The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	0	35817	2847876	capsid,portal,transposase,holin,tail,head,terminase,protease	Staphylococcus_phage(96.77%)	38	NA	NA
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_001607394.1|2848_3586_+|protease	Clp protease ClpP	protease	A0A1W6JPK0	Staphylococcus_phage	99.6	4.0e-129
WP_000154567.1|3608_4754_+|capsid	phage major capsid protein	capsid	A0A1W6JPL4	Staphylococcus_phage	100.0	1.9e-215
WP_000238240.1|4773_5058_+	hypothetical protein	NA	A0A1W6JPL8	Staphylococcus_phage	100.0	2.3e-45
WP_000150936.1|5047_5332_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5315_5678_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114341.1|5674_6079_+	hypothetical protein	NA	A0A1W6JPJ1	Staphylococcus_phage	100.0	2.5e-69
WP_000565498.1|6075_6483_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_115307015.1|6483_7125_+|tail	phage tail protein	tail	C8CH27	Staphylococcus_phage	99.5	7.2e-119
WP_111759497.1|7085_7391_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	91.9	4.3e-29
WP_001096355.1|7440_7791_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_160193844.1|8035_12565_+|tail	phage tail tape measure protein	tail	A0EX03	Staphylococcus_phage	98.3	0.0e+00
WP_000567413.1|12561_14046_+|tail	phage tail protein	tail	A0EX04	Staphylococcus_phage	100.0	4.5e-297
WP_160193846.1|14061_17847_+	hypothetical protein	NA	A0EX05	Staphylococcus_phage	98.7	0.0e+00
WP_001153681.1|17836_17989_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040259.1|18035_18323_+	hypothetical protein	NA	G4KNR2	Staphylococcus_phage	100.0	9.9e-44
WP_042363643.1|18378_18753_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	98.4	1.6e-38
WP_000750406.1|19173_19947_+	staphylococcal enterotoxin type A	NA	A0EX09	Staphylococcus_phage	100.0	2.2e-146
WP_011447039.1|20055_20232_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_001791821.1|20284_20392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|20443_20698_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|20709_21465_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000919350.1|21655_22147_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
WP_020444758.1|22673_23132_+	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	4.9e-85
WP_000727649.1|23226_23676_-	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_000702263.1|24361_24712_+	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|24764_25025_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|25335_25515_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_000669728.1|26472_28542_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000277741.1|28839_30486_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_001068528.1|30733_32020_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|32219_32318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681966.1|32559_32736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|32993_33374_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991315.1|33370_34267_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645732.1|34267_34948_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|34944_35817_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
>prophage 2
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	41062	41464	2847876		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000205106.1|41062_41464_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
>prophage 3
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	45661	47692	2847876		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|45661_46222_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275719.1|46594_47692_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	8.7e-48
>prophage 4
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	51722	54006	2847876		Bacillus_virus(100.0%)	2	NA	NA
WP_000284434.1|51722_53192_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.5	8.5e-107
WP_000040861.1|53184_54006_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 5
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	57697	64475	2847876		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|57697_58993_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|59101_59404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272063.1|59586_60279_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|60275_62468_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774552.1|62471_64475_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	9.8e-114
>prophage 6
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	71704	76732	2847876		Catovirus(33.33%)	5	NA	NA
WP_001231458.1|71704_72652_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.5e-16
WP_001147874.1|72732_74094_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	43.0	1.5e-102
WP_000548777.1|74263_74794_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140179.1|75040_76111_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|76177_76732_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 7
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	80185	80599	2847876		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001643743.1|80185_80599_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.5	3.0e-17
>prophage 8
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	85580	86210	2847876		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|85580_86210_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 9
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	101691	103428	2847876		Bacillus_phage(100.0%)	1	NA	NA
WP_000597238.1|101691_103428_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 10
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	119906	120635	2847876		Planktothrix_phage(100.0%)	1	NA	NA
WP_001144055.1|119906_120635_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
>prophage 11
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	131289	131634	2847876		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|131289_131634_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 12
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	141222	141963	2847876		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|141222_141963_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 13
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	149826	154106	2847876		Staphylococcus_phage(80.0%)	5	NA	NA
WP_147612242.1|149826_150609_+	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	38.6	8.7e-34
WP_000821649.1|150890_151610_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	34.6	4.9e-23
WP_000721567.1|151644_152373_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.8	1.3e-28
WP_000764684.1|152526_153312_+	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	42.7	2.9e-45
WP_001235656.1|153350_154106_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	40.8	2.3e-39
>prophage 14
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	157360	167760	2847876	protease	Staphylococcus_phage(85.71%)	8	NA	NA
WP_000711499.1|157360_158707_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	51.1	2.5e-65
WP_000595635.1|158953_159469_-	membrane protein	NA	NA	NA	NA	NA
WP_001039022.1|160483_161203_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.7	6.4e-124
WP_001038766.1|161326_162043_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	5.5e-83
WP_001038734.1|163088_163805_+|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	97.1	6.6e-129
WP_001038742.1|163974_164694_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	98.3	1.0e-129
WP_001794363.1|164873_166613_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.6	3.2e-286
WP_000072622.1|166605_167760_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.3	7.8e-39
>prophage 15
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	178861	227596	2847876	tRNA,protease	Staphylococcus_phage(94.59%)	45	NA	NA
WP_000125075.1|178861_179431_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
WP_001093574.1|179430_180798_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000414222.1|180946_181519_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
WP_000627550.1|181616_181961_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
WP_000669038.1|182001_182628_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
WP_000070654.1|182703_183699_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	3.8e-74
WP_001794016.1|183779_184430_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	1.0e-51
WP_016186903.1|184731_185187_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	3.5e-75
WP_000348372.1|185345_186824_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
WP_000778539.1|186828_187830_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	96.7	8.5e-183
WP_000718107.1|187826_188084_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672010.1|188149_188623_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	9.5e-84
WP_001801476.1|188627_189374_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.3e-139
WP_000109909.1|189666_191259_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
WP_000933819.1|191630_192824_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000366165.1|192948_193857_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
WP_000453316.1|194068_194902_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.6	1.2e-158
WP_000623481.1|195151_195505_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	97.4	4.2e-20
WP_001200542.1|195501_195867_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091444.1|196121_196424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|196682_197396_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_001168914.1|198585_199221_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001030476.1|199518_199962_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
WP_001152695.1|199948_200392_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671059.1|200504_200975_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	85.8	7.7e-70
WP_000384171.1|201173_201398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|201673_202528_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989104.1|202614_203907_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	95.1	2.6e-216
WP_000221181.1|203906_204221_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	97.1	1.7e-52
WP_001261683.1|204863_206366_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
WP_001819953.1|206858_207890_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.3	5.8e-195
WP_000493891.1|207896_208529_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
WP_001159032.1|208539_209721_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
WP_001008556.1|209733_210198_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	97.4	1.9e-68
WP_001196351.1|210319_211321_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.1	5.0e-183
WP_014937042.1|211431_211551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266099.1|211553_212381_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|212953_213355_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764425.1|213473_214037_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
WP_000526541.1|214033_214987_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
WP_001025064.1|215097_216279_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
WP_001108722.1|216570_218985_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.8	0.0e+00
WP_000836472.1|219006_219318_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
WP_001050520.1|219641_226211_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	88.7	1.7e-295
WP_000284993.1|226327_227596_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	5.9e-56
>prophage 16
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	235721	239658	2847876		Salmonella_phage(50.0%)	4	NA	NA
WP_000733283.1|235721_236567_-	BlaZ family penicillin-hydrolyzing class A beta-lactamase PC1	NA	A0A1B0VBP7	Salmonella_phage	34.0	1.5e-31
WP_001096374.1|236673_238431_+	beta-lactam sensor/signal transducer BlaR1	NA	NA	NA	NA	NA
WP_001284656.1|238420_238801_+	penicillinase repressor BlaI	NA	NA	NA	NA	NA
WP_000690628.1|239064_239658_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	1.1e-41
>prophage 17
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	245240	250610	2847876		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|245240_246098_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048374.1|246126_246765_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000118301.1|246785_250610_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 18
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	259182	260889	2847876		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862084.1|259182_260889_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.8	2.1e-274
>prophage 19
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	267493	270124	2847876	tRNA,protease	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|267493_268756_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279341.1|268849_270124_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 20
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	273892	278028	2847876		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808837.1|273892_275497_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291426.1|275483_276644_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553919.1|276758_277205_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174275.1|277284_278028_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.9	8.3e-18
>prophage 21
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	295610	298808	2847876		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226930.1|295610_298808_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	5.5e-135
>prophage 22
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	303740	305498	2847876		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232655.1|303740_305498_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	3.3e-41
>prophage 23
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	310381	318546	2847876		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080025.1|310381_311083_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_073392727.1|311085_312747_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.0	1.7e-34
WP_000849445.1|313247_314735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038301.1|315027_317658_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	32.7	1.8e-46
WP_001114454.1|317673_318546_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
>prophage 24
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	322460	333614	2847876	tRNA,protease	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|322460_323381_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_016186894.1|323473_323569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|323793_325731_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049150.1|326157_327651_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791219.1|327879_328407_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	5.3e-11
WP_001125540.1|328435_328636_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|328682_329039_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032653.1|329180_329789_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	36.4	1.7e-21
WP_001280014.1|329807_330737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|330741_330852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127572.1|330899_332201_+	trigger factor	NA	NA	NA	NA	NA
WP_000472293.1|332351_333614_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	1.1e-139
>prophage 25
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	343180	345811	2847876	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000425358.1|343180_345811_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	3.7e-153
>prophage 26
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	355926	391524	2847876	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|355926_356931_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019178.1|356932_357958_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|357980_359120_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|359138_359399_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749802.1|359673_361953_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_160193856.1|362155_364429_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
WP_000364542.1|364450_364969_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058583.1|365396_367586_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869979.1|367597_368050_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|368046_368922_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590826.1|369382_370645_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044796.1|370660_372427_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001791215.1|372759_372888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682640.1|372887_373661_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102741.1|373821_375096_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.9	6.3e-106
WP_000704122.1|375180_375603_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|375702_375885_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000008061.1|375924_376071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123097183.1|376307_377321_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409167.1|377630_378773_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000066097.1|378773_379892_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567025.1|380573_381242_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_160193858.1|381243_383721_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.5e-66
WP_000734077.1|384063_386694_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|386756_387017_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|387020_387449_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|387463_387772_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342267.1|388056_388695_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137775.1|388697_389621_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|389632_390901_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|390900_391524_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 27
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	407988	414131	2847876		Bacillus_phage(33.33%)	5	NA	NA
WP_000439692.1|407988_408450_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_160193973.1|408508_410635_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.6	1.5e-32
WP_001282570.1|410691_411666_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|411710_411962_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|412307_414131_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 28
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	417566	420674	2847876		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|417566_419399_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_001119020.1|419534_420674_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.5	6.8e-27
>prophage 29
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	427143	428091	2847876		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117769.1|427143_428091_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	4.9e-47
>prophage 30
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	431145	444873	2847876	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|431145_432537_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001794939.1|432871_433495_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|433505_434324_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217253.1|434384_436184_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
WP_001283055.1|436407_437514_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624581.1|437644_438322_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683921.1|438324_439425_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
WP_001062173.1|439538_440885_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	1.4e-55
WP_000924211.1|440894_441785_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
WP_001213908.1|441910_442696_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564316.1|442737_443601_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|443587_443998_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|444273_444873_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 31
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	451045	451669	2847876		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|451045_451669_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 32
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	457213	460025	2847876		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019697.1|457213_458560_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.9	2.1e-64
WP_000202178.1|458552_460025_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.1	1.4e-80
>prophage 33
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	467545	474115	2847876		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|467545_468883_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159866.1|468875_469106_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_160193860.1|469083_469965_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	7.6e-10
WP_001124985.1|470395_470848_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942216.1|470863_472543_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291540.1|472693_474115_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	6.6e-40
>prophage 34
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	480943	482350	2847876		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|480943_482350_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 35
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	489697	491182	2847876		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|489697_491182_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 36
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	496846	587448	2847876	capsid,portal,plate,tRNA,integrase,holin,tail,terminase,protease,head	Staphylococcus_phage(73.75%)	111	506140:506168	551641:551669
WP_000447733.1|496846_497734_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183424.1|497811_498318_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273367.1|498409_499141_+	segregation and condensation protein A	NA	NA	NA	NA	NA
WP_000368652.1|499133_499676_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|499668_500406_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|500538_501264_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987777.1|501244_502996_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
WP_001574168.1|503247_504180_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001794062.1|504166_506209_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	44.1	1.1e-38
506140:506168	attL	ACCATCTCATTATGATGATATGTTTATTT	NA	NA	NA	NA
WP_000264751.1|506251_507457_-|integrase	site-specific integrase	integrase	A0A2I6PEN0	Staphylococcus_phage	100.0	7.7e-223
WP_000191466.1|507582_508197_+	hypothetical protein	NA	A0A2I6PEZ0	Staphylococcus_phage	100.0	6.7e-106
WP_001013104.1|508193_508340_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	89.6	1.1e-14
WP_000705240.1|508376_508559_-	hypothetical protein	NA	A0A2I6PDR4	Staphylococcus_phage	100.0	5.3e-27
WP_000511090.1|508628_509360_-	helix-turn-helix transcriptional regulator	NA	S4SVC5	Staphylococcus_phage	99.2	1.3e-132
WP_000213811.1|509511_509724_+	helix-turn-helix transcriptional regulator	NA	A7TWF1	Staphylococcus_phage	100.0	1.6e-30
WP_000435357.1|509771_510215_+	hypothetical protein	NA	A7TWF2	Staphylococcus_phage	100.0	8.9e-76
WP_000362644.1|510419_510632_-	hypothetical protein	NA	D2JGJ1	Staphylococcus_phage	100.0	7.6e-33
WP_001148860.1|510701_510899_+	hypothetical protein	NA	A7TWF5	Staphylococcus_phage	100.0	4.6e-24
WP_000773059.1|510885_511266_-	DUF2513 domain-containing protein	NA	Q4ZCQ5	Staphylococcus_virus	100.0	5.8e-68
WP_001025401.1|511332_511578_+	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
WP_001128433.1|511546_511912_-	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	100.0	2.4e-63
WP_001097553.1|511966_512182_+	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	98.6	1.2e-30
WP_001124160.1|512206_512470_+	helix-turn-helix domain-containing protein	NA	A7TWG0	Staphylococcus_phage	100.0	5.7e-46
WP_001285954.1|512481_512643_+	DUF1270 domain-containing protein	NA	A7TWM3	Staphylococcus_phage	100.0	8.6e-21
WP_000174998.1|512721_513045_+	hypothetical protein	NA	A0A2I6PE70	Staphylococcus_phage	100.0	6.5e-52
WP_000279448.1|513059_513422_+	hypothetical protein	NA	A0A0K1LKE9	Staphylococcus_phage	96.7	3.0e-53
WP_000762531.1|513418_514585_+	DUF2800 domain-containing protein	NA	A0A0K1LKE3	Staphylococcus_phage	99.7	2.4e-221
WP_000645045.1|514610_515168_+	DUF2815 family protein	NA	A0A2K9VBT2	Staphylococcus_phage	100.0	1.8e-97
WP_078066095.1|515236_517189_+	DNA polymerase	NA	A0A2I6PF18	Staphylococcus_phage	99.4	0.0e+00
WP_000152769.1|517200_517356_+	hypothetical protein	NA	A0A2I6PDP0	Staphylococcus_phage	94.1	3.5e-19
WP_000029382.1|517541_517901_+	hypothetical protein	NA	Q4ZBU0	Staphylococcus_virus	95.8	1.2e-59
WP_000022728.1|517900_518158_+	DUF3310 domain-containing protein	NA	A0A2I6PEN5	Staphylococcus_phage	100.0	2.6e-43
WP_000235326.1|518160_518361_+	hypothetical protein	NA	C5I650	Staphylococcus_phage	98.5	7.4e-30
WP_000178424.1|518369_518618_+	hypothetical protein	NA	A0A2I6PF06	Staphylococcus_phage	92.7	1.6e-37
WP_001062709.1|518632_519025_+	hypothetical protein	NA	A0A2I6PE39	Staphylococcus_phage	100.0	1.6e-68
WP_000615883.1|519212_519644_+	hypothetical protein	NA	Q4ZBT4	Staphylococcus_virus	98.6	1.4e-73
WP_001065240.1|519636_519885_+	DUF1024 family protein	NA	A0A2I6PEP2	Staphylococcus_phage	92.7	5.0e-36
WP_000181812.1|519877_520405_+	dUTP pyrophosphatase	NA	A0A2I6PF13	Staphylococcus_phage	98.9	1.5e-93
WP_001106583.1|520441_520687_+	hypothetical protein	NA	Q9B0F1	Staphylococcus_virus	100.0	1.6e-31
WP_001034430.1|520683_520884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001199737.1|520883_521117_+	DUF1381 domain-containing protein	NA	Q9B0F0	Staphylococcus_virus	100.0	3.1e-35
WP_000483477.1|521141_521378_+	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
WP_000595272.1|521370_521523_+	transcriptional activator RinB	NA	Q9B0E9	Staphylococcus_virus	100.0	2.6e-19
WP_000265258.1|521590_521791_+	DUF1514 domain-containing protein	NA	A0A2I6PF41	Staphylococcus_phage	100.0	2.9e-26
WP_095284851.1|523234_524290_+	hypothetical protein	NA	A0A0K1LKN1	Staphylococcus_phage	99.4	1.8e-207
WP_015978074.1|524392_524497_-	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	2.7e-12
WP_000665205.1|524630_524921_+	VRR-NUC domain-containing protein	NA	U5U7A3	Staphylococcus_phage	100.0	4.9e-51
WP_078065359.1|524901_526269_+	DEAD/DEAH box helicase	NA	A0A2I6PDQ0	Staphylococcus_phage	99.3	1.9e-262
WP_000513700.1|526281_526719_+	transcriptional regulator	NA	A0A2I6PDC2	Staphylococcus_phage	99.3	7.9e-77
WP_000196700.1|526880_527195_+	HNH endonuclease	NA	A0A2I6PDR3	Staphylococcus_phage	100.0	8.5e-57
WP_000778930.1|527324_527630_+|terminase	terminase	terminase	A0A2I6PDN6	Staphylococcus_phage	100.0	3.7e-49
WP_000153549.1|527619_529311_+|terminase	terminase large subunit	terminase	A0A2I6PDP8	Staphylococcus_phage	99.8	0.0e+00
WP_001100670.1|529315_530554_+|portal	phage portal protein	portal	A0A2I6PEA6	Staphylococcus_phage	100.0	6.9e-235
WP_000061866.1|530537_531311_+|protease	Clp protease ClpP	protease	A0A2I6PEQ7	Staphylococcus_phage	100.0	2.4e-137
WP_001142735.1|531322_532486_+|capsid	phage major capsid protein	capsid	A0A2I6PE62	Staphylococcus_phage	100.0	3.6e-217
WP_000050975.1|532554_532833_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PE36	Staphylococcus_phage	100.0	2.1e-46
WP_000395501.1|532844_533177_+	hypothetical protein	NA	A0A2I6PDD6	Staphylococcus_phage	100.0	6.2e-58
WP_000110020.1|533173_533575_+	hypothetical protein	NA	A0A2I6PDD3	Staphylococcus_phage	100.0	6.2e-68
WP_001023802.1|533575_533971_+	DUF3168 domain-containing protein	NA	A0A2I6PDD8	Staphylococcus_phage	100.0	2.6e-66
WP_000807540.1|534005_534647_+|tail	tail protein	tail	A0A2I6PE59	Staphylococcus_phage	100.0	1.0e-120
WP_000169127.1|534738_535194_+	Ig domain-containing protein	NA	A0A2I6PER6	Staphylococcus_phage	100.0	5.7e-78
WP_000589167.1|535251_535602_+	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
WP_000438833.1|535643_535802_+	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_160193863.1|535815_542016_+|tail	phage tail tape measure protein	tail	A0A2I6PF36	Staphylococcus_phage	99.2	0.0e+00
WP_160193865.1|542015_542840_+|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	99.6	9.2e-159
WP_000384474.1|542848_544432_+	peptidase	NA	A0A2I6PEQ5	Staphylococcus_phage	100.0	9.3e-309
WP_001670550.1|544431_544722_+	hypothetical protein	NA	U5U457	Staphylococcus_phage	99.0	1.3e-48
WP_000429558.1|544737_546648_+	minor structural protein	NA	A0A2I6PEQ9	Staphylococcus_phage	100.0	0.0e+00
WP_000067129.1|546647_548114_+|plate	BppU family phage baseplate upper protein	plate	A0A2I6PDE3	Staphylococcus_phage	100.0	1.8e-274
WP_001166600.1|548113_548503_+	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	99.2	6.4e-62
WP_000916020.1|548495_548660_+	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_000466784.1|548705_549005_+	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_000339141.1|549140_549443_+|holin	phage holin	holin	A0A2I6PF56	Staphylococcus_phage	100.0	3.1e-48
WP_160193867.1|549453_550908_+	CHAP domain-containing protein	NA	I1W626	Staphylococcus_phage	99.8	1.3e-288
WP_000209712.1|551629_551845_+	hypothetical protein	NA	A0ZS61	Staphylococcus_virus	100.0	2.0e-25
551641:551669	attR	ACCATCTCATTATGATGATATGTTTATTT	NA	NA	NA	NA
WP_000913238.1|551934_552840_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000476878.1|552897_553806_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001799520.1|554010_554175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186908.1|554453_554999_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_001151997.1|555104_555353_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163814.1|555460_556414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902107.1|556403_557783_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.3	2.9e-56
WP_000069298.1|557935_559396_+	elastin-binding protein EbpS	NA	NA	NA	NA	NA
WP_016186859.1|559533_559620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001174260.1|559780_560767_+	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_000681744.1|560881_561850_-	asparaginase	NA	NA	NA	NA	NA
WP_000644393.1|561926_562586_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001791200.1|562616_562733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791199.1|562849_563041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133953.1|563297_564473_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000165530.1|564694_566005_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_000161753.1|566021_567020_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001043863.1|567190_567463_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|567893_568466_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774679.1|568468_569194_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001819897.1|569210_570155_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|570246_570696_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_160193869.1|571164_572331_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	2.6e-34
WP_000776318.1|572356_573421_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_000245891.1|573430_574729_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000389521.1|574735_575980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005208.1|575993_576569_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	4.6e-08
WP_000154479.1|576558_577146_+	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_001827022.1|577217_577898_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000839927.1|578233_578551_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000690024.1|578794_579937_+	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_000361536.1|579941_581144_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	42.5	1.4e-35
WP_000049917.1|581130_582102_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525060.1|582125_584819_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858795.1|585140_586433_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	4.3e-54
WP_000362222.1|586761_587448_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
>prophage 37
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	591139	591766	2847876		Bacillus_phage(100.0%)	1	NA	NA
WP_001108885.1|591139_591766_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 38
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	601230	602109	2847876		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|601230_602109_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 39
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	640701	651158	2847876	transposase	Staphylococcus_phage(50.0%)	14	NA	NA
WP_000282169.1|640701_641406_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.3	1.9e-11
WP_001814377.1|641650_641845_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001165814.1|641856_642108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404628.1|642145_643270_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995290.1|643285_643723_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934885.1|644146_645103_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|645302_645782_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166055.1|645796_646636_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	5.1e-48
WP_000159899.1|646721_647255_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|647247_647676_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473654.1|647687_648188_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|648187_648409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|648481_649429_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000342154.1|649667_651158_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	1.7e-22
>prophage 40
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	654566	656578	2847876		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|654566_655226_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166793.1|655222_656578_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 41
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	662946	663738	2847876		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|662946_663738_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 42
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	667273	672299	2847876	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138413.1|667273_668410_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001794103.1|668441_669071_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|669089_669359_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|669520_669829_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|669999_670200_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876206.1|670396_670798_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216956.1|671033_672299_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.0	4.0e-12
>prophage 43
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	680141	681743	2847876		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|680141_681743_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 44
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	686168	689622	2847876		Indivirus(50.0%)	3	NA	NA
WP_000079448.1|686168_687020_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.8e-16
WP_000974850.1|687026_687668_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077549.1|687807_689622_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.3	2.3e-154
>prophage 45
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	693036	693738	2847876		Tupanvirus(100.0%)	1	NA	NA
WP_000571253.1|693036_693738_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.0e-13
>prophage 46
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	701219	703572	2847876		Acinetobacter_phage(100.0%)	2	NA	NA
WP_160193875.1|701219_702002_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.7	1.2e-27
WP_000604802.1|703005_703572_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	31.8	1.7e-23
>prophage 47
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	707890	711456	2847876	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_000283027.1|707890_709153_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	1.7e-95
WP_001123276.1|709300_709486_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_000277741.1|709809_711456_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 48
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	720725	725119	2847876		Bacillus_phage(50.0%)	2	NA	NA
WP_001289586.1|720725_723128_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	1.1e-92
WP_001574370.1|723127_725119_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 49
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	730736	732383	2847876		Vibrio_phage(100.0%)	1	NA	NA
WP_001088983.1|730736_732383_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.5	1.9e-22
>prophage 50
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	736052	737174	2847876		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691309.1|736052_737174_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.1	2.1e-09
>prophage 51
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	741323	746979	2847876		Phage_Wrath(25.0%)	7	NA	NA
WP_001208760.1|741323_741947_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
WP_000380738.1|742326_743190_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	1.2e-15
WP_001791425.1|743263_743368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688127.1|743364_744342_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085657.1|744498_744768_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|745221_745371_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000089857.1|745461_746979_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.8	2.7e-92
>prophage 52
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	757115	761391	2847876		Bacillus_phage(50.0%)	6	NA	NA
WP_000841344.1|757115_757649_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|757787_757976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000624452.1|758088_758691_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670311.1|758687_759779_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603961.1|759782_760514_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001794121.1|760482_761391_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	9.8e-21
>prophage 53
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	765345	791313	2847876	transposase,head,capsid	Staphylococcus_phage(63.64%)	35	NA	NA
WP_077670291.1|765345_765681_-|head	phage head morphogenesis protein	head	A0A1J0MFV1	Staphylococcus_phage	60.4	2.6e-27
WP_000600810.1|765748_765886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574384.1|765882_766149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429703.1|766194_766473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000906224.1|766623_766872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217295.1|767628_767823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791418.1|767833_768007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001794746.1|768675_768993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791415.1|769227_769356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000905625.1|769420_769618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077670290.1|769619_770285_-|capsid	phage capsid protein	capsid	A0A1J0MF61	Staphylococcus_phage	53.0	4.6e-60
WP_000585095.1|770345_770597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477487.1|772117_772534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121213.1|772960_773908_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	99.7	1.6e-183
WP_000006110.1|774119_774305_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_000121211.1|774389_775337_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_031788482.1|775771_775882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002343.1|776583_776790_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
WP_001071312.1|777086_777299_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	3.6e-19
WP_000134547.1|777984_778269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805733.1|778419_778740_+	DUF961 domain-containing protein	NA	NA	NA	NA	NA
WP_000386891.1|778753_779056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000388596.1|779297_780323_+	replication initiation factor domain-containing protein	NA	NA	NA	NA	NA
WP_000692007.1|780383_781439_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_000015642.1|781443_781704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000358146.1|781715_782099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117221260.1|782133_784386_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_001251205.1|784439_785798_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	29.9	4.0e-42
WP_000681139.1|785802_787650_+	membrane protein	NA	NA	NA	NA	NA
WP_000247474.1|787639_788686_+	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	36.9	8.1e-19
WP_000810443.1|788692_789283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001255381.1|789338_789695_+	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_000746372.1|789803_790307_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078367270.1|790287_790824_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	1.3e-28
WP_001659797.1|791115_791313_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
>prophage 54
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	796384	796861	2847876		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|796384_796861_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 55
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	802804	809286	2847876		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103747.1|802804_803623_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	3.1e-26
WP_001077635.1|804097_804640_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516249.1|804645_806655_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.2	4.1e-59
WP_160193877.1|806667_809286_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	2.9e-41
>prophage 56
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	818699	819743	2847876		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|818699_819743_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 57
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	823942	829486	2847876		Bacillus_virus(33.33%)	4	NA	NA
WP_000664777.1|823942_825229_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
WP_000089941.1|825228_826494_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_001293307.1|826524_827238_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042907377.1|827242_829486_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 58
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	834626	846441	2847876	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864182.1|834626_835598_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282296.1|835612_836530_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|836699_837050_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043642.1|837436_839554_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020856.1|839558_839876_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|839872_840157_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097463.1|840177_841353_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036631.1|841373_841841_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000139497.1|842130_846441_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 59
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	850739	851510	2847876		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|850739_851510_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 60
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	856284	869755	2847876	tRNA,protease	Erwinia_phage(16.67%)	10	NA	NA
WP_000379051.1|856284_857688_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	6.4e-27
WP_000072681.1|857753_858299_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015609.1|858295_859192_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	6.1e-31
WP_000195263.1|859609_860917_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001557331.1|861072_863148_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000672864.1|864165_865410_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_001041658.1|865437_866556_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000110252.1|866782_867691_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	2.3e-17
WP_001020801.1|867712_868879_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176401.1|868987_869755_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 61
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	883139	885260	2847876		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|883139_883871_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|883986_884220_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|884525_885260_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 62
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	895619	897614	2847876		Moumouvirus(100.0%)	1	NA	NA
WP_000579564.1|895619_897614_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 63
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	900761	901697	2847876	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|900761_901697_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 64
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	906706	908963	2847876		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|906706_907906_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|908121_908340_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368225.1|908339_908963_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	6.1e-22
>prophage 65
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	912277	912889	2847876		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|912277_912889_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 66
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	916856	921467	2847876		Halovirus(33.33%)	4	NA	NA
WP_160193880.1|916856_917957_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	9.6e-63
WP_000767018.1|917958_919233_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|919250_920132_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178615.1|920159_921467_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 67
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	926398	929152	2847876	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384706.1|926398_929152_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	2.1e-90
>prophage 68
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	948508	948706	2847876		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245800.1|948508_948706_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	1.2e-19
>prophage 69
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	959561	959789	2847876		Staphylococcus_virus(100.0%)	1	NA	NA
WP_001801391.1|959561_959789_-	hypothetical protein	NA	Q4ZBW5	Staphylococcus_virus	67.7	1.9e-18
>prophage 70
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	963249	963600	2847876		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000669541.1|963249_963600_-	complement inhibitor SCIN-C	NA	A7TWS0	Staphylococcus_phage	50.0	1.9e-20
>prophage 71
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	975034	979592	2847876		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|975034_975349_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249264.1|975521_977870_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
WP_000161937.1|977879_979592_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
>prophage 72
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	984470	985529	2847876	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|984470_985529_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 73
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	997508	1000419	2847876		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|997508_997991_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263793.1|997992_998535_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|998604_998994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|998996_999251_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757584.1|999489_1000419_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	6.5e-12
>prophage 74
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1022060	1025703	2847876		Mycoplasma_phage(50.0%)	4	NA	NA
WP_000433551.1|1022060_1023155_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020627.1|1023167_1023707_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000455584.1|1023850_1024126_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|1024296_1025703_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
>prophage 75
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1030344	1030896	2847876		Synechococcus_phage(100.0%)	1	NA	NA
WP_000957036.1|1030344_1030896_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 76
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1037010	1041390	2847876		Bacillus_virus(50.0%)	5	NA	NA
WP_001289622.1|1037010_1037244_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	1.3e-09
WP_000040041.1|1037480_1039199_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|1039201_1039468_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505964.1|1039621_1040164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685075.1|1040217_1041390_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.6	1.5e-74
>prophage 77
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1044569	1059332	2847876		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921981.1|1044569_1045970_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.4e-10
WP_000273254.1|1045962_1046769_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101912.1|1047036_1048284_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709288.1|1048305_1049784_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	9.2e-77
WP_000238673.1|1049798_1050365_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
WP_000030814.1|1050367_1051396_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	7.6e-62
WP_000483716.1|1051388_1052873_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.4	8.5e-46
WP_160193884.1|1052851_1055041_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.2	6.7e-140
WP_000666808.1|1055033_1055705_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000848351.1|1055706_1055970_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174050.1|1055969_1056674_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.6	7.3e-48
WP_001010391.1|1056677_1057802_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861576.1|1057788_1058271_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_000225845.1|1058471_1059332_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	1.2e-39
>prophage 78
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1069569	1073343	2847876		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001074519.1|1069569_1073343_+	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	38.0	1.1e-54
>prophage 79
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1077009	1107356	2847876	holin,protease,bacteriocin	Staphylococcus_phage(16.67%)	33	NA	NA
WP_000676568.1|1077009_1078083_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	31.7	1.1e-15
WP_001088791.1|1078164_1079346_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_000284455.1|1079383_1079713_+	staphostatin B	NA	NA	NA	NA	NA
WP_000184947.1|1079948_1080770_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150205.1|1080762_1081566_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000526678.1|1081552_1083226_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_001814117.1|1083212_1084424_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_072357920.1|1084527_1084605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070967.1|1084755_1085694_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000620943.1|1085745_1086297_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001794164.1|1086386_1086677_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	2.6e-07
WP_001794249.1|1086740_1086872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081338.1|1086918_1087878_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766009.1|1088368_1088725_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000719183.1|1088813_1090295_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000410718.1|1090300_1090588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791476.1|1090928_1091219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571191.1|1091306_1091948_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	5.0e-19
WP_000873929.1|1091944_1092265_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000870819.1|1092267_1094232_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_001794574.1|1094275_1094548_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_001790623.1|1094557_1094659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119695.1|1095197_1095275_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_001033867.1|1095575_1096178_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000214898.1|1096192_1096369_-	YkvS family protein	NA	NA	NA	NA	NA
WP_000668820.1|1096567_1097554_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000876825.1|1097634_1097853_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000287265.1|1098062_1098632_+	competence protein ComK	NA	NA	NA	NA	NA
WP_000414169.1|1099120_1100632_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000021872.1|1100770_1102129_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_001794169.1|1102145_1104470_-|protease	serine protease	protease	W5SAB9	Pithovirus	26.8	4.0e-10
WP_000928413.1|1104688_1105492_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049957.1|1105793_1107356_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
>prophage 80
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1128576	1130385	2847876		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082722.1|1128576_1130385_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	9.3e-47
>prophage 81
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1134335	1148178	2847876	transposase	Bacillus_virus(28.57%)	12	NA	NA
WP_160193886.1|1134335_1135982_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.7	9.0e-291
WP_094409958.1|1136277_1137844_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_001180271.1|1137933_1138815_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001574526.1|1138826_1139477_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000427776.1|1139469_1140450_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_001067041.1|1140452_1141439_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
WP_073392975.1|1141489_1142959_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000121211.1|1143073_1144021_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000517177.1|1144012_1144279_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000197096.1|1144490_1146146_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000786746.1|1146164_1147106_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	9.3e-06
WP_000140043.1|1147095_1148178_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	2.4e-18
>prophage 82
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1156772	1163583	2847876		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619360.1|1156772_1157918_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047061.1|1158028_1158898_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353950.1|1158956_1161566_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044234.1|1161768_1163583_-	O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	8.8e-37
>prophage 83
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1166848	1174307	2847876	transposase	Staphylococcus_virus(50.0%)	4	NA	NA
WP_000277741.1|1166848_1168495_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_000902813.1|1168870_1169260_-	YisL family protein	NA	NA	NA	NA	NA
WP_000670753.1|1169585_1170488_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000154949.1|1170653_1174307_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
>prophage 84
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1184462	1191456	2847876		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185311.1|1184462_1185392_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.5	1.8e-38
WP_000138487.1|1185730_1186975_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000167321.1|1187083_1188274_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.0	1.3e-33
WP_000838047.1|1188581_1189709_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1190070_1190448_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1190862_1191456_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 85
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1201390	1205018	2847876		Mycoplasma_phage(50.0%)	3	NA	NA
WP_160193888.1|1201390_1202866_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	34.9	1.2e-47
WP_000046076.1|1202996_1204205_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143497.1|1204658_1205018_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 86
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1209061	1211730	2847876		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1209061_1210276_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129645.1|1210272_1211730_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	4.4e-39
>prophage 87
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1224941	1228464	2847876		environmental_halophage(50.0%)	3	NA	NA
WP_000807671.1|1224941_1226183_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.1e-110
WP_000205572.1|1226297_1227605_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_160193890.1|1227702_1228464_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	5.7e-06
>prophage 88
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1232412	1233438	2847876		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571209.1|1232412_1233438_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.2e-28
>prophage 89
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1236547	1241725	2847876		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1236547_1236904_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147955.1|1237047_1237368_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1237517_1238057_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150036.1|1238139_1238856_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.7	6.8e-17
WP_000974455.1|1239003_1239426_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1239824_1240319_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255545.1|1240474_1241092_+	amino acid transporter	NA	NA	NA	NA	NA
WP_016187137.1|1241164_1241725_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	3.8e-31
>prophage 90
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1245130	1246374	2847876		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1245130_1245331_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001574556.1|1245687_1246374_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 91
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1255848	1264606	2847876		Staphylococcus_phage(50.0%)	8	NA	NA
WP_001574560.1|1255848_1256577_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	4.8e-18
WP_000999096.1|1256864_1257479_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_001085185.1|1258444_1258909_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_001050041.1|1258930_1261303_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	1.9e-92
WP_001165967.1|1261336_1262077_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000556760.1|1262205_1262439_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785248.1|1262505_1262964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1263301_1264606_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 92
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1275294	1281110	2847876		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1275294_1275882_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1276450_1277395_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1277503_1278499_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369719.1|1278495_1279407_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134960.1|1280174_1281110_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	8.4e-84
>prophage 93
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1285507	1288354	2847876		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662687.1|1285507_1288354_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 94
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1291672	1292512	2847876		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000749385.1|1291672_1292512_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 95
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1298950	1304655	2847876		Streptococcus_phage(66.67%)	5	NA	NA
WP_000370984.1|1298950_1300033_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.8	1.2e-44
WP_000686342.1|1300396_1301263_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192947.1|1301406_1302048_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
WP_000258151.1|1302211_1303267_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1303584_1304655_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 96
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1313932	1336903	2847876		uncultured_Caudovirales_phage(35.71%)	18	NA	NA
WP_000616865.1|1313932_1314694_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
WP_001245566.1|1314690_1315647_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
WP_000876311.1|1315633_1316605_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	80.2	7.8e-141
WP_000562498.1|1316981_1317953_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1318072_1320178_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1320140_1320539_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068491.1|1321340_1322207_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930016.1|1322226_1322727_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
WP_000193750.1|1323066_1324572_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031788440.1|1324649_1324751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429002.1|1324841_1325759_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	8.2e-07
WP_000197262.1|1326310_1326853_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663016.1|1327011_1328070_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.5	5.7e-20
WP_000180987.1|1328309_1329824_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589241.1|1329816_1330794_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.1e-25
WP_000983677.1|1331014_1332796_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525101.1|1332807_1334691_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	8.8e-56
WP_000098285.1|1334962_1336903_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 97
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1340042	1349888	2847876		Pandoravirus(12.5%)	12	NA	NA
WP_001217804.1|1340042_1341194_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
WP_000604508.1|1341177_1341771_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
WP_000446724.1|1342121_1342790_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1342791_1343211_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062968.1|1343214_1343928_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000637686.1|1344026_1344611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093552.1|1344890_1345331_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1345672_1346146_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1346120_1346807_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244416.1|1346806_1347862_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702776.1|1347933_1348917_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.0	7.3e-62
WP_000931237.1|1349048_1349888_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
>prophage 98
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1357050	1407503	2847876	transposase,tRNA,bacteriocin	Staphylococcus_phage(33.33%)	51	NA	NA
WP_001107240.1|1357050_1357533_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_000216727.1|1357706_1358159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041284.1|1358455_1359622_-	multidrug efflux MFS transporter NorA	NA	NA	NA	NA	NA
WP_000776010.1|1359831_1360254_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001191871.1|1360440_1361058_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_000154465.1|1361054_1361339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952030.1|1361493_1362867_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	1.2e-46
WP_000005632.1|1362952_1364506_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_000180420.1|1364788_1365076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435104.1|1365110_1366019_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_000794424.1|1366121_1367048_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001283444.1|1367274_1367718_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000857616.1|1367844_1369518_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	24.2	2.0e-11
WP_000737163.1|1369514_1371146_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	28.2	2.3e-12
WP_000469883.1|1371364_1372240_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358501.1|1372411_1373095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148821.1|1373097_1373556_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1373557_1374124_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
WP_000638614.1|1374218_1374761_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000545116.1|1374840_1375140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000733427.1|1375277_1375667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259673.1|1375733_1376177_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000842865.1|1376303_1376993_+	DUF1129 family protein	NA	NA	NA	NA	NA
WP_160193892.1|1377655_1378330_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	87.9	2.8e-113
WP_000361064.1|1378424_1378802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159128.1|1379039_1379405_+	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	47.8	8.5e-24
WP_000378396.1|1379397_1381578_+	cadmium-translocating P-type ATPase CadA	NA	E4ZFI9	Streptococcus_phage	63.7	9.3e-251
WP_000277738.1|1381940_1383587_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.4	1.0e-289
WP_000277154.1|1383653_1385087_-	multi-copper oxidase Mco	NA	NA	NA	NA	NA
WP_000069452.1|1385101_1387147_-	copper-translocating P-type ATPase CopB	NA	E4ZFI9	Streptococcus_phage	29.2	2.3e-65
WP_000690626.1|1387413_1387989_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	2.9e-42
WP_000838599.1|1388323_1389319_-	YeiH family protein	NA	NA	NA	NA	NA
WP_000377738.1|1389443_1390265_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791613.1|1390566_1390659_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000397995.1|1390887_1391211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998976.1|1392427_1392853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843733.1|1393642_1394386_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_001002795.1|1394935_1395031_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000761344.1|1395245_1395587_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000145511.1|1395673_1396534_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000273007.1|1396898_1397399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001582045.1|1397465_1397792_-	recombinase	NA	NA	NA	NA	NA
WP_001643491.1|1397731_1398109_-	recombinase	NA	NA	NA	NA	NA
WP_000277741.1|1398263_1399910_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_000831610.1|1400853_1401165_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000713732.1|1401168_1403103_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000726502.1|1403177_1403471_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000358995.1|1403850_1404246_-	thioredoxin-dependent arsenate reductase	NA	A0A2H4PQT9	Staphylococcus_phage	86.3	8.5e-62
WP_000153633.1|1404263_1405553_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	81.1	5.6e-187
WP_000120605.1|1405552_1405867_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4PQT4	Staphylococcus_phage	73.1	4.7e-39
WP_001105942.1|1406828_1407503_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
>prophage 99
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1412807	1413281	2847876		Pandoravirus(100.0%)	1	NA	NA
WP_000833480.1|1412807_1413281_-	cupin	NA	A0A291AU44	Pandoravirus	38.7	4.6e-14
>prophage 100
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1418530	1419328	2847876		Lactobacillus_virus(100.0%)	1	NA	NA
WP_000731642.1|1418530_1419328_+	LysM peptidoglycan-binding domain-containing protein	NA	C1KFN7	Lactobacillus_virus	35.8	2.1e-06
>prophage 101
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1424049	1424811	2847876		Planktothrix_phage(100.0%)	1	NA	NA
WP_000153733.1|1424049_1424811_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.2e-33
>prophage 102
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1429176	1430220	2847876		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_001030763.1|1429176_1430220_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.1	3.8e-16
>prophage 103
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1436742	1437540	2847876		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1436742_1437540_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 104
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1440767	1444726	2847876		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1440767_1442495_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793055.1|1442915_1444211_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1444327_1444726_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 105
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1451659	1452403	2847876		Indivirus(100.0%)	1	NA	NA
WP_160193894.1|1451659_1452403_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.8e-12
>prophage 106
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1465268	1465829	2847876	integrase	Streptococcus_phage(100.0%)	1	1459422:1459436	1469411:1469425
1459422:1459436	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044966.1|1465268_1465829_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
WP_001044966.1|1465268_1465829_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
1469411:1469425	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 107
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1478996	1482350	2847876		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1478996_1480007_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1480505_1481027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180233.1|1481054_1482350_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 108
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1489880	1491203	2847876		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860607.1|1489880_1491203_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	8.2e-109
>prophage 109
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1502507	1503164	2847876		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455258.1|1502507_1503164_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	6.4e-46
>prophage 110
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1506831	1510153	2847876		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000382588.1|1506831_1508208_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	6.7e-21
WP_160193900.1|1508752_1510153_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.3	2.5e-55
>prophage 111
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1533453	1534116	2847876		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|1533453_1534116_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 112
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1540704	1541892	2847876		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250820.1|1540704_1541892_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	1.5e-45
>prophage 113
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1544919	1555873	2847876		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1544919_1547001_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1547123_1547594_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1547659_1548073_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1548170_1548425_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001819727.1|1548561_1552158_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	4.3e-67
WP_000918664.1|1552321_1555873_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	6.1e-50
>prophage 114
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1559557	1564340	2847876	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1559557_1560106_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1560118_1560301_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001791441.1|1560356_1560500_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872867.1|1560614_1561184_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664740.1|1561264_1561789_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1561788_1562535_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370181.1|1562542_1562947_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631982.1|1562939_1564340_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	2.5e-55
>prophage 115
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1570351	1572808	2847876	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1570351_1572808_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 116
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1586594	1597052	2847876	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1586594_1588082_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_016186812.1|1588134_1588227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613720.1|1588620_1589097_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154303.1|1589093_1589459_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167936.1|1589436_1590240_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	6.7e-21
WP_000057594.1|1590455_1591388_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1591566_1592448_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1592861_1594955_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1595212_1595752_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176721.1|1595756_1597052_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.3	8.2e-13
>prophage 117
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1606308	1608773	2847876		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1606308_1607274_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252515.1|1607420_1608773_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	1.1e-23
>prophage 118
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1614657	1617755	2847876	tRNA	Hokovirus(50.0%)	2	NA	NA
WP_001051120.1|1614657_1616631_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.6	3.2e-93
WP_000279925.1|1616915_1617755_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 119
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1621661	1622279	2847876		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1621661_1622279_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 120
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1631139	1632837	2847876		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109044.1|1631139_1632837_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 121
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1649474	1655711	2847876		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170274.1|1649474_1650479_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.1	1.4e-23
WP_160193906.1|1650812_1651655_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467992.1|1651691_1652351_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569267.1|1652354_1653380_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	1.4e-31
WP_001036658.1|1653670_1654813_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_000634110.1|1654805_1655711_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.4	7.2e-48
>prophage 122
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1679248	1682030	2847876		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072632.1|1679248_1680481_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	2.7e-45
WP_000028598.1|1680473_1682030_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.5	1.7e-286
>prophage 123
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1693460	1693787	2847876	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001799349.1|1693460_1693787_+|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	85.4	4.3e-11
>prophage 124
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1697150	1700183	2847876		Hokovirus(50.0%)	2	NA	NA
WP_000424963.1|1697150_1698692_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1698716_1700183_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 125
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1709283	1710807	2847876		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930503.1|1709283_1710807_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.2	5.5e-40
>prophage 126
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1719532	1725863	2847876		Staphylococcus_phage(50.0%)	8	NA	NA
WP_000934799.1|1719532_1720036_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1720056_1720353_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1720596_1720788_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1720873_1721971_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1721982_1722186_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373076.1|1722215_1723097_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001573568.1|1723250_1724096_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655687.1|1724759_1725863_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 127
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1735784	1736627	2847876		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209478.1|1735784_1736627_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.2	4.5e-12
>prophage 128
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1758036	1760771	2847876		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280814.1|1758036_1759059_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.1	6.7e-10
WP_001191936.1|1759036_1759981_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449073.1|1759970_1760771_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	44.4	1.5e-41
>prophage 129
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1779008	1779686	2847876		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911024.1|1779008_1779686_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.2e-31
>prophage 130
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1793738	1798187	2847876		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549309.1|1793738_1798187_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.7	1.7e-28
>prophage 131
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1808790	1810452	2847876		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000570080.1|1808790_1809450_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	5.8e-23
WP_000736790.1|1809501_1810452_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 132
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1819259	1820696	2847876		Pandoravirus(100.0%)	1	NA	NA
WP_000163995.1|1819259_1820696_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.0	1.3e-30
>prophage 133
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1827204	1831748	2847876		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925396.1|1827204_1828944_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	2.0e-62
WP_000608835.1|1829209_1829884_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975347.1|1830023_1831748_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 134
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1838564	1840131	2847876	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_094409958.1|1838564_1840131_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
>prophage 135
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1843280	1844324	2847876		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645611.1|1843280_1844324_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.6	6.0e-14
>prophage 136
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1851540	1853070	2847876		Vibrio_phage(100.0%)	1	NA	NA
WP_000838204.1|1851540_1853070_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 137
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1862755	1864261	2847876		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008395.1|1862755_1864261_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 138
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1875222	1880581	2847876		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1875222_1877472_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837114.1|1878059_1879028_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127979.1|1879024_1880581_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 139
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1890892	1892951	2847876		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818914.1|1890892_1891990_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166911.1|1892372_1892951_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	43.0	1.6e-13
>prophage 140
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1900762	1902355	2847876		Planktothrix_phage(100.0%)	1	NA	NA
WP_000067363.1|1900762_1902355_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	5.4e-22
>prophage 141
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1918446	1919631	2847876		Klosneuvirus(100.0%)	1	NA	NA
WP_001084444.1|1918446_1919631_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.6	2.4e-35
>prophage 142
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1924489	1934773	2847876		Tupanvirus(50.0%)	3	NA	NA
WP_000605273.1|1924489_1931665_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.9	3.4e-68
WP_000826855.1|1932111_1933362_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706134.1|1933747_1934773_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 143
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1938309	1941309	2847876		Bacillus_virus(50.0%)	4	NA	NA
WP_000590840.1|1938309_1939050_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	6.5e-39
WP_000171926.1|1939391_1939904_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356967.1|1940084_1940288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013476.1|1940349_1941309_-	cation transporter	NA	A0A1V0SED0	Indivirus	33.6	2.8e-10
>prophage 144
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1944650	1947135	2847876		Catovirus(50.0%)	2	NA	NA
WP_000723445.1|1944650_1945796_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	3.2e-24
WP_000779509.1|1945872_1947135_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	2.5e-22
>prophage 145
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1954152	1960717	2847876		Catovirus(50.0%)	6	NA	NA
WP_000413167.1|1954152_1955277_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	3.9e-128
WP_001028294.1|1955280_1956390_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1956402_1957431_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940769.1|1957420_1959244_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.4	3.0e-29
WP_000565301.1|1959263_1960028_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037317.1|1960030_1960717_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	8.2e-28
>prophage 146
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1964740	1965916	2847876		Clostridium_phage(100.0%)	1	NA	NA
WP_000469818.1|1964740_1965916_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.9	5.2e-30
>prophage 147
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1971374	1972148	2847876		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078278.1|1971374_1972148_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	6.4e-13
>prophage 148
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1980034	1980634	2847876		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1980034_1980634_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 149
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1985568	1990664	2847876		Catovirus(50.0%)	4	NA	NA
WP_001793810.1|1985568_1986549_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.3	1.3e-47
WP_000414632.1|1987871_1988498_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|1988693_1989458_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223717.1|1989461_1990664_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.3	5.1e-09
>prophage 150
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	1998930	2003140	2847876		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1998930_1999911_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045124.1|2000141_2001134_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000925002.1|2001149_2002145_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136645.1|2002141_2003140_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.6e-14
>prophage 151
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2035186	2040521	2847876	transposase	Acidithiobacillus_phage(33.33%)	5	NA	NA
WP_000649665.1|2035186_2036887_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	26.8	4.1e-20
WP_001794509.1|2037176_2037551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|2037736_2038684_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000370465.1|2038688_2039204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088356251.1|2039391_2040521_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.0	6.4e-78
>prophage 152
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2046401	2056397	2847876		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2046401_2047202_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104171.1|2047589_2048378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160193922.1|2048378_2049713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871610.1|2049705_2051532_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	2.1e-30
WP_000101976.1|2051544_2052246_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2053435_2054719_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2054996_2056397_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 153
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2063079	2072115	2847876	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884337.1|2063079_2064366_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177483.1|2064743_2066258_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	4.4e-90
WP_000449218.1|2066583_2067396_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819098.1|2067483_2070144_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.8	4.6e-119
WP_000255583.1|2070180_2072115_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	4.4e-143
>prophage 154
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2082202	2085502	2847876		Faecalibacterium_phage(33.33%)	5	NA	NA
WP_000742840.1|2082202_2083042_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.4	1.4e-05
WP_000491382.1|2083536_2083890_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|2083957_2084353_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054111.1|2084605_2085175_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	34.8	2.8e-05
WP_001059079.1|2085301_2085502_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
>prophage 155
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2091295	2092054	2847876		Planktothrix_phage(100.0%)	1	NA	NA
WP_000154162.1|2091295_2092054_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 156
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2109197	2110910	2847876		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138663.1|2109197_2110910_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	5.4e-20
>prophage 157
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2116538	2117552	2847876		Faustovirus(100.0%)	1	NA	NA
WP_160193924.1|2116538_2117552_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	22.9	1.4e-07
>prophage 158
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2129943	2130636	2847876		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185860.1|2129943_2130636_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 159
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2154438	2158034	2847876	transposase	Paenibacillus_phage(50.0%)	2	NA	NA
WP_094409958.1|2154438_2156005_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_160193926.1|2156174_2158034_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 160
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2183727	2185478	2847876		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143418.1|2183727_2184615_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	7.4e-05
WP_000923764.1|2184722_2185478_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.8e-31
>prophage 161
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2188915	2189413	2847876		Canarypox_virus(100.0%)	1	NA	NA
WP_001065267.1|2188915_2189413_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	2.4e-21
>prophage 162
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2194463	2196847	2847876		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071721.1|2194463_2196314_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.9	1.3e-234
WP_000173336.1|2196310_2196847_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	47.5	1.1e-40
>prophage 163
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2201723	2211834	2847876	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2201723_2203433_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2203710_2203923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028789.1|2204202_2204646_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172333.1|2204839_2206438_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.6	2.6e-77
WP_001793854.1|2206497_2206698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2207124_2208621_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031407.1|2208813_2209704_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237625.1|2209826_2210243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030061.1|2210496_2211834_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	6.7e-18
>prophage 164
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2239989	2243189	2847876		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751265.1|2239989_2240691_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.8	2.1e-39
WP_000379825.1|2241377_2243189_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 165
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2251634	2256089	2847876		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161364.1|2251634_2252633_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	2.6e-35
WP_000076662.1|2252722_2252929_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024137.1|2253680_2256089_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	2.9e-128
>prophage 166
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2265330	2268320	2847876	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001063330.1|2265330_2267436_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.5	6.9e-118
WP_000262597.1|2267798_2268320_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	2.4e-27
>prophage 167
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2274744	2281127	2847876		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062662.1|2274744_2276484_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
WP_160193932.1|2276783_2278850_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2279229_2279640_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240663.1|2279681_2280038_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228158.1|2280158_2281127_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	3.1e-12
>prophage 168
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2289951	2290944	2847876		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161541.1|2289951_2290944_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	9.7e-38
>prophage 169
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2300360	2301056	2847876		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382892.1|2300360_2301056_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	2.0e-37
>prophage 170
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2319655	2326831	2847876		Bacillus_phage(66.67%)	6	NA	NA
WP_000721330.1|2319655_2320522_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	4.4e-79
WP_001573690.1|2320648_2320957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678764.1|2321100_2321367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001793882.1|2321650_2323459_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.5	1.0e-93
WP_000755954.1|2323575_2323968_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_160193938.1|2323969_2326831_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.6	2.6e-27
>prophage 171
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2331274	2331970	2847876		Bacillus_phage(100.0%)	1	NA	NA
WP_000217452.1|2331274_2331970_+	oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	5.1e-09
>prophage 172
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2335153	2340390	2847876	transposase	Staphylococcus_virus(50.0%)	4	NA	NA
WP_000277741.1|2335153_2336800_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_001146762.1|2337264_2337687_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000202030.1|2337798_2339337_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_000824929.1|2339571_2340390_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.8	1.9e-10
>prophage 173
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2348455	2350013	2847876		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173876.1|2348455_2349271_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	6.1e-14
WP_000590515.1|2349263_2350013_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 174
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2356246	2360673	2847876		Bacillus_phage(50.0%)	4	NA	NA
WP_000923514.1|2356246_2356909_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.5	2.2e-17
WP_000072154.1|2356901_2357678_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026190.1|2358071_2359259_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700902.1|2359320_2360673_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	3.0e-13
>prophage 175
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2364066	2365293	2847876		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000948990.1|2364066_2365293_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 176
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2383669	2389876	2847876		Bacillus_phage(66.67%)	5	NA	NA
WP_001176855.1|2383669_2384812_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.9	2.6e-55
WP_000779351.1|2385079_2385466_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2385599_2385707_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064829.1|2386354_2388118_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	1.6e-35
WP_000486505.1|2388142_2389876_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.5e-30
>prophage 177
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2393337	2399091	2847876		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971554.1|2393337_2394453_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.9	7.1e-21
WP_000286868.1|2394463_2395156_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200947.1|2395166_2395634_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_001056917.1|2395685_2396663_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	2.4e-142
WP_000916697.1|2396664_2397612_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	2.1e-138
WP_000594516.1|2398161_2399091_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.4	1.5e-120
>prophage 178
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2406983	2407715	2847876		Bacillus_virus(100.0%)	1	NA	NA
WP_000615467.1|2406983_2407715_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	1.3e-23
>prophage 179
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2424579	2426139	2847876		Escherichia_phage(100.0%)	1	NA	NA
WP_000692650.1|2424579_2426139_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	3.4e-21
>prophage 180
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2436870	2438517	2847876	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_000277741.1|2436870_2438517_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 181
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2449458	2450493	2847876		Bacillus_virus(100.0%)	1	NA	NA
WP_000655979.1|2449458_2450493_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	1.7e-16
>prophage 182
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2460955	2467512	2847876		Staphylococcus_phage(25.0%)	8	NA	NA
WP_000388431.1|2460955_2461684_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	6.7e-28
WP_000372857.1|2461817_2462381_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000793166.1|2462557_2463013_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_000977031.1|2463009_2463453_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000477322.1|2463615_2464989_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.3	1.1e-12
WP_000249492.1|2464981_2465656_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	44.7	8.0e-52
WP_000761409.1|2465791_2466847_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229922.1|2466846_2467512_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	7.2e-37
>prophage 183
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2471249	2472458	2847876		Salmonella_phage(100.0%)	1	NA	NA
WP_000999130.1|2471249_2472458_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.5	3.0e-33
>prophage 184
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2485114	2486014	2847876		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524842.1|2485114_2486014_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.7e-15
>prophage 185
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2493371	2493791	2847876		Bacillus_phage(100.0%)	1	NA	NA
WP_000920241.1|2493371_2493791_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	7.7e-37
>prophage 186
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2499482	2500364	2847876		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730056.1|2499482_2500364_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	1.7e-62
>prophage 187
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2508243	2508879	2847876		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285452.1|2508243_2508879_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.6	7.1e-10
>prophage 188
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2521883	2526150	2847876		Staphylococcus_phage(50.0%)	4	NA	NA
WP_072460394.1|2521883_2522522_+	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	47.4	4.5e-36
WP_000684154.1|2523130_2524255_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.6e-12
WP_000417008.1|2524346_2525300_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.2	5.8e-32
WP_000737700.1|2525658_2526150_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 189
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2530070	2530880	2847876		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717395.1|2530070_2530880_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 190
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2549853	2550459	2847876		Pithovirus(100.0%)	1	NA	NA
WP_000913006.1|2549853_2550459_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 191
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2562426	2565594	2847876		Leptospira_phage(100.0%)	1	NA	NA
WP_000592290.1|2562426_2565594_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	4.3e-63
>prophage 192
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2588773	2592383	2847876	transposase	Paenibacillus_phage(33.33%)	3	NA	NA
WP_094409958.1|2588773_2590341_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000389651.1|2590716_2591526_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.8	1.4e-18
WP_000586768.1|2591522_2592383_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.4e-10
>prophage 193
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2595424	2603987	2847876		Mycobacterium_phage(33.33%)	8	NA	NA
WP_000204271.1|2595424_2596861_+	MarR family transcriptional regulator	NA	A0A088F7M4	Mycobacterium_phage	31.2	5.5e-58
WP_000136272.1|2597109_2597289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791584.1|2597938_2598121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130145.1|2598590_2600255_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	4.7e-45
WP_000179061.1|2600291_2600996_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000769709.1|2601386_2601812_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044369.1|2602106_2602922_+	hydrolase	NA	NA	NA	NA	NA
WP_001044451.1|2603132_2603987_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	34.8	1.3e-06
>prophage 194
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2607365	2610428	2847876		Staphylococcus_phage(50.0%)	5	NA	NA
WP_001015495.1|2607365_2608214_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.4	1.3e-43
WP_001573519.1|2608434_2608560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293423.1|2608514_2608808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333457.1|2608821_2609430_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_001573518.1|2609687_2610428_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	30.3	7.3e-14
>prophage 195
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2616748	2619815	2847876	transposase	Pandoravirus(50.0%)	2	NA	NA
WP_000169223.1|2616748_2618161_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	5.0e-48
WP_094409958.1|2618247_2619815_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
>prophage 196
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2623792	2625355	2847876		Vibrio_phage(100.0%)	1	NA	NA
WP_000792332.1|2623792_2625355_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	3.5e-18
>prophage 197
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2635558	2636527	2847876		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2635558_2636527_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 198
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2652327	2653236	2847876		Klosneuvirus(100.0%)	1	NA	NA
WP_000162591.1|2652327_2653236_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.7	1.2e-26
>prophage 199
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2670478	2677896	2847876	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000334466.1|2670478_2672284_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.6	2.6e-97
WP_000908186.1|2672515_2673298_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	5.7e-09
WP_000370937.1|2673365_2674223_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001792784.1|2674881_2675040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073392962.1|2675719_2675824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277741.1|2676249_2677896_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 200
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2686402	2691898	2847876	transposase	Clostridium_phage(33.33%)	5	NA	NA
WP_000070866.1|2686402_2686846_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_094409958.1|2686951_2688519_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000160304.1|2688629_2689340_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083335.1|2689654_2690317_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242308.1|2690596_2691898_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.7	1.4e-132
>prophage 201
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2699831	2701442	2847876		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2699831_2701442_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 202
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2709245	2716998	2847876		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2709245_2709845_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460244.1|2709845_2710922_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248730.1|2710908_2711745_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001801520.1|2711777_2712875_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697334.1|2712871_2713291_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654191.1|2713397_2713922_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_160193965.1|2713948_2715187_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2715214_2715844_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723407.1|2715867_2716998_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.1	1.0e-27
>prophage 203
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2727714	2728110	2847876		Bacillus_phage(100.0%)	1	NA	NA
WP_000932696.1|2727714_2728110_+	single-stranded DNA-binding protein	NA	A0A1B1PAE7	Bacillus_phage	36.8	3.0e-14
>prophage 204
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2734219	2734867	2847876		Moumouvirus(100.0%)	1	NA	NA
WP_001187612.1|2734219_2734867_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	4.7e-09
>prophage 205
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2743059	2744580	2847876		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178940.1|2743059_2744580_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 206
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2750254	2752282	2847876		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_160193966.1|2750254_2752282_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.6	1.1e-24
>prophage 207
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2757432	2760816	2847876		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621176.1|2757432_2757795_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2758143_2759145_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_160193968.1|2759263_2759590_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190825.1|2759591_2760071_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041107.1|2760045_2760816_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 208
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2774929	2779653	2847876		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094572.1|2774929_2776459_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.6	9.4e-08
WP_072399972.1|2776488_2777508_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2777629_2777884_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047828.1|2777883_2779653_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	4.1e-63
>prophage 209
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2783413	2797488	2847876	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_000159047.1|2783413_2784439_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	3.1e-63
WP_000106312.1|2784752_2786363_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	27.4	5.1e-20
WP_001791590.1|2786457_2786586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602046.1|2786730_2788659_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.1	3.2e-53
WP_001283612.1|2788911_2789547_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_073392939.1|2789903_2790932_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581078.1|2790991_2791216_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052261.1|2791424_2792675_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	9.0e-41
WP_000790325.1|2792858_2793809_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791588.1|2793957_2795442_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.8	5.2e-19
WP_001253292.1|2795438_2796398_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_160193969.1|2796771_2797488_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 210
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2804628	2818972	2847876	terminase,integrase,coat	Staphylococcus_phage(68.42%)	22	2806588:2806607	2821322:2821341
WP_000917289.1|2804628_2804913_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240651.1|2804988_2806605_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
2806588:2806607	attL	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
WP_000179345.1|2806673_2807846_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	98.2	3.5e-220
WP_000620857.1|2807859_2808534_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
WP_000153640.1|2808706_2808925_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
WP_000481967.1|2808929_2809247_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
WP_000708433.1|2809243_2809399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231378.1|2809383_2809587_+	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	97.0	7.5e-30
WP_000403839.1|2809588_2809972_+	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	9.7e-63
WP_001103930.1|2809972_2810290_+	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	58.2	1.6e-18
WP_001002721.1|2810353_2811223_+	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	99.3	6.0e-169
WP_000447451.1|2811236_2812946_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	100.0	0.0e+00
WP_000356937.1|2813257_2813638_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	100.0	6.9e-69
WP_001019766.1|2813634_2814276_+	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	94.8	3.5e-113
WP_001190608.1|2814811_2815153_+	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	98.2	7.1e-57
WP_000846285.1|2815164_2815743_+	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
WP_000448775.1|2815760_2815979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000771368.1|2816029_2816557_+|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_000358778.1|2816559_2816901_+	hypothetical protein	NA	A0A1W6JQM3	Staphylococcus_phage	100.0	1.7e-58
WP_001293073.1|2816897_2817467_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	3.5e-101
WP_001035597.1|2817621_2818326_-	toxic shock syndrome toxin TSST-1	NA	NA	NA	NA	NA
WP_000812237.1|2818744_2818972_+	hypothetical protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	47.4	1.9e-13
2821322:2821341	attR	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
>prophage 211
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2822056	2822684	2847876		Staphylococcus_phage(100.0%)	2	NA	NA
WP_001573769.1|2822056_2822353_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	40.4	6.7e-11
WP_001573771.1|2822342_2822684_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	46.0	4.1e-20
>prophage 212
NZ_CP047788	Staphylococcus aureus strain UP_1033 chromosome, complete genome	2847876	2826662	2847406	2847876	integrase	Staphylococcus_phage(100.0%)	38	2818488:2818504	2840021:2840037
2818488:2818504	attL	AACATTTTAAAGTTACA	NA	NA	NA	NA
WP_000791402.1|2826662_2827718_+	succinyl-diaminopimelate desuccinylase	NA	A0A2I6PER8	Staphylococcus_phage	34.6	7.9e-38
WP_000595617.1|2827739_2828759_+	beta-channel forming cytolysin	NA	A0A2I6PEU3	Staphylococcus_phage	39.6	3.4e-54
WP_000857191.1|2829898_2830936_-|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	100.0	9.1e-180
WP_000825947.1|2830994_2831459_-	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
WP_000705248.1|2831558_2831741_-	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
WP_000591749.1|2831944_2832286_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
WP_000759682.1|2832291_2833224_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
WP_001031454.1|2833239_2833953_-	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_000854072.1|2834084_2834348_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
WP_001025874.1|2834363_2834579_+	DUF2829 domain-containing protein	NA	A0EWV9	Staphylococcus_phage	100.0	6.3e-35
WP_000128907.1|2834567_2834897_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
WP_001148605.1|2834947_2835700_+	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_160193971.1|2835715_2835913_+	hypothetical protein	NA	Q8SDM8	Staphylococcus_phage	92.3	2.8e-29
WP_000939496.1|2835943_2836084_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
WP_000275058.1|2836098_2836731_-	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
WP_001120197.1|2836789_2837110_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_000066017.1|2837106_2837268_+	DUF1270 domain-containing protein	NA	D2JGJ6	Staphylococcus_phage	100.0	4.3e-20
WP_000165375.1|2837362_2837689_+	DUF2482 family protein	NA	W5RAK4	Staphylococcus_phage	100.0	1.2e-53
WP_000291503.1|2837669_2837930_+	DUF1108 family protein	NA	A0EWW8	Staphylococcus_phage	100.0	8.9e-44
WP_001205732.1|2837938_2838202_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700577.1|2838210_2840154_+	AAA family ATPase	NA	A0EWX0	Staphylococcus_phage	100.0	0.0e+00
2840021:2840037	attR	AACATTTTAAAGTTACA	NA	NA	NA	NA
WP_000138472.1|2840155_2841076_+	recombinase	NA	S4SUN6	Staphylococcus_phage	100.0	2.3e-166
WP_071621397.1|2841156_2841774_+	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
WP_000934764.1|2841774_2842245_+	single-stranded DNA-binding protein	NA	A0EWX3	Staphylococcus_phage	100.0	7.4e-81
WP_000148316.1|2842274_2843159_+	DnaD domain protein	NA	A0EWX4	Staphylococcus_phage	100.0	5.4e-141
WP_000338531.1|2843165_2843384_+	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	98.6	1.2e-36
WP_000101274.1|2843714_2844083_+	hypothetical protein	NA	W5RAK8	Staphylococcus_phage	100.0	8.2e-51
WP_000131366.1|2844086_2844329_+	hypothetical protein	NA	A0EWX8	Staphylococcus_phage	100.0	3.9e-41
WP_001793974.1|2844334_2844508_+	hypothetical protein	NA	A0EWX9	Staphylococcus_phage	100.0	1.2e-25
WP_001065091.1|2844500_2844752_+	DUF1024 family protein	NA	A0EWY0	Staphylococcus_phage	100.0	1.9e-38
WP_000028422.1|2844741_2844924_+	hypothetical protein	NA	A0EWY1	Staphylococcus_phage	100.0	2.6e-26
WP_000185659.1|2844916_2845459_+	dUTP pyrophosphatase	NA	A0EWY2	Staphylococcus_phage	100.0	1.1e-96
WP_000195803.1|2845495_2845702_+	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_000592207.1|2845698_2846085_+	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	3.0e-64
WP_000595265.1|2846081_2846231_+	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_000265043.1|2846230_2846431_+	DUF1514 domain-containing protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
WP_000590122.1|2846458_2846875_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988336.1|2847106_2847406_+	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
