Acidithiobacillus_phage(33.33%)	5	NA	NA
WP_000649665.1|2013465_2015166_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	26.8	4.1e-20
WP_001794509.1|2015455_2015830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|2016015_2016963_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000370465.1|2016967_2017483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088356251.1|2017670_2018800_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.0	6.4e-78
>prophage 153
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2024680	2034676	2819041		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2024680_2025481_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104171.1|2025868_2026657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060146.1|2026657_2027992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871610.1|2027984_2029811_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	2.1e-30
WP_000101976.1|2029823_2030525_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2031714_2032998_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2033275_2034676_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 154
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2041358	2050394	2819041	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884337.1|2041358_2042645_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177483.1|2043022_2044537_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	4.4e-90
WP_160175476.1|2044862_2045675_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819098.1|2045762_2048423_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.8	4.6e-119
WP_000255583.1|2048459_2050394_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	4.4e-143
>prophage 155
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2060481	2063781	2819041		Faecalibacterium_phage(33.33%)	5	NA	NA
WP_000742840.1|2060481_2061321_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.4	1.4e-05
WP_000491382.1|2061815_2062169_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|2062236_2062632_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054111.1|2062884_2063454_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	34.8	2.8e-05
WP_001059079.1|2063580_2063781_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
>prophage 156
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2069574	2070333	2819041		Planktothrix_phage(100.0%)	1	NA	NA
WP_000154162.1|2069574_2070333_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 157
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2087476	2089189	2819041		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138663.1|2087476_2089189_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	5.4e-20
>prophage 158
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2094817	2095831	2819041		Faustovirus(100.0%)	1	NA	NA
WP_000639198.1|2094817_2095831_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	22.2	8.2e-08
>prophage 159
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2108222	2108915	2819041		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185860.1|2108222_2108915_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 160
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2132790	2134650	2819041		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125631.1|2132790_2134650_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 161
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2160325	2162076	2819041		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143418.1|2160325_2161213_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	7.4e-05
WP_000923764.1|2161320_2162076_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.8e-31
>prophage 162
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2165513	2166011	2819041		Canarypox_virus(100.0%)	1	NA	NA
WP_001065267.1|2165513_2166011_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	2.4e-21
>prophage 163
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2171061	2173445	2819041		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071721.1|2171061_2172912_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.9	1.3e-234
WP_000173336.1|2172908_2173445_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	47.5	1.1e-40
>prophage 164
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2178321	2188432	2819041	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2178321_2180031_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2180308_2180521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028789.1|2180800_2181244_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172333.1|2181437_2183036_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.6	2.6e-77
WP_001793854.1|2183095_2183296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2183722_2185219_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031407.1|2185411_2186302_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237625.1|2186424_2186841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030061.1|2187094_2188432_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	6.7e-18
>prophage 165
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2216587	2219787	2819041		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751265.1|2216587_2217289_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.8	2.1e-39
WP_000379825.1|2217975_2219787_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 166
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2228226	2232612	2819041		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161364.1|2228226_2229225_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	2.6e-35
WP_000076662.1|2229314_2229521_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024137.1|2230203_2232612_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	2.9e-128
>prophage 167
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2241853	2244843	2819041	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001063330.1|2241853_2243959_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.5	6.9e-118
WP_160175480.1|2244321_2244843_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	2.4e-27
>prophage 168
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2251267	2257650	2819041		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062662.1|2251267_2253007_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
WP_000473682.1|2253306_2255373_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2255752_2256163_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240663.1|2256204_2256561_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228158.1|2256681_2257650_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	3.1e-12
>prophage 169
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2266472	2267465	2819041		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161541.1|2266472_2267465_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	9.7e-38
>prophage 170
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2276881	2277577	2819041		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382892.1|2276881_2277577_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	2.0e-37
>prophage 171
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2296176	2303352	2819041		Bacillus_phage(66.67%)	6	NA	NA
WP_000721330.1|2296176_2297043_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	4.4e-79
WP_001573690.1|2297169_2297478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678764.1|2297621_2297888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001793882.1|2298171_2299980_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.5	1.0e-93
WP_160175483.1|2300096_2300489_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000088715.1|2300490_2303352_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	1.2e-27
>prophage 172
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2307795	2308491	2819041		Bacillus_phage(100.0%)	1	NA	NA
WP_000217452.1|2307795_2308491_+	oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	5.1e-09
>prophage 173
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2314169	2314988	2819041		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824929.1|2314169_2314988_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.8	1.9e-10
>prophage 174
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2323053	2324611	2819041		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173876.1|2323053_2323869_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	6.1e-14
WP_000590515.1|2323861_2324611_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 175
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2330844	2335271	2819041		Bacillus_phage(50.0%)	4	NA	NA
WP_000923514.1|2330844_2331507_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.5	2.2e-17
WP_000072154.1|2331499_2332276_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026190.1|2332669_2333857_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700902.1|2333918_2335271_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	3.0e-13
>prophage 176
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2338664	2339891	2819041		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000948990.1|2338664_2339891_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 177
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2358267	2364474	2819041		Bacillus_phage(66.67%)	5	NA	NA
WP_001176855.1|2358267_2359410_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.9	2.6e-55
WP_000779351.1|2359677_2360064_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2360197_2360305_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064829.1|2360952_2362716_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	1.6e-35
WP_000486505.1|2362740_2364474_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.5e-30
>prophage 178
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2367935	2373689	2819041		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971554.1|2367935_2369051_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.9	7.1e-21
WP_000286868.1|2369061_2369754_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200947.1|2369764_2370232_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_001056917.1|2370283_2371261_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	2.4e-142
WP_000916697.1|2371262_2372210_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	2.1e-138
WP_000594516.1|2372759_2373689_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.4	1.5e-120
>prophage 179
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2381582	2382314	2819041		Bacillus_virus(100.0%)	1	NA	NA
WP_000615467.1|2381582_2382314_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	1.3e-23
>prophage 180
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2399178	2400738	2819041		Escherichia_phage(100.0%)	1	NA	NA
WP_000692650.1|2399178_2400738_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	3.4e-21
>prophage 181
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2411469	2413116	2819041	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_000277741.1|2411469_2413116_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 182
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2424057	2425092	2819041		Bacillus_virus(100.0%)	1	NA	NA
WP_000655979.1|2424057_2425092_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	1.7e-16
>prophage 183
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2435555	2442112	2819041		Staphylococcus_phage(25.0%)	8	NA	NA
WP_000388431.1|2435555_2436284_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	6.7e-28
WP_000372857.1|2436417_2436981_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000793166.1|2437157_2437613_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_000977031.1|2437609_2438053_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000477322.1|2438215_2439589_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.3	1.1e-12
WP_000249492.1|2439581_2440256_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	44.7	8.0e-52
WP_000761409.1|2440391_2441447_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229922.1|2441446_2442112_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	7.2e-37
>prophage 184
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2459716	2460616	2819041		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524842.1|2459716_2460616_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.7e-15
>prophage 185
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2467973	2468393	2819041		Bacillus_phage(100.0%)	1	NA	NA
WP_000920241.1|2467973_2468393_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	7.7e-37
>prophage 186
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2474024	2474906	2819041		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730056.1|2474024_2474906_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	1.7e-62
>prophage 187
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2482785	2483421	2819041		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285452.1|2482785_2483421_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.6	7.1e-10
>prophage 188
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2496425	2500692	2819041		Staphylococcus_phage(50.0%)	4	NA	NA
WP_072460394.1|2496425_2497064_+	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	47.4	4.5e-36
WP_000684154.1|2497672_2498797_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.6e-12
WP_000417008.1|2498888_2499842_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.2	5.8e-32
WP_160175488.1|2500200_2500692_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.6e-07
>prophage 189
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2504612	2505422	2819041		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717395.1|2504612_2505422_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 190
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2524395	2525001	2819041		Pithovirus(100.0%)	1	NA	NA
WP_000913006.1|2524395_2525001_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 191
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2536913	2540081	2819041		Leptospira_phage(100.0%)	1	NA	NA
WP_000592290.1|2536913_2540081_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	4.3e-63
>prophage 192
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2563260	2566870	2819041	transposase	Paenibacillus_phage(33.33%)	3	NA	NA
WP_094409958.1|2563260_2564828_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000389651.1|2565203_2566013_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.8	1.4e-18
WP_000586768.1|2566009_2566870_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.4e-10
>prophage 193
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2569911	2578474	2819041		Mycobacterium_phage(33.33%)	8	NA	NA
WP_000204271.1|2569911_2571348_+	MarR family transcriptional regulator	NA	A0A088F7M4	Mycobacterium_phage	31.2	5.5e-58
WP_000136272.1|2571596_2571776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791584.1|2572425_2572608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130145.1|2573077_2574742_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	4.7e-45
WP_000179061.1|2574778_2575483_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000769709.1|2575873_2576299_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044369.1|2576593_2577409_+	hydrolase	NA	NA	NA	NA	NA
WP_001044451.1|2577619_2578474_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	34.8	1.3e-06
>prophage 194
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2581852	2584915	2819041		Staphylococcus_phage(50.0%)	5	NA	NA
WP_001015495.1|2581852_2582701_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.4	1.3e-43
WP_001573519.1|2582921_2583047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293423.1|2583001_2583295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333457.1|2583308_2583917_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_001573518.1|2584174_2584915_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	30.3	7.3e-14
>prophage 195
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2591235	2592648	2819041		Pandoravirus(100.0%)	1	NA	NA
WP_000169223.1|2591235_2592648_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	5.0e-48
>prophage 196
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2596616	2598179	2819041		Vibrio_phage(100.0%)	1	NA	NA
WP_000792332.1|2596616_2598179_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	3.5e-18
>prophage 197
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2608382	2609351	2819041		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2608382_2609351_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 198
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2625152	2626061	2819041		Klosneuvirus(100.0%)	1	NA	NA
WP_000162591.1|2625152_2626061_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.7	1.2e-26
>prophage 199
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2643303	2650721	2819041	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000334466.1|2643303_2645109_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.6	2.6e-97
WP_000908186.1|2645340_2646123_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	5.7e-09
WP_000370937.1|2646190_2647048_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001792784.1|2647706_2647865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073392962.1|2648544_2648649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277741.1|2649074_2650721_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 200
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2659227	2663060	2819041		Clostridium_phage(50.0%)	4	NA	NA
WP_000070866.1|2659227_2659671_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_000160304.1|2659791_2660502_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083335.1|2660816_2661479_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242308.1|2661758_2663060_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.7	1.4e-132
>prophage 201
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2670993	2672604	2819041		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2670993_2672604_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 202
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2680407	2688160	2819041		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2680407_2681007_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460244.1|2681007_2682084_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248730.1|2682070_2682907_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001801520.1|2682939_2684037_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697334.1|2684033_2684453_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654191.1|2684559_2685084_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2685110_2686349_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2686376_2687006_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723407.1|2687029_2688160_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.1	1.0e-27
>prophage 203
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2698877	2699273	2819041		Bacillus_phage(100.0%)	1	NA	NA
WP_000932696.1|2698877_2699273_+	single-stranded DNA-binding protein	NA	A0A1B1PAE7	Bacillus_phage	36.8	3.0e-14
>prophage 204
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2705382	2706030	2819041		Moumouvirus(100.0%)	1	NA	NA
WP_001187612.1|2705382_2706030_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	4.7e-09
>prophage 205
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2714222	2715743	2819041		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178940.1|2714222_2715743_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 206
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2721417	2723445	2819041		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546609.1|2721417_2723445_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.6	3.9e-25
>prophage 207
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2728595	2731979	2819041		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621176.1|2728595_2728958_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2729306_2730308_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2730426_2730753_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190825.1|2730754_2731234_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041107.1|2731208_2731979_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 208
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2746092	2750816	2819041		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094572.1|2746092_2747622_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.6	9.4e-08
WP_072399972.1|2747651_2748671_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2748792_2749047_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047828.1|2749046_2750816_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	4.1e-63
>prophage 209
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2754576	2768651	2819041	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_000159047.1|2754576_2755602_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	3.1e-63
WP_000106312.1|2755915_2757526_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	27.4	5.1e-20
WP_001791590.1|2757620_2757749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602046.1|2757893_2759822_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.1	3.2e-53
WP_001283612.1|2760074_2760710_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_073392939.1|2761066_2762095_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581078.1|2762154_2762379_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052261.1|2762587_2763838_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	9.0e-41
WP_000790325.1|2764021_2764972_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_160175491.1|2765120_2766605_+	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	25.8	6.8e-19
WP_001253292.1|2766601_2767561_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688492.1|2767934_2768651_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 210
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2775792	2790136	2819041	terminase,integrase,coat	Staphylococcus_phage(68.42%)	22	2777752:2777771	2792486:2792505
WP_000917289.1|2775792_2776077_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240651.1|2776152_2777769_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
2777752:2777771	attL	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
WP_000179345.1|2777837_2779010_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	98.2	3.5e-220
WP_000620857.1|2779023_2779698_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
WP_000153640.1|2779870_2780089_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
WP_000481967.1|2780093_2780411_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
WP_000708433.1|2780407_2780563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231378.1|2780547_2780751_+	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	97.0	7.5e-30
WP_000403839.1|2780752_2781136_+	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	9.7e-63
WP_001103930.1|2781136_2781454_+	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	58.2	1.6e-18
WP_001002721.1|2781517_2782387_+	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	99.3	6.0e-169
WP_000447451.1|2782400_2784110_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	100.0	0.0e+00
WP_000356937.1|2784421_2784802_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	100.0	6.9e-69
WP_001019766.1|2784798_2785440_+	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	94.8	3.5e-113
WP_001190608.1|2785975_2786317_+	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	98.2	7.1e-57
WP_000846285.1|2786328_2786907_+	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
WP_000448775.1|2786924_2787143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000771368.1|2787193_2787721_+|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_000358778.1|2787723_2788065_+	hypothetical protein	NA	A0A1W6JQM3	Staphylococcus_phage	100.0	1.7e-58
WP_001293073.1|2788061_2788631_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	3.5e-101
WP_001035597.1|2788785_2789490_-	toxic shock syndrome toxin TSST-1	NA	NA	NA	NA	NA
WP_000812237.1|2789908_2790136_+	hypothetical protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	47.4	1.9e-13
2792486:2792505	attR	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
>prophage 211
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2793220	2793848	2819041		Staphylococcus_phage(100.0%)	2	NA	NA
WP_001573769.1|2793220_2793517_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	40.4	6.7e-11
WP_001573771.1|2793506_2793848_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	46.0	4.1e-20
>prophage 212
NZ_CP047793	Staphylococcus aureus strain UP_764 chromosome, complete genome	2819041	2797826	2818571	2819041	integrase	Staphylococcus_phage(100.0%)	38	2789652:2789668	2811186:2811202
2789652:2789668	attL	AACATTTTAAAGTTACA	NA	NA	NA	NA
WP_000791402.1|2797826_2798882_+	succinyl-diaminopimelate desuccinylase	NA	A0A2I6PER8	Staphylococcus_phage	34.6	7.9e-38
WP_000595617.1|2798903_2799923_+	beta-channel forming cytolysin	NA	A0A2I6PEU3	Staphylococcus_phage	39.6	3.4e-54
WP_000857191.1|2801062_2802100_-|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	100.0	9.1e-180
WP_000825947.1|2802158_2802623_-	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
WP_000705248.1|2802722_2802905_-	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
WP_000591749.1|2803108_2803450_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
WP_000759682.1|2803455_2804388_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
WP_001031454.1|2804403_2805117_-	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_001801500.1|2805079_2805253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854072.1|2805249_2805513_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
WP_001025874.1|2805528_2805744_+	DUF2829 domain-containing protein	NA	A0EWV9	Staphylococcus_phage	100.0	6.3e-35
WP_000128907.1|2805732_2806062_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
WP_001148605.1|2806112_2806865_+	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_001148855.1|2806880_2807078_+	hypothetical protein	NA	Q8SDM8	Staphylococcus_phage	100.0	7.0e-33
WP_000939496.1|2807108_2807249_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
WP_000275058.1|2807263_2807896_-	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
WP_001120197.1|2807954_2808275_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_000066017.1|2808271_2808433_+	DUF1270 domain-containing protein	NA	D2JGJ6	Staphylococcus_phage	100.0	4.3e-20
WP_000165375.1|2808527_2808854_+	DUF2482 family protein	NA	W5RAK4	Staphylococcus_phage	100.0	1.2e-53
WP_000291503.1|2808834_2809095_+	DUF1108 family protein	NA	A0EWW8	Staphylococcus_phage	100.0	8.9e-44
WP_001205732.1|2809103_2809367_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700577.1|2809375_2811319_+	AAA family ATPase	NA	A0EWX0	Staphylococcus_phage	100.0	0.0e+00
2811186:2811202	attR	AACATTTTAAAGTTACA	NA	NA	NA	NA
WP_000138472.1|2811320_2812241_+	recombinase	NA	S4SUN6	Staphylococcus_phage	100.0	2.3e-166
WP_071621397.1|2812321_2812939_+	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
WP_000934764.1|2812939_2813410_+	single-stranded DNA-binding protein	NA	A0EWX3	Staphylococcus_phage	100.0	7.4e-81
WP_000148316.1|2813439_2814324_+	DnaD domain protein	NA	A0EWX4	Staphylococcus_phage	100.0	5.4e-141
WP_000338531.1|2814330_2814549_+	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	98.6	1.2e-36
WP_000101274.1|2814879_2815248_+	hypothetical protein	NA	W5RAK8	Staphylococcus_phage	100.0	8.2e-51
WP_000131366.1|2815251_2815494_+	hypothetical protein	NA	A0EWX8	Staphylococcus_phage	100.0	3.9e-41
WP_001065091.1|2815665_2815917_+	DUF1024 family protein	NA	A0EWY0	Staphylococcus_phage	100.0	1.9e-38
WP_000028422.1|2815906_2816089_+	hypothetical protein	NA	A0EWY1	Staphylococcus_phage	100.0	2.6e-26
WP_000185659.1|2816081_2816624_+	dUTP pyrophosphatase	NA	A0EWY2	Staphylococcus_phage	100.0	1.1e-96
WP_000195803.1|2816660_2816867_+	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_000592207.1|2816863_2817250_+	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	3.0e-64
WP_000595265.1|2817246_2817396_+	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_000265043.1|2817395_2817596_+	DUF1514 domain-containing protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
WP_000590122.1|2817623_2818040_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988336.1|2818271_2818571_+	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
