The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	0	35820	2860390	protease,head,terminase,holin,transposase,portal,tail,capsid	Staphylococcus_phage(96.77%)	38	NA	NA
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000154559.1|3609_4755_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114226.1|5675_6080_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268735.1|6484_7129_+|tail	phage tail protein	tail	A0EWZ9	Staphylococcus_phage	100.0	3.8e-120
WP_071621395.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_001643732.1|8039_12569_+|tail	phage tail tape measure protein	tail	A0EX03	Staphylococcus_phage	100.0	0.0e+00
WP_000567413.1|12565_14050_+|tail	phage tail protein	tail	A0EX04	Staphylococcus_phage	100.0	4.5e-297
WP_000582190.1|14065_17851_+	hypothetical protein	NA	A0EX05	Staphylococcus_phage	100.0	0.0e+00
WP_001153681.1|17840_17993_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040259.1|18039_18327_+	hypothetical protein	NA	G4KNR2	Staphylococcus_phage	100.0	9.9e-44
WP_000340977.1|18382_18757_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_000750406.1|19176_19950_+	staphylococcal enterotoxin type A	NA	A0EX09	Staphylococcus_phage	100.0	2.2e-146
WP_011447039.1|20058_20235_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_001791821.1|20287_20395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|20446_20701_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|20712_21468_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000919350.1|21658_22150_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
WP_020444758.1|22676_23135_+	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	4.9e-85
WP_000727649.1|23229_23679_-	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_000702263.1|24364_24715_+	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|24767_25028_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|25338_25518_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_000669728.1|26475_28545_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000277709.1|28842_30489_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
WP_001068528.1|30736_32023_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|32222_32321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681966.1|32562_32739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|32996_33377_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991315.1|33373_34270_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645732.1|34270_34951_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|34947_35820_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
>prophage 2
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	41065	41467	2860390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000205106.1|41065_41467_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
>prophage 3
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	45663	47694	2860390		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|45663_46224_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275719.1|46596_47694_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	8.7e-48
>prophage 4
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	51724	54008	2860390		Bacillus_virus(100.0%)	2	NA	NA
WP_000284434.1|51724_53194_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.5	8.5e-107
WP_000040861.1|53186_54008_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 5
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	57697	64475	2860390		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|57697_58993_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|59101_59404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272063.1|59586_60279_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|60275_62468_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_160325436.1|62471_64475_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	7.5e-114
>prophage 6
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	71704	76732	2860390		Catovirus(33.33%)	5	NA	NA
WP_001231458.1|71704_72652_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.5e-16
WP_001147874.1|72732_74094_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	43.0	1.5e-102
WP_000548777.1|74263_74794_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140179.1|75040_76111_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|76177_76732_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 7
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	80185	80599	2860390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001643743.1|80185_80599_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.5	3.0e-17
>prophage 8
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	85580	86210	2860390		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|85580_86210_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 9
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	101691	103428	2860390		Bacillus_phage(100.0%)	1	NA	NA
WP_000597238.1|101691_103428_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 10
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	119907	120636	2860390		Planktothrix_phage(100.0%)	1	NA	NA
WP_001144055.1|119907_120636_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
>prophage 11
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	131291	131636	2860390		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|131291_131636_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 12
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	141225	141966	2860390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|141225_141966_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 13
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	149829	154109	2860390		Staphylococcus_phage(80.0%)	5	NA	NA
WP_147612242.1|149829_150612_+	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	38.6	8.7e-34
WP_000821649.1|150893_151613_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	34.6	4.9e-23
WP_000721567.1|151647_152376_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.8	1.3e-28
WP_000764684.1|152529_153315_+	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	42.7	2.9e-45
WP_001235656.1|153353_154109_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	40.8	2.3e-39
>prophage 14
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	157363	227655	2860390	protease,tRNA	Staphylococcus_phage(93.02%)	63	NA	NA
WP_000711499.1|157363_158710_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	51.1	2.5e-65
WP_001039022.1|160485_161205_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.7	6.4e-124
WP_001038766.1|161328_162045_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	5.5e-83
WP_001038734.1|163090_163807_+|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	97.1	6.6e-129
WP_001038742.1|163976_164696_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	98.3	1.0e-129
WP_001794363.1|164875_166615_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.6	3.2e-286
WP_000072622.1|166607_167762_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.3	7.8e-39
WP_000413389.1|167798_169616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095390.1|169877_170177_-	secretion protein	NA	NA	NA	NA	NA
WP_001053714.1|170191_171802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000619920.1|171844_172294_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001819963.1|172521_172881_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000182553.1|173006_175427_-	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_000731421.1|176393_176837_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001037039.1|176836_177280_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001791232.1|177454_177556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001801861.1|177678_177774_-	type I toxin-antitoxin system Fst family toxin PepA1	NA	NA	NA	NA	NA
WP_000747804.1|178224_178671_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000125075.1|178863_179433_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
WP_001093574.1|179432_180800_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000414222.1|180948_181521_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
WP_000627550.1|181618_181963_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
WP_000669038.1|182003_182630_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
WP_000070654.1|182705_183701_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	3.8e-74
WP_001794016.1|183781_184432_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	1.0e-51
WP_016186903.1|184733_185189_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	3.5e-75
WP_000348372.1|185347_186826_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
WP_000778539.1|186830_187832_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	96.7	8.5e-183
WP_000718107.1|187828_188086_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672010.1|188151_188625_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	9.5e-84
WP_001801476.1|188629_189376_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.3e-139
WP_000109909.1|189668_191261_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
WP_000933819.1|191632_192826_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000366165.1|192950_193859_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
WP_000453316.1|194070_194904_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.6	1.2e-158
WP_000623481.1|195153_195507_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	97.4	4.2e-20
WP_001200542.1|195503_195869_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091444.1|196123_196426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|196684_197398_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_000492901.1|197855_198476_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001168914.1|198642_199278_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001030476.1|199575_200019_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
WP_001152695.1|200005_200449_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000384171.1|201231_201456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|201731_202586_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989104.1|202672_203965_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	95.1	2.6e-216
WP_000221181.1|203964_204279_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	97.1	1.7e-52
WP_001261683.1|204921_206424_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
WP_001819953.1|206916_207948_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.3	5.8e-195
WP_000493891.1|207954_208587_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
WP_001159032.1|208597_209779_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
WP_001008556.1|209791_210256_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	97.4	1.9e-68
WP_001196351.1|210377_211379_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.1	5.0e-183
WP_014937042.1|211490_211610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266099.1|211612_212440_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|213012_213414_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764425.1|213532_214096_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
WP_000526541.1|214092_215046_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
WP_001025064.1|215156_216338_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
WP_001108722.1|216629_219044_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.8	0.0e+00
WP_000836472.1|219065_219377_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
WP_160325439.1|219700_226270_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	88.7	1.7e-295
WP_000284993.1|226386_227655_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	5.9e-56
>prophage 15
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	235792	239729	2860390		Salmonella_phage(50.0%)	4	NA	NA
WP_000733283.1|235792_236638_-	BlaZ family penicillin-hydrolyzing class A beta-lactamase PC1	NA	A0A1B0VBP7	Salmonella_phage	34.0	1.5e-31
WP_001096374.1|236744_238502_+	beta-lactam sensor/signal transducer BlaR1	NA	NA	NA	NA	NA
WP_001284656.1|238491_238872_+	penicillinase repressor BlaI	NA	NA	NA	NA	NA
WP_000690628.1|239135_239729_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	1.1e-41
>prophage 16
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	245312	250682	2860390		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|245312_246170_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048374.1|246198_246837_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_160325441.1|246857_250682_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 17
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	259254	260961	2860390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862084.1|259254_260961_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.8	2.1e-274
>prophage 18
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	267565	270196	2860390	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|267565_268828_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279341.1|268921_270196_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 19
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	273964	278100	2860390		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808837.1|273964_275569_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291426.1|275555_276716_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553919.1|276830_277277_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174275.1|277356_278100_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.9	8.3e-18
>prophage 20
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	295682	298880	2860390		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226930.1|295682_298880_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	5.5e-135
>prophage 21
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	303812	305570	2860390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232655.1|303812_305570_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	3.3e-41
>prophage 22
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	310453	318619	2860390		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_160325443.1|310453_311155_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_073392727.1|311157_312819_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.0	1.7e-34
WP_000849445.1|313320_314808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160325444.1|315100_317731_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	32.7	1.8e-46
WP_001114454.1|317746_318619_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
>prophage 23
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	322533	333687	2860390	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|322533_323454_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_016186894.1|323546_323642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|323866_325804_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049150.1|326230_327724_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791219.1|327952_328480_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	5.3e-11
WP_001125540.1|328508_328709_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|328755_329112_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032653.1|329253_329862_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	36.4	1.7e-21
WP_001280014.1|329880_330810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|330814_330925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127572.1|330972_332274_+	trigger factor	NA	NA	NA	NA	NA
WP_000472293.1|332424_333687_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	1.1e-139
>prophage 24
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	343253	345884	2860390	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000425358.1|343253_345884_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	3.7e-153
>prophage 25
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	355999	391597	2860390	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|355999_357004_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019178.1|357005_358031_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|358053_359193_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|359211_359472_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749802.1|359746_362026_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000595001.1|362228_364502_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
WP_000364542.1|364523_365042_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058583.1|365469_367659_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869979.1|367670_368123_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|368119_368995_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590826.1|369455_370718_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044796.1|370733_372500_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001791215.1|372832_372961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682640.1|372960_373734_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102741.1|373894_375169_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.9	6.3e-106
WP_000704122.1|375253_375676_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|375775_375958_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000008061.1|375997_376144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985898.1|376380_377394_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409167.1|377703_378846_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000066097.1|378846_379965_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567025.1|380646_381315_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001283316.1|381316_383794_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_000734077.1|384136_386767_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|386829_387090_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|387093_387522_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|387536_387845_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342267.1|388129_388768_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137775.1|388770_389694_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|389705_390974_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|390973_391597_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 26
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	408061	414225	2860390		Bacillus_phage(33.33%)	5	NA	NA
WP_000439692.1|408061_408523_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_160325521.1|408581_410729_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	9.1e-33
WP_001282570.1|410785_411760_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|411804_412056_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|412401_414225_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 27
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	417660	420768	2860390		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|417660_419493_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_001119020.1|419628_420768_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.5	6.8e-27
>prophage 28
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	427237	428185	2860390		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117769.1|427237_428185_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	4.9e-47
>prophage 29
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	431239	444967	2860390	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|431239_432631_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001794939.1|432965_433589_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|433599_434418_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217253.1|434478_436278_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
WP_001283055.1|436501_437608_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624581.1|437738_438416_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683921.1|438418_439519_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
WP_001062173.1|439632_440979_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	1.4e-55
WP_000924211.1|440988_441879_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
WP_001213908.1|442004_442790_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564316.1|442831_443695_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|443681_444092_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|444367_444967_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 30
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	451139	451763	2860390		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|451139_451763_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 31
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	457307	460119	2860390		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019697.1|457307_458654_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.9	2.1e-64
WP_000202178.1|458646_460119_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.1	1.4e-80
>prophage 32
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	467639	474209	2860390		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|467639_468977_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159866.1|468969_469200_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183386.1|469177_470059_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	5.8e-10
WP_001124985.1|470489_470942_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942216.1|470957_472637_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291540.1|472787_474209_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	6.6e-40
>prophage 33
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	481037	482444	2860390		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|481037_482444_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 34
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	489791	491276	2860390		Cyanophage(100.0%)	1	NA	NA
WP_160325447.1|489791_491276_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 35
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	496940	586301	2860390	protease,tRNA,head,terminase,holin,portal,integrase,plate,tail,capsid	Staphylococcus_phage(80.26%)	106	506234:506262	550494:550522
WP_000447733.1|496940_497828_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183424.1|497905_498412_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273367.1|498503_499235_+	segregation and condensation protein A	NA	NA	NA	NA	NA
WP_000368652.1|499227_499770_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|499762_500500_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|500632_501358_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987777.1|501338_503090_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
WP_001574168.1|503341_504274_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001794062.1|504260_506303_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	44.1	1.1e-38
506234:506262	attL	ACCATCTCATTATGATGATATGTTTATTT	NA	NA	NA	NA
WP_160325448.1|506345_507551_-|integrase	site-specific integrase	integrase	A0A2I6PEN0	Staphylococcus_phage	99.8	2.9e-222
WP_000191466.1|507676_508291_+	hypothetical protein	NA	A0A2I6PEZ0	Staphylococcus_phage	100.0	6.7e-106
WP_001795334.1|508287_508434_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	100.0	1.2e-16
WP_000705240.1|508470_508653_-	hypothetical protein	NA	A0A2I6PDR4	Staphylococcus_phage	100.0	5.3e-27
WP_000348133.1|508748_509669_-	exonuclease	NA	B5WZL1	Staphylococcus_phage	100.0	2.5e-173
WP_000801423.1|509684_510299_-	helix-turn-helix domain-containing protein	NA	B5WZL2	Staphylococcus_phage	100.0	9.0e-111
WP_160325449.1|510470_510698_+	BetR domain protein	NA	B5WZL3	Staphylococcus_phage	98.7	1.2e-33
WP_001001383.1|511294_511513_+	hypothetical protein	NA	B5WZL5	Staphylococcus_phage	100.0	7.8e-33
WP_001025401.1|511562_511808_+	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
WP_001128433.1|511776_512142_-	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	100.0	2.4e-63
WP_001097552.1|512196_512412_+	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	100.0	1.9e-31
WP_001124157.1|512436_512700_+	helix-turn-helix domain-containing protein	NA	A7TWG0	Staphylococcus_phage	98.9	6.3e-45
WP_001285954.1|512712_512874_+	DUF1270 domain-containing protein	NA	A7TWM3	Staphylococcus_phage	100.0	8.6e-21
WP_000174998.1|512952_513276_+	hypothetical protein	NA	A0A2I6PE70	Staphylococcus_phage	100.0	6.5e-52
WP_000985972.1|513290_513653_+	hypothetical protein	NA	B5WZM2	Staphylococcus_phage	100.0	8.3e-56
WP_000762530.1|513649_514816_+	DUF2800 domain-containing protein	NA	B5WZM3	Staphylococcus_phage	100.0	8.3e-222
WP_000645048.1|514841_515399_+	DUF2815 family protein	NA	A0A2I6PEP8	Staphylococcus_phage	100.0	1.8e-97
WP_160325450.1|515466_517419_+	DNA polymerase	NA	A0A2I6PE86	Staphylococcus_phage	99.8	0.0e+00
WP_001164629.1|517431_517617_+	DUF3113 family protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
WP_000113974.1|517616_518018_+	PVL family protein	NA	A0A2I6PEL5	Staphylococcus_phage	100.0	1.2e-68
WP_000022730.1|518017_518275_+	DUF3310 domain-containing protein	NA	A0A2I6PEN5	Staphylococcus_phage	98.8	1.3e-42
WP_000235324.1|518277_518478_+	hypothetical protein	NA	A0A2I6PEM3	Staphylococcus_phage	100.0	2.5e-30
WP_000132193.1|518492_518735_+	hypothetical protein	NA	A0A2D1G5G2	Staphylococcus_phage	98.8	5.6e-40
WP_001065110.1|518749_519001_+	DUF1024 family protein	NA	W5R8J0	Staphylococcus_phage	100.0	4.9e-39
WP_000028425.1|518990_519173_+	hypothetical protein	NA	D2JGL7	Staphylococcus_phage	100.0	2.6e-26
WP_000185703.1|519165_519702_+	hypothetical protein	NA	S4V978	Staphylococcus_phage	98.9	1.0e-94
WP_000195806.1|519738_519975_+	DUF1381 domain-containing protein	NA	C8CH06	Staphylococcus_phage	98.7	3.1e-35
WP_000483477.1|519999_520236_+	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
WP_000595237.1|520228_520381_+	transcriptional activator RinB	NA	B5WZN3	Staphylococcus_phage	100.0	2.6e-19
WP_000265258.1|520448_520649_+	DUF1514 domain-containing protein	NA	A0A2I6PF41	Staphylococcus_phage	100.0	2.9e-26
WP_000884879.1|520701_523149_+	hypothetical protein	NA	B5WZN5	Staphylococcus_phage	99.9	0.0e+00
WP_015978074.1|523251_523356_-	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	2.7e-12
WP_000665205.1|523489_523780_+	VRR-NUC domain-containing protein	NA	U5U7A3	Staphylococcus_phage	100.0	4.9e-51
WP_001793488.1|523760_525128_+	DEAD/DEAH box helicase	NA	A0A2I6PE95	Staphylococcus_phage	100.0	1.7e-263
WP_000528514.1|525140_525578_+	transcriptional regulator	NA	B5WZN8	Staphylococcus_phage	100.0	2.7e-77
WP_000160689.1|525734_526049_+	HNH endonuclease	NA	A0A2I6PDC4	Staphylococcus_phage	100.0	2.5e-56
WP_000778933.1|526177_526483_+|terminase	terminase	terminase	A0A2I6PEQ6	Staphylococcus_phage	100.0	2.9e-49
WP_000153541.1|526472_528164_+|terminase	terminase large subunit	terminase	A0A2I6PE44	Staphylococcus_phage	99.8	0.0e+00
WP_001100670.1|528168_529407_+|portal	phage portal protein	portal	A0A2I6PEA6	Staphylococcus_phage	100.0	6.9e-235
WP_000061866.1|529390_530164_+|protease	Clp protease ClpP	protease	A0A2I6PEQ7	Staphylococcus_phage	100.0	2.4e-137
WP_001142734.1|530175_531339_+|capsid	phage major capsid protein	capsid	A0A2I6PEQ3	Staphylococcus_phage	100.0	1.2e-217
WP_000050973.1|531407_531686_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_000395502.1|531697_532030_+	hypothetical protein	NA	A0A2I6PEA5	Staphylococcus_phage	100.0	3.1e-57
WP_000110023.1|532026_532428_+	hypothetical protein	NA	A0A2I6PF54	Staphylococcus_phage	100.0	8.1e-68
WP_001023806.1|532428_532824_+	DUF3168 domain-containing protein	NA	A0A2I6PEQ4	Staphylococcus_phage	100.0	8.8e-67
WP_000807536.1|532858_533500_+|tail	tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	100.0	5.9e-121
WP_000169127.1|533591_534047_+	Ig domain-containing protein	NA	A0A2I6PER6	Staphylococcus_phage	100.0	5.7e-78
WP_000589167.1|534104_534455_+	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
WP_000438833.1|534496_534655_+	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_001003420.1|534668_540869_+|tail	phage tail tape measure protein	tail	U5U762	Staphylococcus_phage	99.6	0.0e+00
WP_001190533.1|540868_541693_+|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
WP_000384474.1|541701_543285_+	peptidase	NA	A0A2I6PEQ5	Staphylococcus_phage	100.0	9.3e-309
WP_000179858.1|543284_543575_+	hypothetical protein	NA	U5U457	Staphylococcus_phage	100.0	2.1e-49
WP_000429558.1|543590_545501_+	minor structural protein	NA	A0A2I6PEQ9	Staphylococcus_phage	100.0	0.0e+00
WP_000067132.1|545500_546967_+|plate	BppU family phage baseplate upper protein	plate	B5WZQ8	Staphylococcus_phage	100.0	7.6e-257
WP_001166599.1|546966_547356_+	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
WP_000916020.1|547348_547513_+	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_000466784.1|547558_547858_+	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_000339141.1|547993_548296_+|holin	phage holin	holin	A0A2I6PF56	Staphylococcus_phage	100.0	3.1e-48
WP_000909205.1|548306_549761_+	CHAP domain-containing protein	NA	A0A2I6PF47	Staphylococcus_phage	99.6	2.8e-288
WP_000209712.1|550482_550698_+	hypothetical protein	NA	A0ZS61	Staphylococcus_virus	100.0	2.0e-25
550494:550522	attR	ACCATCTCATTATGATGATATGTTTATTT	NA	NA	NA	NA
WP_000913238.1|550787_551693_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000476878.1|551750_552659_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001799520.1|552863_553028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186908.1|553306_553852_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_001151997.1|553957_554206_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163814.1|554313_555267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902107.1|555256_556636_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.3	2.9e-56
WP_000069298.1|556788_558249_+	elastin-binding protein EbpS	NA	NA	NA	NA	NA
WP_016186859.1|558386_558473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001174260.1|558633_559620_+	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_000681744.1|559734_560703_-	asparaginase	NA	NA	NA	NA	NA
WP_000644393.1|560779_561439_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001791200.1|561469_561586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791199.1|561702_561894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133953.1|562150_563326_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000165530.1|563547_564858_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_000161753.1|564874_565873_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001043863.1|566043_566316_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|566746_567319_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774679.1|567321_568047_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001819897.1|568063_569008_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|569099_569549_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_001269937.1|570017_571184_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	1.5e-34
WP_000776318.1|571209_572274_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_000245891.1|572283_573582_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000389521.1|573588_574833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005208.1|574846_575422_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	4.6e-08
WP_000154479.1|575411_575999_+	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_001827022.1|576070_576751_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000839927.1|577086_577404_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000690024.1|577647_578790_+	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_000361536.1|578794_579997_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	42.5	1.4e-35
WP_000049917.1|579983_580955_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525060.1|580978_583672_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858795.1|583993_585286_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	4.3e-54
WP_000362222.1|585614_586301_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
>prophage 36
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	589992	590619	2860390		Bacillus_phage(100.0%)	1	NA	NA
WP_001108885.1|589992_590619_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 37
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	600083	600962	2860390		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|600083_600962_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 38
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	639554	650011	2860390	transposase	Staphylococcus_phage(50.0%)	14	NA	NA
WP_000282169.1|639554_640259_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.3	1.9e-11
WP_001814377.1|640503_640698_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001165814.1|640709_640961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404628.1|640998_642123_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995290.1|642138_642576_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934885.1|642999_643956_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|644155_644635_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166055.1|644649_645489_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	5.1e-48
WP_000159899.1|645574_646108_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|646100_646529_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473654.1|646540_647041_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|647040_647262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|647334_648282_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000342154.1|648520_650011_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	1.7e-22
>prophage 39
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	653419	655431	2860390		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|653419_654079_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166793.1|654075_655431_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 40
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	661799	662591	2860390		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|661799_662591_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 41
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	666126	671152	2860390	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138413.1|666126_667263_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001794103.1|667294_667924_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|667942_668212_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|668373_668682_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|668852_669053_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876206.1|669249_669651_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216956.1|669886_671152_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.0	4.0e-12
>prophage 42
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	678994	680596	2860390		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|678994_680596_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 43
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	685021	688475	2860390		Indivirus(50.0%)	3	NA	NA
WP_000079448.1|685021_685873_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.8e-16
WP_000974850.1|685879_686521_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077549.1|686660_688475_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.3	2.3e-154
>prophage 44
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	691889	692591	2860390		Tupanvirus(100.0%)	1	NA	NA
WP_000571257.1|691889_692591_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	29.2	6.9e-14
>prophage 45
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	700072	702425	2860390		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000153717.1|700072_700855_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.7	1.2e-27
WP_000604802.1|701858_702425_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	31.8	1.7e-23
>prophage 46
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	706743	710309	2860390	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_000283027.1|706743_708006_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	1.7e-95
WP_001123276.1|708153_708339_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_000277709.1|708662_710309_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
>prophage 47
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	719578	723972	2860390		Bacillus_phage(50.0%)	2	NA	NA
WP_001289586.1|719578_721981_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	1.1e-92
WP_001574370.1|721980_723972_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 48
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	729589	731236	2860390		Vibrio_phage(100.0%)	1	NA	NA
WP_001088983.1|729589_731236_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.5	1.9e-22
>prophage 49
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	734905	736027	2860390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691309.1|734905_736027_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.1	2.1e-09
>prophage 50
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	740176	745832	2860390		Phage_Wrath(25.0%)	7	NA	NA
WP_001208760.1|740176_740800_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
WP_000380738.1|741179_742043_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	1.2e-15
WP_001791425.1|742116_742221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688127.1|742217_743195_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085657.1|743351_743621_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|744074_744224_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000089857.1|744314_745832_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.8	2.7e-92
>prophage 51
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	755968	760244	2860390		Bacillus_phage(50.0%)	6	NA	NA
WP_000841344.1|755968_756502_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|756640_756829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000624452.1|756941_757544_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670311.1|757540_758632_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603961.1|758635_759367_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001794121.1|759335_760244_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	9.8e-21
>prophage 52
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	764198	764534	2860390	head	Staphylococcus_phage(100.0%)	1	NA	NA
WP_077670291.1|764198_764534_-|head	phage head morphogenesis protein	head	A0A1J0MFV1	Staphylococcus_phage	60.4	2.6e-27
>prophage 53
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	768471	775071	2860390	transposase,capsid	Staphylococcus_phage(80.0%)	7	NA	NA
WP_077670290.1|768471_769137_-|capsid	phage capsid protein	capsid	A0A1J0MF61	Staphylococcus_phage	53.0	4.6e-60
WP_160325457.1|769197_769449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477487.1|770969_771386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121213.1|771812_772760_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	99.7	1.6e-183
WP_000006110.1|772971_773157_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_001002343.1|774361_774568_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
WP_001071312.1|774858_775071_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	3.6e-19
>prophage 54
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	782454	789328	2860390	transposase	Staphylococcus_phage(50.0%)	8	NA	NA
WP_001251205.1|782454_783813_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	29.9	4.0e-42
WP_000681139.1|783817_785665_+	membrane protein	NA	NA	NA	NA	NA
WP_000247474.1|785654_786701_+	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	36.9	8.1e-19
WP_000810443.1|786707_787298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001255381.1|787353_787710_+	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_000746372.1|787818_788322_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078367270.1|788302_788839_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	1.3e-28
WP_001659797.1|789130_789328_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
>prophage 55
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	794399	794876	2860390		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|794399_794876_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 56
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	800819	807301	2860390		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103747.1|800819_801638_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	3.1e-26
WP_001077635.1|802112_802655_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516249.1|802660_804670_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.2	4.1e-59
WP_000073334.1|804682_807301_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	3.8e-41
>prophage 57
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	816715	817759	2860390		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|816715_817759_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 58
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	821958	827502	2860390		Bacillus_virus(33.33%)	4	NA	NA
WP_000664777.1|821958_823245_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
WP_000089941.1|823244_824510_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_001293307.1|824540_825254_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042907377.1|825258_827502_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 59
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	832642	844457	2860390	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864182.1|832642_833614_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282296.1|833628_834546_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|834715_835066_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043642.1|835452_837570_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020856.1|837574_837892_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|837888_838173_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097463.1|838193_839369_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036631.1|839389_839857_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000139497.1|840146_844457_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 60
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	848730	849501	2860390		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|848730_849501_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 61
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	854275	861139	2860390	protease,tRNA	Erwinia_phage(33.33%)	5	NA	NA
WP_000379051.1|854275_855679_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	6.4e-27
WP_000072681.1|855744_856290_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015609.1|856286_857183_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	6.1e-31
WP_000195263.1|857600_858908_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001557331.1|859063_861139_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
>prophage 62
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	864973	867946	2860390		Tupanvirus(50.0%)	3	NA	NA
WP_000110252.1|864973_865882_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	2.3e-17
WP_001020801.1|865903_867070_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176401.1|867178_867946_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 63
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	881330	883451	2860390		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|881330_882062_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|882177_882411_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|882716_883451_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 64
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	893821	895816	2860390		Moumouvirus(100.0%)	1	NA	NA
WP_000579564.1|893821_895816_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 65
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	898963	899899	2860390	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|898963_899899_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 66
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	904908	907165	2860390		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|904908_906108_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|906323_906542_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368225.1|906541_907165_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	6.1e-22
>prophage 67
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	910479	911091	2860390		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|910479_911091_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 68
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	915058	919669	2860390		Halovirus(33.33%)	4	NA	NA
WP_001190910.1|915058_916159_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	9.6e-63
WP_000767018.1|916160_917435_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|917452_918334_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178615.1|918361_919669_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 69
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	924600	927354	2860390	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384706.1|924600_927354_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	2.1e-90
>prophage 70
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	946710	946908	2860390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245800.1|946710_946908_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	1.2e-19
>prophage 71
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	955819	957995	2860390	transposase	Staphylococcus_virus(100.0%)	2	NA	NA
WP_000277709.1|955819_957466_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
WP_001801391.1|957767_957995_-	hypothetical protein	NA	Q4ZBW5	Staphylococcus_virus	67.7	1.9e-18
>prophage 72
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	961455	961806	2860390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000669541.1|961455_961806_-	complement inhibitor SCIN-C	NA	A7TWS0	Staphylococcus_phage	50.0	1.9e-20
>prophage 73
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	973240	977798	2860390		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|973240_973555_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249264.1|973727_976076_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
WP_000161937.1|976085_977798_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
>prophage 74
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	982676	983735	2860390	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|982676_983735_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 75
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	995714	998625	2860390		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|995714_996197_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263793.1|996198_996741_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|996810_997200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|997202_997457_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757584.1|997695_998625_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	6.5e-12
>prophage 76
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1020266	1023909	2860390		Mycoplasma_phage(50.0%)	4	NA	NA
WP_000433551.1|1020266_1021361_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020627.1|1021373_1021913_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000455584.1|1022056_1022332_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|1022502_1023909_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
>prophage 77
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1028550	1029102	2860390		Synechococcus_phage(100.0%)	1	NA	NA
WP_000957036.1|1028550_1029102_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 78
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1035216	1039596	2860390		Bacillus_virus(50.0%)	5	NA	NA
WP_001289622.1|1035216_1035450_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	1.3e-09
WP_000040041.1|1035686_1037405_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|1037407_1037674_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505964.1|1037827_1038370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685075.1|1038423_1039596_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.6	1.5e-74
>prophage 79
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1042775	1057538	2860390		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921981.1|1042775_1044176_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.4e-10
WP_000273254.1|1044168_1044975_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101912.1|1045242_1046490_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709288.1|1046511_1047990_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	9.2e-77
WP_000238673.1|1048004_1048571_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
WP_000030814.1|1048573_1049602_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	7.6e-62
WP_000483716.1|1049594_1051079_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.4	8.5e-46
WP_000032734.1|1051057_1053247_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.2	5.1e-140
WP_000666808.1|1053239_1053911_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000848351.1|1053912_1054176_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174050.1|1054175_1054880_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.6	7.3e-48
WP_001010391.1|1054883_1056008_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_160325465.1|1055994_1056477_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	1.0e-21
WP_000225845.1|1056677_1057538_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	1.2e-39
>prophage 80
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1067717	1071491	2860390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001074519.1|1067717_1071491_+	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	38.0	1.1e-54
>prophage 81
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1075157	1105513	2860390	bacteriocin,protease,holin	Staphylococcus_phage(16.67%)	32	NA	NA
WP_160325467.1|1075157_1076240_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	31.7	1.5e-15
WP_001088791.1|1076321_1077503_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_000284455.1|1077540_1077870_+	staphostatin B	NA	NA	NA	NA	NA
WP_000184947.1|1078105_1078927_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150205.1|1078919_1079723_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000526678.1|1079709_1081383_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_001814117.1|1081369_1082581_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_072357920.1|1082684_1082762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070967.1|1082912_1083851_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000620943.1|1083902_1084454_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001794164.1|1084543_1084834_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	2.6e-07
WP_001794249.1|1084897_1085029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081338.1|1085075_1086035_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766009.1|1086525_1086882_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000719183.1|1086970_1088452_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000410718.1|1088457_1088745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791476.1|1089085_1089376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571191.1|1089463_1090105_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	5.0e-19
WP_000873929.1|1090101_1090422_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000870819.1|1090424_1092389_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_001794574.1|1092432_1092705_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_001790623.1|1092714_1092816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119695.1|1093354_1093432_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_001033867.1|1093732_1094335_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000214898.1|1094349_1094526_-	YkvS family protein	NA	NA	NA	NA	NA
WP_000876825.1|1095791_1096010_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000287265.1|1096219_1096789_+	competence protein ComK	NA	NA	NA	NA	NA
WP_000414169.1|1097277_1098789_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000021872.1|1098927_1100286_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_001794169.1|1100302_1102627_-|protease	serine protease	protease	W5SAB9	Pithovirus	26.8	4.0e-10
WP_000928413.1|1102845_1103649_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049957.1|1103950_1105513_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
>prophage 82
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1126733	1128542	2860390		Streptococcus_phage(100.0%)	1	NA	NA
WP_160325470.1|1126733_1128542_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	4.2e-47
>prophage 83
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1132492	1146258	2860390	transposase	Bacillus_virus(28.57%)	11	NA	NA
WP_001794171.1|1132492_1134139_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.4	1.7e-289
WP_094409958.1|1134434_1136001_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_001180271.1|1136090_1136972_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001574526.1|1136983_1137634_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000427776.1|1137626_1138607_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_160325471.1|1138609_1139596_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.4	3.6e-16
WP_000121211.1|1141153_1142101_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000517177.1|1142092_1142359_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160325472.1|1142570_1144226_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000786746.1|1144244_1145186_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	9.3e-06
WP_000140043.1|1145175_1146258_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	2.4e-18
>prophage 84
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1154852	1161663	2860390		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619360.1|1154852_1155998_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047061.1|1156108_1156978_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353950.1|1157036_1159646_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044234.1|1159848_1161663_-	O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	8.8e-37
>prophage 85
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1164928	1172388	2860390	transposase	Staphylococcus_virus(50.0%)	4	NA	NA
WP_000277708.1|1164928_1166575_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	4.1e-291
WP_000902813.1|1166951_1167341_-	YisL family protein	NA	NA	NA	NA	NA
WP_000670753.1|1167666_1168569_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000154949.1|1168734_1172388_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
>prophage 86
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1182543	1189537	2860390		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185311.1|1182543_1183473_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.5	1.8e-38
WP_000138487.1|1183811_1185056_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000167321.1|1185164_1186355_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.0	1.3e-33
WP_000838047.1|1186662_1187790_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1188151_1188529_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1188943_1189537_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 87
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1199471	1203099	2860390		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009683.1|1199471_1200947_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	1.2e-47
WP_000046076.1|1201077_1202286_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143497.1|1202739_1203099_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 88
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1207142	1209811	2860390		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1207142_1208357_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129645.1|1208353_1209811_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	4.4e-39
>prophage 89
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1223022	1226545	2860390		environmental_halophage(50.0%)	3	NA	NA
WP_000807671.1|1223022_1224264_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.1e-110
WP_000205572.1|1224378_1225686_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1225783_1226545_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 90
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1230493	1231519	2860390		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571209.1|1230493_1231519_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.2e-28
>prophage 91
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1234628	1239806	2860390		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1234628_1234985_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147955.1|1235128_1235449_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1235598_1236138_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150036.1|1236220_1236937_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.7	6.8e-17
WP_160325475.1|1237084_1237507_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1237905_1238400_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255545.1|1238555_1239173_+	amino acid transporter	NA	NA	NA	NA	NA
WP_016187137.1|1239245_1239806_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	3.8e-31
>prophage 92
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1243211	1244455	2860390		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1243211_1243412_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001574556.1|1243768_1244455_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 93
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1253929	1262687	2860390		Staphylococcus_phage(50.0%)	8	NA	NA
WP_001574560.1|1253929_1254658_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	4.8e-18
WP_000999096.1|1254945_1255560_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_001085185.1|1256525_1256990_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_001050041.1|1257011_1259384_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	1.9e-92
WP_001165967.1|1259417_1260158_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000556760.1|1260286_1260520_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785248.1|1260586_1261045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1261382_1262687_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 94
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1273375	1279191	2860390		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1273375_1273963_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1274531_1275476_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1275584_1276580_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369719.1|1276576_1277488_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134960.1|1278255_1279191_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	8.4e-84
>prophage 95
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1283588	1286435	2860390		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662687.1|1283588_1286435_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 96
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1289753	1290593	2860390		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_160325476.1|1289753_1290593_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 97
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1297031	1302736	2860390		Streptococcus_phage(66.67%)	5	NA	NA
WP_000370984.1|1297031_1298114_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.8	1.2e-44
WP_000686342.1|1298477_1299344_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192947.1|1299487_1300129_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
WP_000258151.1|1300292_1301348_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1301665_1302736_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 98
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1312013	1334984	2860390		uncultured_Caudovirales_phage(35.71%)	18	NA	NA
WP_000616865.1|1312013_1312775_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
WP_001245566.1|1312771_1313728_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
WP_000876311.1|1313714_1314686_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	80.2	7.8e-141
WP_000562498.1|1315062_1316034_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1316153_1318259_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1318221_1318620_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068491.1|1319421_1320288_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930016.1|1320307_1320808_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
WP_000193750.1|1321147_1322653_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031788440.1|1322730_1322832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429002.1|1322922_1323840_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	8.2e-07
WP_000197262.1|1324391_1324934_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663016.1|1325092_1326151_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.5	5.7e-20
WP_000180987.1|1326390_1327905_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589241.1|1327897_1328875_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.1e-25
WP_000983677.1|1329095_1330877_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525101.1|1330888_1332772_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	8.8e-56
WP_000098285.1|1333043_1334984_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 99
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1338123	1347969	2860390		Pandoravirus(12.5%)	12	NA	NA
WP_001217804.1|1338123_1339275_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
WP_000604508.1|1339258_1339852_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
WP_000446724.1|1340202_1340871_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1340872_1341292_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062968.1|1341295_1342009_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000637686.1|1342107_1342692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093552.1|1342971_1343412_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1343753_1344227_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1344201_1344888_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244416.1|1344887_1345943_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702776.1|1346014_1346998_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.0	7.3e-62
WP_000931237.1|1347129_1347969_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
>prophage 100
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1355131	1405642	2860390	bacteriocin,transposase,tRNA	Staphylococcus_phage(31.25%)	53	NA	NA
WP_001107240.1|1355131_1355614_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_000216727.1|1355787_1356240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041284.1|1356536_1357703_-	multidrug efflux MFS transporter NorA	NA	NA	NA	NA	NA
WP_000776010.1|1357912_1358335_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001191871.1|1358521_1359139_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_000154465.1|1359135_1359420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952030.1|1359574_1360948_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	1.2e-46
WP_000005632.1|1361033_1362587_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_000180420.1|1362869_1363157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435104.1|1363191_1364100_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_000794424.1|1364202_1365129_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001283444.1|1365355_1365799_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000857616.1|1365925_1367599_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	24.2	2.0e-11
WP_000737163.1|1367595_1369227_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	28.2	2.3e-12
WP_000469883.1|1369445_1370321_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358501.1|1370492_1371176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148821.1|1371178_1371637_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1371638_1372205_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
WP_000638614.1|1372299_1372842_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000545116.1|1372921_1373221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000733427.1|1373358_1373748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259673.1|1373814_1374258_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000842865.1|1374384_1375074_+	DUF1129 family protein	NA	NA	NA	NA	NA
WP_001105942.1|1375736_1376411_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
WP_000361064.1|1376505_1376883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159128.1|1377120_1377486_+	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	47.8	8.5e-24
WP_000378396.1|1377478_1379659_+	cadmium-translocating P-type ATPase CadA	NA	E4ZFI9	Streptococcus_phage	63.7	9.3e-251
WP_160200137.1|1380021_1381668_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.2	1.7e-289
WP_000277154.1|1381734_1383168_-	multi-copper oxidase Mco	NA	NA	NA	NA	NA
WP_000069452.1|1383182_1385228_-	copper-translocating P-type ATPase CopB	NA	E4ZFI9	Streptococcus_phage	29.2	2.3e-65
WP_000690626.1|1385494_1386070_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	2.9e-42
WP_000838599.1|1386404_1387400_-	YeiH family protein	NA	NA	NA	NA	NA
WP_000377738.1|1387524_1388346_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791613.1|1388647_1388740_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000397995.1|1388968_1389292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998976.1|1390508_1390934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843733.1|1391723_1392467_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_001002795.1|1393016_1393112_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000761344.1|1393326_1393668_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000145511.1|1393754_1394615_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000273007.1|1394980_1395481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001582045.1|1395547_1395874_-	recombinase	NA	NA	NA	NA	NA
WP_001643491.1|1395813_1396191_-	recombinase	NA	NA	NA	NA	NA
WP_000277709.1|1396345_1397992_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
WP_000593106.1|1398353_1398980_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.1e-22
WP_000831610.1|1398991_1399303_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000713732.1|1399306_1401241_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000726502.1|1401315_1401609_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000358995.1|1401988_1402384_-	thioredoxin-dependent arsenate reductase	NA	A0A2H4PQT9	Staphylococcus_phage	86.3	8.5e-62
WP_000153633.1|1402401_1403691_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	81.1	5.6e-187
WP_000120605.1|1403690_1404005_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4PQT4	Staphylococcus_phage	73.1	4.7e-39
WP_001035802.1|1404720_1404933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105942.1|1404967_1405642_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
>prophage 101
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1410946	1411420	2860390		Pandoravirus(100.0%)	1	NA	NA
WP_000833480.1|1410946_1411420_-	cupin	NA	A0A291AU44	Pandoravirus	38.7	4.6e-14
>prophage 102
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1416669	1417467	2860390		Lactobacillus_virus(100.0%)	1	NA	NA
WP_000731642.1|1416669_1417467_+	LysM peptidoglycan-binding domain-containing protein	NA	C1KFN7	Lactobacillus_virus	35.8	2.1e-06
>prophage 103
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1422188	1422950	2860390		Planktothrix_phage(100.0%)	1	NA	NA
WP_000153733.1|1422188_1422950_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.2e-33
>prophage 104
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1427316	1428360	2860390		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_001030763.1|1427316_1428360_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.1	3.8e-16
>prophage 105
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1434882	1435680	2860390		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1434882_1435680_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 106
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1438907	1442866	2860390		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1438907_1440635_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793055.1|1441055_1442351_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1442467_1442866_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 107
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1449799	1450543	2860390		Indivirus(100.0%)	1	NA	NA
WP_000894458.1|1449799_1450543_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-12
>prophage 108
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1463408	1463969	2860390	integrase	Streptococcus_phage(100.0%)	1	1457562:1457576	1467551:1467565
1457562:1457576	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044966.1|1463408_1463969_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
WP_001044966.1|1463408_1463969_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
1467551:1467565	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 109
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1477066	1480420	2860390		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1477066_1478077_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1478575_1479097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180233.1|1479124_1480420_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 110
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1487951	1489274	2860390		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860607.1|1487951_1489274_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	8.2e-109
>prophage 111
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1500578	1501235	2860390		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455258.1|1500578_1501235_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	6.4e-46
>prophage 112
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1504902	1508224	2860390		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000382588.1|1504902_1506279_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	6.7e-21
WP_000347064.1|1506823_1508224_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.0	9.4e-55
>prophage 113
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1531711	1532374	2860390		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|1531711_1532374_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 114
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1538962	1540150	2860390		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250820.1|1538962_1540150_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	1.5e-45
>prophage 115
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1543177	1554131	2860390		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1543177_1545259_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1545381_1545852_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1545917_1546331_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1546428_1546683_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001819727.1|1546819_1550416_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	4.3e-67
WP_000918664.1|1550579_1554131_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	6.1e-50
>prophage 116
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1557814	1562597	2860390	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1557814_1558363_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1558375_1558558_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001791441.1|1558613_1558757_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872867.1|1558871_1559441_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664740.1|1559521_1560046_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1560045_1560792_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370181.1|1560799_1561204_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631982.1|1561196_1562597_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	2.5e-55
>prophage 117
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1568608	1571065	2860390	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_160325484.1|1568608_1571065_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	40.8	6.1e-134
>prophage 118
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1590147	1600605	2860390	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1590147_1591635_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_016186812.1|1591687_1591780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613720.1|1592173_1592650_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154303.1|1592646_1593012_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167936.1|1592989_1593793_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	6.7e-21
WP_000057594.1|1594008_1594941_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1595119_1596001_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1596414_1598508_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1598765_1599305_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176721.1|1599309_1600605_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.3	8.2e-13
>prophage 119
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1609861	1612326	2860390		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1609861_1610827_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252515.1|1610973_1612326_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	1.1e-23
>prophage 120
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1618210	1621308	2860390	tRNA	Hokovirus(50.0%)	2	NA	NA
WP_001051120.1|1618210_1620184_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.6	3.2e-93
WP_000279925.1|1620468_1621308_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 121
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1625214	1625832	2860390		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1625214_1625832_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 122
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1634675	1636373	2860390		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109044.1|1634675_1636373_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 123
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1653010	1659247	2860390		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170274.1|1653010_1654015_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.1	1.4e-23
WP_000825534.1|1654348_1655191_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467992.1|1655227_1655887_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569267.1|1655890_1656916_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	1.4e-31
WP_001036658.1|1657206_1658349_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_000634110.1|1658341_1659247_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.4	7.2e-48
>prophage 124
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1682783	1685565	2860390		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072632.1|1682783_1684016_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	2.7e-45
WP_000028598.1|1684008_1685565_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.5	1.7e-286
>prophage 125
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1697052	1697379	2860390	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001799349.1|1697052_1697379_+|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	85.4	4.3e-11
>prophage 126
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1700686	1703719	2860390		Hokovirus(50.0%)	2	NA	NA
WP_000424963.1|1700686_1702228_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1702252_1703719_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 127
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1712819	1714343	2860390		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930503.1|1712819_1714343_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.2	5.5e-40
>prophage 128
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1723526	1744530	2860390	integrase,coat,terminase	Staphylococcus_phage(80.95%)	29	1722803:1722820	1737903:1737920
1722803:1722820	attL	ATATTATTGTTCTTCTTT	NA	NA	NA	NA
WP_000813311.1|1723526_1724039_-	hypothetical protein	NA	Q4ZE83	Staphylococcus_phage	100.0	1.4e-69
WP_073392942.1|1724156_1724594_-	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	58.2	9.8e-27
WP_000801980.1|1724735_1725704_-	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	2.7e-24
WP_001293071.1|1725980_1726550_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	4.6e-101
WP_001656917.1|1726546_1726759_-	hypothetical protein	NA	Q4ZE86	Staphylococcus_phage	97.1	5.4e-31
WP_000771361.1|1726890_1727418_-|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	100.0	6.8e-91
WP_000214170.1|1727470_1728124_-	hypothetical protein	NA	Q4ZE82	Staphylococcus_phage	99.5	7.6e-116
WP_001288442.1|1728154_1728499_-	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	91.7	1.3e-50
WP_001019762.1|1729206_1729848_-	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	92.5	4.7e-110
WP_000356942.1|1729844_1730225_-	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	96.8	1.7e-67
WP_000447468.1|1730533_1732243_-	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	92.8	8.2e-303
WP_001002709.1|1732256_1733126_-	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	96.2	5.3e-165
WP_001103967.1|1733190_1733517_-	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	96.3	3.5e-53
WP_001231376.1|1733902_1734106_-	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	98.5	2.0e-30
WP_000784892.1|1734072_1734246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138305.1|1734257_1734530_-	winged helix-turn-helix domain-containing protein	NA	Q4ZE77	Staphylococcus_phage	94.4	1.2e-43
WP_001611932.1|1734530_1734695_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000230361.1|1734843_1735467_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000270135.1|1735627_1736842_+|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	97.3	3.3e-221
WP_000400841.1|1736954_1737674_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q4ZE81	Staphylococcus_phage	29.8	3.7e-23
WP_000897044.1|1737905_1738148_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
1737903:1737920	attR	ATATTATTGTTCTTCTTT	NA	NA	NA	NA
WP_000934799.1|1738199_1738703_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1738723_1739020_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1739263_1739455_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1739540_1740638_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1740649_1740853_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373076.1|1740882_1741764_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001573568.1|1741917_1742763_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655687.1|1743426_1744530_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 129
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1754451	1755294	2860390		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209478.1|1754451_1755294_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.2	4.5e-12
>prophage 130
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1776704	1779439	2860390		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280814.1|1776704_1777727_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.1	6.7e-10
WP_001191936.1|1777704_1778649_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_160325489.1|1778638_1779439_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.9	4.4e-41
>prophage 131
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1797676	1798354	2860390		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911024.1|1797676_1798354_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.2e-31
>prophage 132
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1812392	1816841	2860390		Mycobacterium_phage(100.0%)	1	NA	NA
WP_160325493.1|1812392_1816841_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.6	1.1e-27
>prophage 133
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1827445	1829107	2860390		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000570080.1|1827445_1828105_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	5.8e-23
WP_000736790.1|1828156_1829107_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 134
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1837915	1839352	2860390		Pandoravirus(100.0%)	1	NA	NA
WP_000163995.1|1837915_1839352_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.0	1.3e-30
>prophage 135
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1845860	1850404	2860390		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925396.1|1845860_1847600_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	2.0e-62
WP_000608835.1|1847865_1848540_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975347.1|1848679_1850404_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 136
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1860273	1861317	2860390		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645611.1|1860273_1861317_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.6	6.0e-14
>prophage 137
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1868533	1870063	2860390		Vibrio_phage(100.0%)	1	NA	NA
WP_000838204.1|1868533_1870063_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 138
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1879748	1881254	2860390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008395.1|1879748_1881254_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 139
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1892215	1897574	2860390		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1892215_1894465_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837114.1|1895052_1896021_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127979.1|1896017_1897574_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 140
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1907885	1909944	2860390		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818914.1|1907885_1908983_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166911.1|1909365_1909944_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	43.0	1.6e-13
>prophage 141
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1917755	1919348	2860390		Planktothrix_phage(100.0%)	1	NA	NA
WP_000067363.1|1917755_1919348_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	5.4e-22
>prophage 142
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1935440	1936625	2860390		Klosneuvirus(100.0%)	1	NA	NA
WP_001084444.1|1935440_1936625_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.6	2.4e-35
>prophage 143
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1941473	1951757	2860390		Tupanvirus(50.0%)	3	NA	NA
WP_000605273.1|1941473_1948649_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.9	3.4e-68
WP_160325498.1|1949095_1950346_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706134.1|1950731_1951757_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 144
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1955293	1958292	2860390		Bacillus_virus(50.0%)	4	NA	NA
WP_000590840.1|1955293_1956034_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	6.5e-39
WP_000171926.1|1956375_1956888_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356967.1|1957067_1957271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013476.1|1957332_1958292_-	cation transporter	NA	A0A1V0SED0	Indivirus	33.6	2.8e-10
>prophage 145
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1961633	1964118	2860390		Catovirus(50.0%)	2	NA	NA
WP_000723445.1|1961633_1962779_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	3.2e-24
WP_000779509.1|1962855_1964118_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	2.5e-22
>prophage 146
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1971135	1977700	2860390		Catovirus(50.0%)	6	NA	NA
WP_000413167.1|1971135_1972260_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	3.9e-128
WP_001028294.1|1972263_1973373_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1973385_1974414_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940769.1|1974403_1976227_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.4	3.0e-29
WP_000565301.1|1976246_1977011_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037317.1|1977013_1977700_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	8.2e-28
>prophage 147
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1981723	1982899	2860390		Clostridium_phage(100.0%)	1	NA	NA
WP_000469818.1|1981723_1982899_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.9	5.2e-30
>prophage 148
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1988357	1989131	2860390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078278.1|1988357_1989131_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	6.4e-13
>prophage 149
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	1997017	1997617	2860390		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1997017_1997617_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 150
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2002551	2007646	2860390		Catovirus(50.0%)	5	NA	NA
WP_001793810.1|2002551_2003532_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.3	1.3e-47
WP_160325499.1|2003866_2004643_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414632.1|2004853_2005480_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|2005675_2006440_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223717.1|2006443_2007646_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.3	5.1e-09
>prophage 151
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2015912	2020122	2860390		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|2015912_2016893_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_160325501.1|2017123_2018116_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000925002.1|2018131_2019127_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136645.1|2019123_2020122_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.6e-14
>prophage 152
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2052144	2057479	2860390	transposase	Acidithiobacillus_phage(33.33%)	5	NA	NA
WP_000649665.1|2052144_2053845_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	26.8	4.1e-20
WP_001794509.1|2054134_2054509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|2054694_2055642_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000370465.1|2055646_2056162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088356251.1|2056349_2057479_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.0	6.4e-78
>prophage 153
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2063330	2073326	2860390		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2063330_2064131_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104171.1|2064518_2065307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060146.1|2065307_2066642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871610.1|2066634_2068461_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	2.1e-30
WP_000101976.1|2068473_2069175_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2070364_2071648_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2071925_2073326_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 154
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2080008	2089044	2860390	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884337.1|2080008_2081295_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177483.1|2081672_2083187_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	4.4e-90
WP_000449218.1|2083512_2084325_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819098.1|2084412_2087073_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.8	4.6e-119
WP_000255583.1|2087109_2089044_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	4.4e-143
>prophage 155
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2099131	2102431	2860390		Faecalibacterium_phage(33.33%)	5	NA	NA
WP_000742840.1|2099131_2099971_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.4	1.4e-05
WP_000491382.1|2100465_2100819_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|2100886_2101282_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054111.1|2101534_2102104_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	34.8	2.8e-05
WP_001059079.1|2102230_2102431_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
>prophage 156
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2108224	2108983	2860390		Planktothrix_phage(100.0%)	1	NA	NA
WP_000154162.1|2108224_2108983_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 157
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2126126	2127839	2860390		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138663.1|2126126_2127839_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	5.4e-20
>prophage 158
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2133467	2134481	2860390		Faustovirus(100.0%)	1	NA	NA
WP_000639198.1|2133467_2134481_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	22.2	8.2e-08
>prophage 159
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2146872	2147565	2860390		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185860.1|2146872_2147565_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 160
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2171440	2173300	2860390		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125631.1|2171440_2173300_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 161
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2198939	2200690	2860390		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143418.1|2198939_2199827_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	7.4e-05
WP_000923764.1|2199934_2200690_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.8e-31
>prophage 162
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2204127	2204625	2860390		Canarypox_virus(100.0%)	1	NA	NA
WP_001065267.1|2204127_2204625_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	2.4e-21
>prophage 163
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2209675	2212059	2860390		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071721.1|2209675_2211526_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.9	1.3e-234
WP_000173336.1|2211522_2212059_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	47.5	1.1e-40
>prophage 164
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2216935	2227046	2860390	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2216935_2218645_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2218922_2219135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028789.1|2219414_2219858_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172333.1|2220051_2221650_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.6	2.6e-77
WP_001793854.1|2221709_2221910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2222336_2223833_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031407.1|2224025_2224916_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237625.1|2225038_2225455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030061.1|2225708_2227046_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	6.7e-18
>prophage 165
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2255201	2258401	2860390		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751265.1|2255201_2255903_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.8	2.1e-39
WP_000379825.1|2256589_2258401_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 166
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2266840	2271226	2860390		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161364.1|2266840_2267839_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	2.6e-35
WP_000076662.1|2267928_2268135_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024137.1|2268817_2271226_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	2.9e-128
>prophage 167
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2280467	2283457	2860390	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001063330.1|2280467_2282573_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.5	6.9e-118
WP_000262597.1|2282935_2283457_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	2.4e-27
>prophage 168
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2289881	2296264	2860390		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062662.1|2289881_2291621_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
WP_000473682.1|2291920_2293987_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2294366_2294777_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240663.1|2294818_2295175_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228158.1|2295295_2296264_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	3.1e-12
>prophage 169
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2305088	2306081	2860390		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161541.1|2305088_2306081_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	9.7e-38
>prophage 170
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2315497	2316193	2860390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382892.1|2315497_2316193_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	2.0e-37
>prophage 171
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2334791	2341967	2860390		Bacillus_phage(66.67%)	6	NA	NA
WP_000721330.1|2334791_2335658_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	4.4e-79
WP_001573690.1|2335784_2336093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678764.1|2336236_2336503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001793882.1|2336786_2338595_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.5	1.0e-93
WP_000755954.1|2338711_2339104_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000088715.1|2339105_2341967_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	1.2e-27
>prophage 172
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2346410	2347106	2860390		Bacillus_phage(100.0%)	1	NA	NA
WP_000217452.1|2346410_2347106_+	oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	5.1e-09
>prophage 173
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2352782	2353601	2860390		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824929.1|2352782_2353601_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.8	1.9e-10
>prophage 174
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2361666	2363224	2860390		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173876.1|2361666_2362482_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	6.1e-14
WP_000590515.1|2362474_2363224_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 175
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2369457	2373884	2860390		Bacillus_phage(50.0%)	4	NA	NA
WP_000923514.1|2369457_2370120_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.5	2.2e-17
WP_000072154.1|2370112_2370889_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026190.1|2371282_2372470_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700902.1|2372531_2373884_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	3.0e-13
>prophage 176
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2377277	2378504	2860390		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000948990.1|2377277_2378504_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 177
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2396880	2398023	2860390		Streptococcus_phage(100.0%)	1	NA	NA
WP_001176855.1|2396880_2398023_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.9	2.6e-55
>prophage 178
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2401353	2404267	2860390	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000486505.1|2401353_2403087_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.5e-30
WP_000121211.1|2403319_2404267_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
>prophage 179
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2407622	2413376	2860390		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971554.1|2407622_2408738_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.9	7.1e-21
WP_000286868.1|2408748_2409441_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200947.1|2409451_2409919_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_001056917.1|2409970_2410948_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	2.4e-142
WP_000916697.1|2410949_2411897_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	2.1e-138
WP_000594516.1|2412446_2413376_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.4	1.5e-120
>prophage 180
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2421269	2422001	2860390		Bacillus_virus(100.0%)	1	NA	NA
WP_000615467.1|2421269_2422001_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	1.3e-23
>prophage 181
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2438865	2440425	2860390		Escherichia_phage(100.0%)	1	NA	NA
WP_000692650.1|2438865_2440425_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	3.4e-21
>prophage 182
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2451156	2452803	2860390	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_000277709.1|2451156_2452803_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
>prophage 183
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2463744	2464779	2860390		Bacillus_virus(100.0%)	1	NA	NA
WP_000655979.1|2463744_2464779_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	1.7e-16
>prophage 184
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2475242	2481799	2860390		Staphylococcus_phage(25.0%)	8	NA	NA
WP_160325509.1|2475242_2475971_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	5.1e-28
WP_000372857.1|2476104_2476668_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000793166.1|2476844_2477300_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_000977031.1|2477296_2477740_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000477322.1|2477902_2479276_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.3	1.1e-12
WP_000249492.1|2479268_2479943_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	44.7	8.0e-52
WP_000761409.1|2480078_2481134_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229922.1|2481133_2481799_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	7.2e-37
>prophage 185
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2485536	2486745	2860390		Salmonella_phage(100.0%)	1	NA	NA
WP_000999130.1|2485536_2486745_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.5	3.0e-33
>prophage 186
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2499401	2500301	2860390		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524842.1|2499401_2500301_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.7e-15
>prophage 187
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2507658	2508078	2860390		Bacillus_phage(100.0%)	1	NA	NA
WP_000920241.1|2507658_2508078_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	7.7e-37
>prophage 188
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2513769	2514651	2860390		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730056.1|2513769_2514651_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	1.7e-62
>prophage 189
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2522530	2523166	2860390		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285452.1|2522530_2523166_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.6	7.1e-10
>prophage 190
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2536170	2540323	2860390		Staphylococcus_phage(50.0%)	4	NA	NA
WP_072460394.1|2536170_2536809_+	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	47.4	4.5e-36
WP_000684154.1|2537303_2538428_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.6e-12
WP_000417008.1|2538519_2539473_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.2	5.8e-32
WP_000737700.1|2539831_2540323_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 191
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2544243	2545053	2860390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717395.1|2544243_2545053_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 192
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2564025	2564631	2860390		Pithovirus(100.0%)	1	NA	NA
WP_000913006.1|2564025_2564631_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 193
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2576598	2579766	2860390		Leptospira_phage(100.0%)	1	NA	NA
WP_000592290.1|2576598_2579766_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	4.3e-63
>prophage 194
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2602945	2606555	2860390	transposase	Paenibacillus_phage(33.33%)	3	NA	NA
WP_094409958.1|2602945_2604513_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000389651.1|2604888_2605698_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.8	1.4e-18
WP_000586768.1|2605694_2606555_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.4e-10
>prophage 195
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2609596	2618161	2860390		Mycobacterium_phage(33.33%)	8	NA	NA
WP_000204271.1|2609596_2611033_+	MarR family transcriptional regulator	NA	A0A088F7M4	Mycobacterium_phage	31.2	5.5e-58
WP_000136272.1|2611281_2611461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791584.1|2612110_2612293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130145.1|2612764_2614429_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	4.7e-45
WP_000179061.1|2614465_2615170_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000769709.1|2615560_2615986_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044369.1|2616280_2617096_+	hydrolase	NA	NA	NA	NA	NA
WP_001044451.1|2617306_2618161_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	34.8	1.3e-06
>prophage 196
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2621539	2624602	2860390		Staphylococcus_phage(50.0%)	5	NA	NA
WP_001015495.1|2621539_2622388_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.4	1.3e-43
WP_001573519.1|2622608_2622734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293423.1|2622688_2622982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333457.1|2622995_2623604_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_001573518.1|2623861_2624602_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	30.3	7.3e-14
>prophage 197
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2630922	2632335	2860390		Pandoravirus(100.0%)	1	NA	NA
WP_000169223.1|2630922_2632335_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	5.0e-48
>prophage 198
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2636303	2637866	2860390		Vibrio_phage(100.0%)	1	NA	NA
WP_000792332.1|2636303_2637866_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	3.5e-18
>prophage 199
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2648069	2649038	2860390		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2648069_2649038_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 200
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2664835	2665744	2860390		Klosneuvirus(100.0%)	1	NA	NA
WP_000162591.1|2664835_2665744_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.7	1.2e-26
>prophage 201
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2682986	2690404	2860390	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000334466.1|2682986_2684792_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.6	2.6e-97
WP_000908186.1|2685023_2685806_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	5.7e-09
WP_000370937.1|2685873_2686731_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001792784.1|2687389_2687548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073392962.1|2688227_2688332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277709.1|2688757_2690404_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
>prophage 202
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2698910	2704406	2860390	transposase	Clostridium_phage(33.33%)	5	NA	NA
WP_000070866.1|2698910_2699354_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_094409958.1|2699459_2701027_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000160304.1|2701137_2701848_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083335.1|2702162_2702825_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242308.1|2703104_2704406_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.7	1.4e-132
>prophage 203
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2712339	2713950	2860390		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2712339_2713950_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 204
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2721753	2729506	2860390		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2721753_2722353_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460244.1|2722353_2723430_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248730.1|2723416_2724253_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001801520.1|2724285_2725383_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697334.1|2725379_2725799_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654191.1|2725905_2726430_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2726456_2727695_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2727722_2728352_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723407.1|2728375_2729506_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.1	1.0e-27
>prophage 205
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2740223	2740619	2860390		Bacillus_phage(100.0%)	1	NA	NA
WP_000932696.1|2740223_2740619_+	single-stranded DNA-binding protein	NA	A0A1B1PAE7	Bacillus_phage	36.8	3.0e-14
>prophage 206
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2746728	2747376	2860390		Moumouvirus(100.0%)	1	NA	NA
WP_001187612.1|2746728_2747376_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	4.7e-09
>prophage 207
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2755568	2757089	2860390		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178940.1|2755568_2757089_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 208
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2762763	2764791	2860390		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546609.1|2762763_2764791_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.6	3.9e-25
>prophage 209
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2769941	2773324	2860390		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621176.1|2769941_2770304_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2770651_2771653_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2771771_2772098_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190825.1|2772099_2772579_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041107.1|2772553_2773324_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 210
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2787437	2792161	2860390		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094572.1|2787437_2788967_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.6	9.4e-08
WP_072399972.1|2788996_2790016_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2790137_2790392_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047828.1|2790391_2792161_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	4.1e-63
>prophage 211
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2795921	2810000	2860390	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_000159047.1|2795921_2796947_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	3.1e-63
WP_000106312.1|2797260_2798871_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	27.4	5.1e-20
WP_001791590.1|2798968_2799097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602046.1|2799241_2801170_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.1	3.2e-53
WP_001283612.1|2801422_2802058_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_073392939.1|2802415_2803444_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581078.1|2803503_2803728_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052261.1|2803936_2805187_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	9.0e-41
WP_000790325.1|2805370_2806321_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791588.1|2806469_2807954_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.8	5.2e-19
WP_001253292.1|2807950_2808910_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688492.1|2809283_2810000_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 212
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2817141	2831485	2860390	integrase,coat,terminase	Staphylococcus_phage(68.42%)	22	2819101:2819120	2833835:2833854
WP_000917289.1|2817141_2817426_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240651.1|2817501_2819118_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
2819101:2819120	attL	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
WP_160325520.1|2819186_2820359_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	97.9	3.5e-220
WP_000620857.1|2820372_2821047_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
WP_000153640.1|2821219_2821438_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
WP_000481967.1|2821442_2821760_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
WP_000708433.1|2821756_2821912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231378.1|2821896_2822100_+	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	97.0	7.5e-30
WP_000403839.1|2822101_2822485_+	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	9.7e-63
WP_001103930.1|2822485_2822803_+	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	58.2	1.6e-18
WP_001002721.1|2822866_2823736_+	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	99.3	6.0e-169
WP_000447451.1|2823749_2825459_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	100.0	0.0e+00
WP_000356937.1|2825770_2826151_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	100.0	6.9e-69
WP_001019766.1|2826147_2826789_+	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	94.8	3.5e-113
WP_001190608.1|2827324_2827666_+	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	98.2	7.1e-57
WP_000846285.1|2827677_2828256_+	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
WP_000448775.1|2828273_2828492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000771368.1|2828542_2829070_+|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_000358778.1|2829072_2829414_+	hypothetical protein	NA	A0A1W6JQM3	Staphylococcus_phage	100.0	1.7e-58
WP_001293073.1|2829410_2829980_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	3.5e-101
WP_001035597.1|2830134_2830839_-	toxic shock syndrome toxin TSST-1	NA	NA	NA	NA	NA
WP_000812237.1|2831257_2831485_+	hypothetical protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	47.4	1.9e-13
2833835:2833854	attR	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
>prophage 213
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2834569	2835197	2860390		Staphylococcus_phage(100.0%)	2	NA	NA
WP_001573769.1|2834569_2834866_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	40.4	6.7e-11
WP_001573771.1|2834855_2835197_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	46.0	4.1e-20
>prophage 214
NZ_CP047805	Staphylococcus aureus strain UP_1654 chromosome, complete genome	2860390	2839175	2859920	2860390	integrase	Staphylococcus_phage(100.0%)	38	2831001:2831017	2852535:2852551
2831001:2831017	attL	AACATTTTAAAGTTACA	NA	NA	NA	NA
WP_000791402.1|2839175_2840231_+	succinyl-diaminopimelate desuccinylase	NA	A0A2I6PER8	Staphylococcus_phage	34.6	7.9e-38
WP_000595617.1|2840252_2841272_+	beta-channel forming cytolysin	NA	A0A2I6PEU3	Staphylococcus_phage	39.6	3.4e-54
WP_000857191.1|2842411_2843449_-|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	100.0	9.1e-180
WP_000825947.1|2843507_2843972_-	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
WP_000705248.1|2844071_2844254_-	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
WP_000591749.1|2844457_2844799_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
WP_000759682.1|2844804_2845737_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
WP_001031454.1|2845752_2846466_-	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_001801500.1|2846428_2846602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854072.1|2846598_2846862_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
WP_001025874.1|2846877_2847093_+	DUF2829 domain-containing protein	NA	A0EWV9	Staphylococcus_phage	100.0	6.3e-35
WP_000128907.1|2847081_2847411_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
WP_001148605.1|2847461_2848214_+	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_001148855.1|2848229_2848427_+	hypothetical protein	NA	Q8SDM8	Staphylococcus_phage	100.0	7.0e-33
WP_000939496.1|2848457_2848598_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
WP_000275058.1|2848612_2849245_-	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
WP_001120197.1|2849303_2849624_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_000066017.1|2849620_2849782_+	DUF1270 domain-containing protein	NA	D2JGJ6	Staphylococcus_phage	100.0	4.3e-20
WP_000165375.1|2849876_2850203_+	DUF2482 family protein	NA	W5RAK4	Staphylococcus_phage	100.0	1.2e-53
WP_000291503.1|2850183_2850444_+	DUF1108 family protein	NA	A0EWW8	Staphylococcus_phage	100.0	8.9e-44
WP_001205732.1|2850452_2850716_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700577.1|2850724_2852668_+	AAA family ATPase	NA	A0EWX0	Staphylococcus_phage	100.0	0.0e+00
2852535:2852551	attR	AACATTTTAAAGTTACA	NA	NA	NA	NA
WP_000138472.1|2852669_2853590_+	recombinase	NA	S4SUN6	Staphylococcus_phage	100.0	2.3e-166
WP_071621397.1|2853670_2854288_+	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
WP_000934764.1|2854288_2854759_+	single-stranded DNA-binding protein	NA	A0EWX3	Staphylococcus_phage	100.0	7.4e-81
WP_000148316.1|2854788_2855673_+	DnaD domain protein	NA	A0EWX4	Staphylococcus_phage	100.0	5.4e-141
WP_000338531.1|2855679_2855898_+	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	98.6	1.2e-36
WP_000101274.1|2856228_2856597_+	hypothetical protein	NA	W5RAK8	Staphylococcus_phage	100.0	8.2e-51
WP_000131366.1|2856600_2856843_+	hypothetical protein	NA	A0EWX8	Staphylococcus_phage	100.0	3.9e-41
WP_001065091.1|2857014_2857266_+	DUF1024 family protein	NA	A0EWY0	Staphylococcus_phage	100.0	1.9e-38
WP_000028422.1|2857255_2857438_+	hypothetical protein	NA	A0EWY1	Staphylococcus_phage	100.0	2.6e-26
WP_000185659.1|2857430_2857973_+	dUTP pyrophosphatase	NA	A0EWY2	Staphylococcus_phage	100.0	1.1e-96
WP_000195803.1|2858009_2858216_+	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_000592207.1|2858212_2858599_+	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	3.0e-64
WP_000595265.1|2858595_2858745_+	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_000265043.1|2858744_2858945_+	DUF1514 domain-containing protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
WP_000590122.1|2858972_2859389_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988336.1|2859620_2859920_+	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
