The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	0	45553	2697945	head,protease,holin,portal,terminase,integrase,tail,capsid	Staphylococcus_phage(93.55%)	47	39689:39705	47123:47139
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000154555.1|3609_4755_+|capsid	phage major capsid protein	capsid	A0A1X9H072	Staphylococcus_phage	100.0	5.6e-215
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114225.1|5675_6080_+	hypothetical protein	NA	A0A2I6PDJ6	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268741.1|6484_7129_+|tail	phage tail protein	tail	W5R9H4	Staphylococcus_phage	100.0	6.5e-120
WP_072050172.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	98.6	8.8e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_047928553.1|8039_12569_+|tail	phage tail tape measure protein	tail	A0A1X9H084	Staphylococcus_phage	99.9	0.0e+00
WP_000567408.1|12565_14050_+|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	100.0	1.2e-297
WP_000582177.1|14065_17848_+	hypothetical protein	NA	A0A068A201	Staphylococcus_phage	99.8	0.0e+00
WP_001000058.1|17840_17993_+	hypothetical protein	NA	A0A1W6JPL6	Staphylococcus_phage	100.0	7.6e-19
WP_001262620.1|18038_18326_+	hypothetical protein	NA	C5I682	Staphylococcus_phage	100.0	9.9e-44
WP_000340977.1|18381_18756_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_072357969.1|18898_19075_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	96.6	6.5e-22
WP_031762631.1|19127_19235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|19286_19541_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|19552_20308_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000920041.1|20498_20990_+	staphylokinase	NA	A7TWR8	Staphylococcus_phage	100.0	8.0e-86
WP_160179323.1|22067_22517_-	chemotaxis-inhibiting protein CHIPS	NA	A7TWR9	Staphylococcus_phage	99.3	9.6e-78
WP_000702262.1|23199_23550_+	complement inhibitor SCIN-A	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|23602_23863_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|24173_24353_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_160179325.1|25310_27359_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_001068542.1|27682_28969_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|29168_29267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681968.1|29509_29686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|29944_30325_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991302.1|30321_31218_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645728.1|31218_31899_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|31895_32768_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
WP_047928552.1|32767_33508_+	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
WP_000182842.1|33573_34137_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000966288.1|34257_34782_+	membrane protein	NA	NA	NA	NA	NA
WP_001033971.1|34841_35399_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000713072.1|35395_36238_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_001188077.1|36294_37335_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_000267034.1|37785_37959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905733.1|38981_40133_+|integrase	tyrosine-type recombinase/integrase	integrase	P97010	Streptococcus_pyogenes_phage	32.2	8.1e-12
39689:39705	attL	AATAGTTTTGAAAAATA	NA	NA	NA	NA
WP_106905822.1|40171_42199_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106905732.1|42557_43946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905731.1|43988_44408_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	50.4	1.5e-27
WP_020977410.1|44707_45553_-	penicillin-hydrolyzing class A beta-lactamase BlaZ	NA	A0A1B0VBP7	Salmonella_phage	33.9	1.3e-30
47123:47139	attR	AATAGTTTTGAAAAATA	NA	NA	NA	NA
>prophage 2
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	52172	54202	2697945		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|52172_52733_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275707.1|53104_54202_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.9	2.5e-47
>prophage 3
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	58231	60515	2697945		Bacillus_virus(100.0%)	2	NA	NA
WP_000284433.1|58231_59701_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	3.5e-108
WP_000040866.1|59693_60515_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 4
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	64176	70943	2697945		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|64176_65472_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|65580_65883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272071.1|66054_66747_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992921.1|66743_68936_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774565.1|68939_70943_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	5.8e-114
>prophage 5
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	78002	83031	2697945		Catovirus(33.33%)	5	NA	NA
WP_001231451.1|78002_78950_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-16
WP_001147869.1|79030_80392_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.8	1.1e-103
WP_000548775.1|80561_81092_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140172.1|81338_82409_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|82476_83031_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 6
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	86483	86897	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001670387.1|86483_86897_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	39.1	5.1e-17
>prophage 7
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	91890	92520	2697945		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|91890_92520_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 8
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	108000	109737	2697945		Bacillus_phage(100.0%)	1	NA	NA
WP_000597239.1|108000_109737_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 9
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	125880	126609	2697945		Planktothrix_phage(100.0%)	1	NA	NA
WP_001144055.1|125880_126609_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
>prophage 10
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	137493	137838	2697945		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|137493_137838_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 11
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	147427	148168	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|147427_148168_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 12
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	155954	160218	2697945		Staphylococcus_phage(80.0%)	5	NA	NA
WP_129409671.1|155954_156737_+	staphylococcal enterotoxin type O	NA	A0A1X9H080	Staphylococcus_phage	36.7	1.4e-31
WP_000821658.1|157017_157737_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	35.8	2.3e-25
WP_000713847.1|157771_158500_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.2	1.1e-27
WP_160179339.1|158653_159424_+	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	42.8	3.1e-44
WP_001236364.1|159462_160218_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	41.0	1.0e-39
>prophage 13
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	163961	165056	2697945	transposase	Staphylococcus_phage(100.0%)	2	NA	NA
WP_001792814.1|163961_164090_-|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	66.7	6.6e-08
WP_000209099.1|164267_165056_-	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	95.0	1.3e-138
>prophage 14
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	168408	172200	2697945		Staphylococcus_phage(100.0%)	3	NA	NA
WP_001092773.1|168408_168990_-	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	63.2	4.6e-56
WP_047928525.1|169385_170942_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	97.7	6.3e-286
WP_000072555.1|170934_172200_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	34.3	5.2e-44
>prophage 15
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	177276	224380	2697945	protease,tRNA	Staphylococcus_phage(91.89%)	44	NA	NA
WP_000764922.1|177276_178029_-	hypothetical protein	NA	A0A097PAT7	Streptococcus_pyogenes_phage	47.2	4.4e-51
WP_031775015.1|178055_178781_-	enterotoxin	NA	A0EX09	Staphylococcus_phage	33.5	4.0e-25
WP_000669028.1|178825_179452_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	93.8	3.9e-93
WP_160179343.1|179525_180521_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	4.2e-73
WP_078104171.1|180601_181252_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	83.8	1.6e-41
WP_076692541.1|181554_182010_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	98.6	1.2e-78
WP_000348379.1|182168_183647_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	100.0	1.5e-289
WP_000778516.1|183651_184653_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	98.2	9.7e-187
WP_000718110.1|184649_184907_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	98.8	3.6e-45
WP_078098768.1|184972_185446_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	97.5	1.4e-82
WP_016169057.1|185450_186197_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	99.2	2.2e-143
WP_000109906.1|186574_188167_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
WP_000933822.1|188538_189732_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
WP_000366163.1|189856_190765_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
WP_000453298.1|190976_191810_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
WP_000623478.1|192193_192547_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	100.0	2.6e-22
WP_001200542.1|192543_192909_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091445.1|193164_193467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|193726_194440_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_001168907.1|194879_195515_-|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_001030469.1|195810_196254_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
WP_001153742.1|196240_196684_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671052.1|196796_197267_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	99.4	1.0e-82
WP_000384171.1|197465_197690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|197965_198820_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000163235.1|199115_199511_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	100.0	6.3e-73
WP_000989121.1|199528_200821_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
WP_000221177.1|200820_201135_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
WP_160179345.1|201657_203160_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	100.0	2.3e-30
WP_025174259.1|203652_204684_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	2.0e-195
WP_000493888.1|204690_205323_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	100.0	3.4e-113
WP_001159035.1|205333_206515_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	100.0	1.7e-227
WP_001008549.1|206527_206992_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
WP_160179347.1|207113_208115_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.7	9.0e-185
WP_001790712.1|208226_208346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266096.1|208348_209176_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|209745_210147_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764419.1|210266_210830_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
WP_000526539.1|210826_211780_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_001025061.1|211889_213071_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	100.0	5.6e-218
WP_001108728.1|213361_215776_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.3	0.0e+00
WP_000836465.1|215797_216109_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	100.0	1.6e-52
WP_047928507.1|216434_222995_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	96.2	2.1e-298
WP_000285020.1|223111_224380_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	9.1e-57
>prophage 16
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	235813	241141	2697945		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|235813_236671_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048368.1|236699_237296_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_031775255.1|237316_241141_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.0e-83
>prophage 17
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	248051	251753	2697945		Tupanvirus(50.0%)	3	NA	NA
WP_047928504.1|248051_249221_-	acetoin utilization protein AcuC	NA	A0A2K9L0I3	Tupanvirus	37.0	7.4e-21
WP_001015996.1|249245_249878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000862083.1|250046_251753_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	100.0	1.2e-274
>prophage 18
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	258370	261001	2697945	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|258370_259633_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279338.1|259726_261001_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 19
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	264770	268905	2697945		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808837.1|264770_266375_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291419.1|266361_267522_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553927.1|267635_268082_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174285.1|268161_268905_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.0	4.9e-18
>prophage 20
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	286722	289920	2697945		Streptomyces_phage(100.0%)	1	NA	NA
WP_031586435.1|286722_289920_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	1.3e-136
>prophage 21
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	294853	296611	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160179354.1|294853_296611_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	98.9	1.3e-40
>prophage 22
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	303472	311636	2697945		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080028.1|303472_304177_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_160179534.1|304176_305838_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_000849439.1|306336_307824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038305.1|308117_310748_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_160179356.1|310763_311636_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	37.9	9.7e-42
>prophage 23
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	315551	326704	2697945	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|315551_316472_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_001790562.1|316564_316687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|316884_318822_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049154.1|319247_320741_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791162.1|320969_321497_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_001125540.1|321525_321726_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|321772_322129_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032657.1|322270_322879_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
WP_001280024.1|322897_323827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|323831_323942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127573.1|323989_325291_+	trigger factor	NA	NA	NA	NA	NA
WP_000472302.1|325441_326704_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.0	5.0e-140
>prophage 24
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	336271	338902	2697945	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000425353.1|336271_338902_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.7	3.7e-153
>prophage 25
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	348835	384388	2697945	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|348835_349840_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019178.1|349841_350867_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|350889_352029_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|352047_352308_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749795.1|352582_354862_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000594985.1|355064_357338_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	1.1e-63
WP_000364542.1|357359_357878_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058587.1|358305_360495_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869983.1|360506_360959_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|360955_361831_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_061743889.1|362291_363554_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044799.1|363569_365336_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001808039.1|365668_365797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682646.1|365796_366570_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_160179360.1|366730_368005_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.5	4.1e-105
WP_000704122.1|368089_368512_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|368611_368794_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000009238.1|368833_368980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985895.1|369216_370230_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409167.1|370541_371684_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000066097.1|371684_372803_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567018.1|373437_374106_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_047928487.1|374107_376585_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.4	1.1e-66
WP_047928486.1|376927_379558_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|379620_379881_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|379884_380313_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|380327_380636_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342266.1|380920_381559_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137779.1|381561_382485_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|382496_383765_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|383764_384388_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 26
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	399237	405401	2697945		Bacillus_phage(33.33%)	5	NA	NA
WP_000439693.1|399237_399699_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_000953299.1|399757_401905_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	1.6e-32
WP_001282563.1|401961_402936_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|402980_403232_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368345.1|403577_405401_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	8.0e-22
>prophage 27
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	408891	411999	2697945		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|408891_410724_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_047928473.1|410859_411999_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
>prophage 28
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	418469	419417	2697945		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|418469_419417_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 29
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	422470	436216	2697945	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|422470_423862_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001797828.1|424196_424820_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411301.1|424830_425649_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217244.1|425709_427527_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.6e-54
WP_001283055.1|427750_428857_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_023914705.1|428987_429665_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683936.1|429667_430768_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	29.6	5.2e-08
WP_001062177.1|430881_432228_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
WP_000924220.1|432237_433128_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	36.0	3.4e-26
WP_031775221.1|433253_434039_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	1.0e-18
WP_000564316.1|434080_434944_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|434930_435341_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|435616_436216_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 30
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	442389	443013	2697945		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|442389_443013_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 31
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	448557	451369	2697945		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019690.1|448557_449904_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.9	5.7e-65
WP_000202188.1|449896_451369_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
>prophage 32
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	458868	465439	2697945		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|458868_460206_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159865.1|460198_460429_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183375.1|460406_461288_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	26.1	8.9e-11
WP_001124985.1|461719_462172_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942210.1|462187_463867_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_047928467.1|464017_465439_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	3.9e-40
>prophage 33
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	472268	473675	2697945		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|472268_473675_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 34
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	480102	481587	2697945		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|480102_481587_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 35
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	485114	493399	2697945		Klosneuvirus(20.0%)	10	NA	NA
WP_001171351.1|485114_486023_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.5	3.4e-05
WP_000365246.1|486104_486647_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000392691.1|486751_487201_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000447733.1|487249_488137_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183436.1|488214_488721_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273371.1|488812_489544_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	7.9e-05
WP_000368656.1|489536_490079_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|490071_490809_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|490941_491667_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987774.1|491647_493399_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.2	2.2e-21
>prophage 36
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	497030	499709	2697945		Bacillus_phage(50.0%)	3	NA	NA
WP_001151997.1|497030_497279_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163801.1|497386_498340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902099.1|498329_499709_+	ATP-dependent DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	33.6	1.4e-55
>prophage 37
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	509133	514600	2697945		Bacillus_phage(25.0%)	7	NA	NA
WP_001043863.1|509133_509406_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|509836_510409_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_061743899.1|510411_511137_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001817755.1|511153_512098_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|512189_512639_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_000789522.1|512847_513048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001269921.1|513433_514600_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	31.8	5.8e-34
>prophage 38
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	518262	518838	2697945		Bacillus_virus(100.0%)	1	NA	NA
WP_000005212.1|518262_518838_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.1e-08
>prophage 39
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	522208	529714	2697945	tRNA	unidentified_phage(25.0%)	5	NA	NA
WP_000361552.1|522208_523411_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	1.9e-35
WP_000049923.1|523397_524369_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525078.1|524392_527086_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858789.1|527407_528700_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	1.9e-54
WP_000362220.1|529027_529714_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
>prophage 40
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	533455	534082	2697945		Bacillus_phage(100.0%)	1	NA	NA
WP_001108889.1|533455_534082_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 41
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	543407	544286	2697945		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|543407_544286_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 42
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	570267	579654	2697945		Staphylococcus_phage(60.0%)	13	NA	NA
WP_000282171.1|570267_570972_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
WP_001795441.1|571216_571411_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_160179369.1|571422_571674_+	scaffolding protein	NA	NA	NA	NA	NA
WP_000404645.1|571711_572836_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995287.1|572851_573289_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934887.1|573712_574669_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.3e-167
WP_000175746.1|574868_575348_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_047928450.1|575362_576202_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	77.3	2.3e-48
WP_000159900.1|576287_576821_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|576813_577242_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473653.1|577253_577754_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|577753_577975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342144.1|578163_579654_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.8	5.9e-23
>prophage 43
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	583063	585075	2697945		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|583063_583723_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166801.1|583719_585075_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 44
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	591240	592032	2697945		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|591240_592032_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 45
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	595572	600603	2697945	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138413.1|595572_596709_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001788788.1|596740_597370_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|597388_597658_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|597820_598129_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|598299_598500_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876201.1|598696_599098_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216946.1|599337_600603_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	6.2e-13
>prophage 46
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	608650	610252	2697945		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|608650_610252_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 47
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	615340	618794	2697945		Indivirus(50.0%)	3	NA	NA
WP_000079447.1|615340_616192_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-16
WP_000974847.1|616198_616840_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077571.1|616979_618794_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.1	5.1e-154
>prophage 48
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	622208	622910	2697945		Tupanvirus(100.0%)	1	NA	NA
WP_000571259.1|622208_622910_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	2.0e-13
>prophage 49
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	631007	633362	2697945		Acinetobacter_phage(100.0%)	3	NA	NA
WP_000153613.1|631007_631790_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	35.9	2.7e-27
WP_047928445.1|631791_632790_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.9	8.5e-34
WP_000604816.1|632795_633362_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
>prophage 50
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	637680	638943	2697945		Bacillus_phage(100.0%)	1	NA	NA
WP_000283016.1|637680_638943_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	2.6e-96
>prophage 51
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	648602	652996	2697945		Bacillus_phage(50.0%)	2	NA	NA
WP_001289579.1|648602_651005_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.7	4.2e-95
WP_001548666.1|651004_652996_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 52
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	658816	660463	2697945		Vibrio_phage(100.0%)	1	NA	NA
WP_001088978.1|658816_660463_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.5e-22
>prophage 53
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	664132	665254	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691284.1|664132_665254_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 54
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	669403	675059	2697945		Phage_Wrath(25.0%)	7	NA	NA
WP_001208760.1|669403_670027_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
WP_000380719.1|670406_671270_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	4.1e-16
WP_001791425.1|671343_671448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688122.1|671444_672422_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085655.1|672578_672848_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|673301_673451_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000082539.1|673541_675059_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
>prophage 55
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	685211	697322	2697945	integrase	Staphylococcus_phage(58.33%)	18	695520:695534	703903:703917
WP_061743908.1|685211_685745_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|685883_686072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202390.1|686185_686788_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670303.1|686784_687876_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603964.1|687879_688611_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072384901.1|688579_689488_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	3.4e-21
WP_000786634.1|691529_691796_-	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	53.6	3.0e-18
WP_000786993.1|691785_692103_-	DUF2482 family protein	NA	W5RAK4	Staphylococcus_phage	80.6	1.6e-39
WP_000072840.1|692189_692351_-	DUF1270 family protein	NA	R4IH12	Staphylococcus_phage	69.8	1.1e-12
WP_001157025.1|692449_693133_-	phage repressor protein	NA	A9CR56	Staphylococcus_phage	85.6	5.2e-107
WP_000800341.1|693193_693400_+	hypothetical protein	NA	A1BTY8	Staphylococcus_virus	75.0	3.3e-25
WP_000932238.1|693823_694099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001209962.1|694125_694344_-	DUF739 family protein	NA	A0A2I6PE94	Staphylococcus_phage	62.5	4.9e-19
WP_000664917.1|694511_694904_+	helix-turn-helix domain-containing protein	NA	A0A2I6PE55	Staphylococcus_phage	53.6	1.6e-28
WP_000554410.1|695050_695434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031587096.1|695445_696141_+	hypothetical protein	NA	A0A2H4J5B8	uncultured_Caudovirales_phage	50.3	1.4e-06
695520:695534	attL	AGGCTTATTTTTATT	NA	NA	NA	NA
WP_108630597.1|696193_696484_+	hypothetical protein	NA	A0A1W6JQD3	Staphylococcus_phage	51.9	7.0e-05
WP_031797583.1|696605_697322_+|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	34.7	4.1e-22
703903:703917	attR	AGGCTTATTTTTATT	NA	NA	NA	NA
>prophage 56
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	702038	702515	2697945		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|702038_702515_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 57
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	708457	714939	2697945		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103743.1|708457_709276_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
WP_001077635.1|709750_710293_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516264.1|710298_712308_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.7	2.8e-60
WP_000073352.1|712320_714939_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	8.5e-41
>prophage 58
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	724353	725397	2697945		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|724353_725397_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 59
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	729596	735140	2697945		Bacillus_virus(33.33%)	4	NA	NA
WP_158172995.1|729596_730883_-	peptidase M16	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
WP_000089946.1|730882_732148_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.6e-40
WP_001293307.1|732178_732892_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001806691.1|732896_735140_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 60
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	740280	752094	2697945	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864185.1|740280_741252_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282302.1|741266_742184_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|742353_742704_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_031587224.1|743089_745207_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	1.8e-25
WP_000020853.1|745211_745529_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|745525_745810_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097461.1|745830_747006_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036633.1|747026_747494_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_078170913.1|747783_752094_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 61
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	756342	757113	2697945		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|756342_757113_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 62
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	761891	773096	2697945	protease,tRNA	Erwinia_phage(20.0%)	9	NA	NA
WP_000379049.1|761891_763295_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.8	1.3e-27
WP_000072681.1|763360_763906_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_160179378.1|763902_764799_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.2	1.4e-30
WP_000195260.1|765215_766523_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_160179380.1|766678_768754_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.1	3.9e-105
WP_000931872.1|768927_769800_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000110253.1|770123_771032_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_001020801.1|771053_772220_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176406.1|772328_773096_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	1.9e-25
>prophage 63
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	786649	788770	2697945		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|786649_787381_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|787496_787730_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|788035_788770_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 64
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	799140	801135	2697945		Moumouvirus(100.0%)	1	NA	NA
WP_000579564.1|799140_801135_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 65
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	804282	805218	2697945	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161281.1|804282_805218_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.9	3.6e-10
>prophage 66
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	810231	812488	2697945		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|810231_811431_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|811646_811865_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368227.1|811864_812488_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.7	3.6e-22
>prophage 67
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	815802	816414	2697945		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|815802_816414_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 68
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	820381	824992	2697945		Halovirus(33.33%)	4	NA	NA
WP_001190913.1|820381_821482_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
WP_000767028.1|821483_822758_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|822775_823657_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178619.1|823684_824992_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 69
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	829456	832210	2697945	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384691.1|829456_832210_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 70
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	851793	851982	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245802.1|851793_851982_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	86.9	3.8e-20
>prophage 71
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	861065	863025	2697945		Staphylococcus_phage(100.0%)	3	NA	NA
WP_076692497.1|861065_861290_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
WP_000765709.1|861246_861393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857488.1|862065_863025_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	7.4e-35
>prophage 72
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	869823	870411	2697945		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000659313.1|869823_870411_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	28.9	1.3e-10
>prophage 73
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	877134	881692	2697945		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|877134_877449_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_047928316.1|877621_879970_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
WP_000161940.1|879979_881692_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	8.9e-15
>prophage 74
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	886699	887758	2697945	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003563.1|886699_887758_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 75
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	899693	902601	2697945		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|899693_900176_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263796.1|900177_900720_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_047928303.1|900789_901179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|901181_901436_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757570.1|901674_902601_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	1.7e-12
>prophage 76
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	914118	915966	2697945		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000182654.1|914118_915966_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 77
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	924099	932931	2697945		Mycoplasma_phage(25.0%)	9	NA	NA
WP_000433551.1|924099_925194_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020625.1|925206_925746_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000455596.1|925889_926165_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|926331_927738_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000863440.1|927741_929034_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_160179393.1|929124_930102_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000035320.1|930105_931218_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000668339.1|931388_932015_-	cell-wall-binding lipoprotein	NA	NA	NA	NA	NA
WP_000957036.1|932379_932931_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 78
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	938943	943323	2697945		Bacillus_virus(50.0%)	5	NA	NA
WP_001289618.1|938943_939177_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
WP_000040052.1|939413_941132_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|941134_941401_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505966.1|941554_942097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685067.1|942150_943323_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	4.0e-75
>prophage 79
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	946438	961200	2697945		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921965.1|946438_947839_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273253.1|947831_948638_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101899.1|948904_950152_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_047928251.1|950173_951652_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	3.2e-77
WP_000238669.1|951666_952233_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
WP_000030811.1|952235_953264_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
WP_000483713.1|953256_954741_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	3.2e-45
WP_000032740.1|954719_956909_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
WP_000666806.1|956901_957573_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000848350.1|957574_957838_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_160179395.1|957837_958542_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
WP_001010413.1|958545_959670_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861572.1|959656_960139_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
WP_000225837.1|960339_961200_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.2	5.3e-40
>prophage 80
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	971653	975424	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001074552.1|971653_975424_+	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.1e-54
>prophage 81
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	979090	980101	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_031775067.1|979090_980101_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	32.3	6.2e-16
>prophage 82
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	988406	992128	2697945		Enterococcus_phage(50.0%)	6	NA	NA
WP_001788574.1|988406_988697_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
WP_001790177.1|988760_988892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000766009.1|990385_990742_+	DoxX family protein	NA	NA	NA	NA	NA
WP_001792054.1|990830_990968_-	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
WP_001795266.1|991108_991399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571167.1|991486_992128_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.7e-19
>prophage 83
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1002322	1007533	2697945	protease	Pithovirus(33.33%)	3	NA	NA
WP_001795272.1|1002322_1004647_-|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.8e-11
WP_000928413.1|1004865_1005669_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049951.1|1005970_1007533_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
>prophage 84
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1026463	1028272	2697945		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082725.1|1026463_1028272_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
>prophage 85
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1034085	1036055	2697945		Bacillus_virus(100.0%)	2	NA	NA
WP_000427769.1|1034085_1035066_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_001067040.1|1035068_1036055_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
>prophage 86
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1039706	1041720	2697945		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000786736.1|1039706_1040648_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	1.6e-05
WP_000140050.1|1040637_1041720_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
>prophage 87
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1050315	1057125	2697945		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619360.1|1050315_1051461_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047069.1|1051570_1052440_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353954.1|1052498_1055108_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044219.1|1055310_1057125_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	34.2	3.0e-37
>prophage 88
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1062735	1066389	2697945		Bacillus_phage(100.0%)	1	NA	NA
WP_160179407.1|1062735_1066389_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
>prophage 89
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1076543	1083621	2697945		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185319.1|1076543_1077473_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.9	3.7e-39
WP_000138487.1|1077895_1079140_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047928208.1|1079248_1080439_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.3e-33
WP_000838039.1|1080747_1081875_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1082235_1082613_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1083027_1083621_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 90
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1093541	1097169	2697945		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009687.1|1093541_1095017_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	6.9e-48
WP_000046076.1|1095147_1096356_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143497.1|1096809_1097169_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 91
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1101212	1103881	2697945		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1101212_1102427_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129653.1|1102423_1103881_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	4.4e-39
>prophage 92
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1117089	1120612	2697945		environmental_halophage(50.0%)	3	NA	NA
WP_001807949.1|1117089_1118331_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	6.3e-111
WP_000205582.1|1118445_1119753_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_160179413.1|1119850_1120612_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	2.6e-06
>prophage 93
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1124099	1133237	2697945		Streptococcus_phage(40.0%)	14	NA	NA
WP_047928199.1|1124099_1125125_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	3.9e-26
WP_001065801.1|1125374_1125671_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001018962.1|1125663_1126050_-	topiosmerase	NA	NA	NA	NA	NA
WP_000932211.1|1126464_1127343_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000662306.1|1127344_1127458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290489.1|1127521_1127902_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000589549.1|1128059_1128416_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001190695.1|1128559_1128880_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1129029_1129569_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150016.1|1129651_1130368_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.6	1.0e-17
WP_000974460.1|1130515_1130938_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1131336_1131831_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255553.1|1131986_1132604_+	amino acid transporter	NA	NA	NA	NA	NA
WP_072353886.1|1132676_1133237_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	2.2e-31
>prophage 94
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1136641	1137885	2697945		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1136641_1136842_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_160179415.1|1137198_1137885_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	53.4	1.4e-32
>prophage 95
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1147051	1154794	2697945		Staphylococcus_phage(50.0%)	7	NA	NA
WP_000757401.1|1147051_1147780_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	1.4e-17
WP_001085185.1|1148644_1149109_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_160179419.1|1149130_1151503_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.0	6.6e-93
WP_001165964.1|1151536_1152277_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000556760.1|1152392_1152626_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|1152692_1153151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1153489_1154794_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 96
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1163912	1169674	2697945		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1163912_1164500_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1165073_1166018_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1166128_1167124_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369722.1|1167120_1168032_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134963.1|1168738_1169674_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 97
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1174183	1177030	2697945		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662681.1|1174183_1177030_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	0.0e+00
>prophage 98
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1180348	1181188	2697945		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000753320.1|1180348_1181188_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 99
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1187266	1192979	2697945		Streptococcus_phage(66.67%)	5	NA	NA
WP_001793589.1|1187266_1188349_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.5	2.0e-44
WP_000686342.1|1188712_1189579_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192949.1|1189722_1190364_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	47.7	5.3e-37
WP_000258151.1|1190535_1191591_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1191908_1192979_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 100
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1202259	1225767	2697945		uncultured_Caudovirales_phage(35.71%)	19	NA	NA
WP_000616842.1|1202259_1203021_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	8.5e-18
WP_001245577.1|1203017_1203974_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000876318.1|1203960_1204932_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
WP_000499195.1|1204970_1205126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562498.1|1205639_1206611_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1206728_1208834_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1208796_1209195_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068494.1|1209995_1210862_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|1210881_1211382_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_000193751.1|1211722_1213228_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_001790641.1|1213305_1213407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429014.1|1213497_1214415_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	3.7e-07
WP_000197271.1|1215038_1215581_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_061743932.1|1215875_1216934_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	1.4e-21
WP_000180991.1|1217173_1218688_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589260.1|1218680_1219658_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	5.4e-25
WP_000983677.1|1219879_1221661_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_076692510.1|1221672_1223556_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	2.0e-55
WP_000098285.1|1223826_1225767_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 101
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1228906	1238752	2697945		Pandoravirus(12.5%)	12	NA	NA
WP_001217802.1|1228906_1230058_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	1.2e-23
WP_000604514.1|1230041_1230635_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
WP_000446724.1|1230985_1231654_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1231655_1232075_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062972.1|1232078_1232792_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000604990.1|1232890_1233475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093562.1|1233754_1234195_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1234536_1235010_+	DoxX family protein	NA	NA	NA	NA	NA
WP_160179427.1|1234984_1235671_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244417.1|1235670_1236726_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.5	1.6e-14
WP_000702781.1|1236797_1237781_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.3	1.5e-62
WP_000931237.1|1237912_1238752_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
>prophage 102
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1250364	1251738	2697945		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000952026.1|1250364_1251738_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	33.6	5.1e-45
>prophage 103
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1256715	1262995	2697945		Bacillus_phage(33.33%)	6	NA	NA
WP_000857624.1|1256715_1258389_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.4	4.5e-11
WP_000737150.1|1258385_1260017_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.8	6.7e-12
WP_000469890.1|1260235_1261111_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358498.1|1261282_1261966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148828.1|1261968_1262427_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1262428_1262995_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
>prophage 104
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1269917	1270391	2697945		Pandoravirus(100.0%)	1	NA	NA
WP_000833486.1|1269917_1270391_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 105
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1275653	1276451	2697945		Bacillus_phage(100.0%)	1	NA	NA
WP_000731644.1|1275653_1276451_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	1.2e-06
>prophage 106
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1281281	1282043	2697945		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|1281281_1282043_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 107
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1286417	1287461	2697945		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001030771.1|1286417_1287461_-	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-17
>prophage 108
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1293982	1294780	2697945		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1293982_1294780_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 109
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1298005	1301964	2697945		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1298005_1299733_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793067.1|1300153_1301449_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1301565_1301964_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 110
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1308891	1309635	2697945		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|1308891_1309635_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 111
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1320519	1321080	2697945	integrase	Streptococcus_phage(100.0%)	1	1314673:1314687	1324668:1324682
1314673:1314687	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044915.1|1320519_1321080_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
WP_001044915.1|1320519_1321080_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
1324668:1324682	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 112
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1333969	1337323	2697945		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1333969_1334980_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1335478_1336000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180145.1|1336027_1337323_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	2.1e-24
>prophage 113
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1344630	1345953	2697945		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860587.1|1344630_1345953_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.1	2.4e-108
>prophage 114
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1357257	1357914	2697945		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455256.1|1357257_1357914_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 115
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1361554	1364875	2697945		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001100835.1|1361554_1362931_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	3.9e-21
WP_031588860.1|1363474_1364875_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
>prophage 116
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1383579	1384242	2697945		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067255.1|1383579_1384242_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.1e-24
>prophage 117
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1390821	1392009	2697945		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250823.1|1390821_1392009_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	4.4e-45
>prophage 118
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1395037	1405991	2697945		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1395037_1397119_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1397241_1397712_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1397777_1398191_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1398288_1398543_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001788197.1|1398679_1402276_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
WP_000918667.1|1402439_1405991_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 119
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1409674	1414457	2697945	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1409674_1410223_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1410235_1410418_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|1410473_1410617_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872876.1|1410731_1411301_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664738.1|1411381_1411906_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1411905_1412652_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370182.1|1412659_1413064_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_098691770.1|1413056_1414457_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	1.9e-55
>prophage 120
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1420467	1422924	2697945	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1420467_1422924_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 121
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1441849	1452121	2697945	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1441849_1443337_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_001790128.1|1443389_1443482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613716.1|1443875_1444352_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|1444348_1444714_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167924.1|1444691_1445495_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.3	1.3e-21
WP_000057594.1|1445710_1446643_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148594.1|1446821_1447703_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_160179444.1|1447931_1450025_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.5	1.2e-109
WP_000551283.1|1450281_1450821_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176728.1|1450825_1452121_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	8.2e-13
>prophage 122
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1461377	1463842	2697945		Hokovirus(50.0%)	2	NA	NA
WP_160179447.1|1461377_1462343_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.1	2.3e-44
WP_047928174.1|1462489_1463842_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 123
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1469727	1472825	2697945	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_001051129.1|1469727_1471701_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	1.5e-93
WP_000279926.1|1471985_1472825_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 124
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1476731	1477349	2697945		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1476731_1477349_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 125
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1486521	1488219	2697945		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109047.1|1486521_1488219_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 126
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1504872	1511113	2697945		Lactobacillus_phage(33.33%)	6	NA	NA
WP_047928170.1|1504872_1505877_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	42.2	3.3e-25
WP_031589187.1|1506208_1507051_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467991.1|1507087_1507747_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569289.1|1507750_1508776_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	3.1e-31
WP_001036648.1|1509072_1510215_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_160179538.1|1510207_1511113_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.4	6.5e-49
>prophage 127
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1534893	1537669	2697945		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072580.1|1534893_1536120_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.1	4.8e-47
WP_000028670.1|1536112_1537669_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.3	1.4e-288
>prophage 128
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1552050	1555070	2697945		Staphylococcus_phage(33.33%)	3	NA	NA
WP_000212549.1|1552050_1552383_-	hypothetical protein	NA	A0A0N9SJ02	Staphylococcus_phage	54.8	1.7e-10
WP_047928163.1|1552883_1553729_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	40.1	7.7e-52
WP_000800379.1|1554317_1555070_+	S8 family serine peptidase	NA	A0A1W6JND5	Lactococcus_phage	32.2	9.6e-14
>prophage 129
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1559986	1563019	2697945		Hokovirus(50.0%)	2	NA	NA
WP_000424964.1|1559986_1561528_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1561552_1563019_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 130
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1571978	1573502	2697945		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930501.1|1571978_1573502_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.6	1.9e-40
>prophage 131
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1580971	1589388	2697945	integrase	Staphylococcus_phage(66.67%)	12	1579010:1579024	1585425:1585439
1579010:1579024	attL	TTTAATGCAATAACA	NA	NA	NA	NA
WP_001808003.1|1580971_1581109_+	hypothetical protein	NA	Q4ZE80	Staphylococcus_phage	75.6	2.8e-12
WP_115304765.1|1581207_1581435_+|integrase	tyrosine-type recombinase/integrase	integrase	Q4ZE80	Staphylococcus_phage	66.0	5.1e-11
WP_001817700.1|1581556_1582495_+	Abi family protein	NA	NA	NA	NA	NA
WP_000897044.1|1582760_1583003_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_000934799.1|1583054_1583558_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1583578_1583875_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1584118_1584310_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1584395_1585493_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
1585425:1585439	attR	TGTTATTGCATTAAA	NA	NA	NA	NA
WP_000157345.1|1585504_1585708_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_001077602.1|1585737_1586619_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001566903.1|1586775_1587621_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655707.1|1588284_1589388_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	29.0	4.6e-12
>prophage 132
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1599324	1600167	2697945		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209566.1|1599324_1600167_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	7.7e-12
>prophage 133
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1621437	1624172	2697945		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280799.1|1621437_1622460_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	6.7e-10
WP_001191945.1|1622437_1623382_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449066.1|1623371_1624172_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.9	1.2e-41
>prophage 134
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1642408	1643086	2697945		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911017.1|1642408_1643086_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-31
>prophage 135
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1658756	1663196	2697945		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549287.1|1658756_1663196_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	25.6	6.3e-28
>prophage 136
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1673801	1675463	2697945		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_000570070.1|1673801_1674461_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
WP_000736783.1|1674512_1675463_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 137
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1684700	1686137	2697945		Pandoravirus(100.0%)	1	NA	NA
WP_000164009.1|1684700_1686137_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.8	2.8e-30
>prophage 138
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1689897	1694436	2697945		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925394.1|1689897_1691637_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
WP_000608832.1|1691896_1692571_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975345.1|1692714_1694436_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 139
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1704444	1705488	2697945		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645615.1|1704444_1705488_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.0	1.2e-14
>prophage 140
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1712702	1714232	2697945		Vibrio_phage(100.0%)	1	NA	NA
WP_000838204.1|1712702_1714232_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 141
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1723108	1724614	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047928108.1|1723108_1724614_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	2.3e-38
>prophage 142
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1735758	1741117	2697945		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1735758_1738008_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837103.1|1738595_1739564_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127982.1|1739560_1741117_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 143
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1751327	1753387	2697945		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818915.1|1751327_1752425_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166921.1|1752808_1753387_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	40.1	4.3e-14
>prophage 144
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1761921	1765063	2697945		Planktothrix_phage(50.0%)	2	NA	NA
WP_047928087.1|1761921_1763514_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.5e-16
WP_001558793.1|1764385_1765063_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.4	1.6e-20
>prophage 145
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1768978	1769659	2697945		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571406.1|1768978_1769659_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	3.8e-33
>prophage 146
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1786449	1787634	2697945		Klosneuvirus(100.0%)	1	NA	NA
WP_001084436.1|1786449_1787634_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.2	9.2e-35
>prophage 147
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1801725	1802751	2697945		Catovirus(100.0%)	1	NA	NA
WP_000706137.1|1801725_1802751_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 148
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1806290	1809521	2697945		Bacillus_virus(50.0%)	4	NA	NA
WP_000590844.1|1806290_1807031_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	2.2e-39
WP_000171919.1|1807372_1807885_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356963.1|1808063_1808267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013481.1|1808561_1809521_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
>prophage 149
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1812861	1815346	2697945		Catovirus(50.0%)	2	NA	NA
WP_000723449.1|1812861_1814007_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.1	3.2e-24
WP_000779492.1|1814083_1815346_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	3.3e-22
>prophage 150
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1822181	1828746	2697945		Catovirus(50.0%)	6	NA	NA
WP_000413171.1|1822181_1823306_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
WP_001028286.1|1823309_1824419_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1824431_1825460_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_160179464.1|1825449_1827273_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.0	2.3e-29
WP_000565293.1|1827292_1828057_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037328.1|1828059_1828746_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 151
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1832771	1833947	2697945		Clostridium_phage(100.0%)	1	NA	NA
WP_000469819.1|1832771_1833947_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	28.1	2.3e-30
>prophage 152
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1839285	1840059	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078092.1|1839285_1840059_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 153
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1848096	1848696	2697945		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1848096_1848696_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 154
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1853632	1854613	2697945		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_160179468.1|1853632_1854613_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4UUK0	Bodo_saltans_virus	37.5	7.8e-48
>prophage 155
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1857982	1859185	2697945		Tupanvirus(100.0%)	1	NA	NA
WP_047928032.1|1857982_1859185_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.1	5.1e-09
>prophage 156
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1867451	1871661	2697945		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1867451_1868432_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045111.1|1868662_1869655_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_160179470.1|1869670_1870666_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136636.1|1870662_1871661_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.2e-14
>prophage 157
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1902337	1903405	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000816127.1|1902337_1903405_-	persulfide response sulfurtransferase CstA	NA	A0A2H4PQR9	Staphylococcus_phage	41.5	3.5e-09
>prophage 158
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1910996	1921006	2697945		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|1910996_1911797_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104166.1|1912192_1912981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061743967.1|1912981_1914316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|1914308_1916135_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000101976.1|1916147_1916849_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_047928004.1|1918044_1919328_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	2.3e-68
WP_000375647.1|1919605_1921006_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 159
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1927696	1936736	2697945	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884326.1|1927696_1928983_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177462.1|1929361_1930876_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	1.5e-90
WP_000449218.1|1931201_1932014_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_047927991.1|1932101_1934765_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	2.1e-119
WP_031588484.1|1934801_1936736_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	7.4e-143
>prophage 160
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1946818	1953243	2697945		Faecalibacterium_phage(25.0%)	8	NA	NA
WP_000742837.1|1946818_1947658_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
WP_000491382.1|1947975_1948329_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|1948396_1948792_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054118.1|1949051_1949621_+	helix-turn-helix domain-containing protein	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|1949738_1949939_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
WP_000672041.1|1950331_1950523_-	peptide resistance ABC transporter activity modulator VraH	NA	NA	NA	NA	NA
WP_000143651.1|1950614_1952495_-	peptide resistance ABC transporter permease subunit VraE	NA	NA	NA	NA	NA
WP_000154162.1|1952484_1953243_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 161
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1968925	1969939	2697945		Faustovirus(100.0%)	1	NA	NA
WP_000639185.1|1968925_1969939_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	25.9	9.6e-09
>prophage 162
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	1982185	1982878	2697945		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185863.1|1982185_1982878_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 163
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2008960	2010820	2697945		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125611.1|2008960_2010820_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 164
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2036425	2038177	2697945		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143426.1|2036425_2037313_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	3.3e-05
WP_000923760.1|2037421_2038177_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 165
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2041597	2042095	2697945		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|2041597_2042095_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 166
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2047143	2049527	2697945		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071717.1|2047143_2048994_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	1.2e-235
WP_000173329.1|2048990_2049527_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.6	1.3e-41
>prophage 167
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2054404	2064517	2697945	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2054404_2056114_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2056391_2056604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708241.1|2056883_2057327_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172340.1|2057520_2059119_+	acetyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
WP_031775001.1|2059178_2059508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2059803_2061300_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031402.1|2061492_2062383_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.6e-07
WP_001807954.1|2062505_2062922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030070.1|2063179_2064517_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	3.0e-18
>prophage 168
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2093316	2097234	2697945		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000751276.1|2093316_2094018_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	45.9	4.4e-37
WP_160179483.1|2094423_2094912_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_031588406.1|2095422_2097234_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 169
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2105658	2109710	2697945		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_160179485.1|2105658_2106657_+	D-lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	32.6	2.0e-35
WP_000076661.1|2106746_2106953_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024129.1|2107301_2109710_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	41.0	2.9e-128
>prophage 170
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2118944	2121980	2697945	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001058990.1|2118944_2121050_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.3	1.2e-117
WP_000455986.1|2121458_2121980_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.7	1.2e-26
>prophage 171
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2129327	2135697	2697945		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062652.1|2129327_2131067_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	1.3e-34
WP_000473680.1|2131367_2133434_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2133799_2134210_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_160179487.1|2134251_2134590_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228169.1|2134728_2135697_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	5.2e-12
>prophage 172
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2145410	2146403	2697945		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161536.1|2145410_2146403_-	D-lactate dehydrogenase	NA	M1HYB0	Acanthocystis_turfacea_Chlorella_virus	31.5	1.1e-36
>prophage 173
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2155687	2156383	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160179491.1|2155687_2156383_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.4	2.3e-38
>prophage 174
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2177254	2185547	2697945		Streptococcus_phage(66.67%)	8	NA	NA
WP_000721335.1|2177254_2178121_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	7.5e-79
WP_000966095.1|2178296_2179490_+	MFS transporter	NA	NA	NA	NA	NA
WP_072398205.1|2179500_2179704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000217714.1|2179811_2180120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678764.1|2180263_2180530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078104177.1|2180813_2182622_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	38.1	1.9e-95
WP_000446878.1|2182739_2184209_+	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
WP_001033636.1|2184308_2185547_+	DNA cytosine methyltransferase	NA	A0A141E0F9	Streptococcus_phage	29.5	8.4e-31
>prophage 175
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2194245	2194941	2697945		Bacillus_phage(100.0%)	1	NA	NA
WP_031586057.1|2194245_2194941_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	8.6e-09
>prophage 176
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2199864	2200683	2697945		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824946.1|2199864_2200683_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	28.7	1.0e-08
>prophage 177
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2208591	2210149	2697945		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173866.1|2208591_2209407_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	1.8e-13
WP_000590515.1|2209399_2210149_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 178
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2217290	2221719	2697945		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000923524.1|2217290_2217953_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.3	5.5e-21
WP_000072147.1|2217945_2218722_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026194.1|2219117_2220305_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700923.1|2220366_2221719_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 179
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2225527	2227386	2697945		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000948981.1|2225527_2226754_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
WP_000569120.1|2226750_2227386_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	9.0e-05
>prophage 180
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2245111	2251288	2697945		Bacillus_phage(66.67%)	5	NA	NA
WP_001176863.1|2245111_2246254_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
WP_000779360.1|2246511_2246898_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2247031_2247139_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064816.1|2247766_2249530_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	8.5e-37
WP_000486494.1|2249554_2251288_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.0e-31
>prophage 181
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2254749	2260521	2697945		Staphylococcus_phage(75.0%)	6	NA	NA
WP_160179495.1|2254749_2255865_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	9.2e-21
WP_000286879.1|2255875_2256568_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200945.1|2256578_2257046_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_000783428.1|2257097_2258075_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	7.1e-142
WP_000916704.1|2258076_2259024_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	3.2e-139
WP_000594519.1|2259591_2260521_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 182
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2268345	2269077	2697945		Bacillus_virus(100.0%)	1	NA	NA
WP_000615461.1|2268345_2269077_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.1e-25
>prophage 183
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2285725	2287285	2697945		Escherichia_phage(100.0%)	1	NA	NA
WP_000692645.1|2285725_2287285_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 184
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2308819	2309854	2697945		Bacillus_virus(100.0%)	1	NA	NA
WP_000655972.1|2308819_2309854_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 185
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2321419	2325316	2697945		Hokovirus(33.33%)	4	NA	NA
WP_000477332.1|2321419_2322793_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	1.3e-13
WP_000249497.1|2322785_2323460_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
WP_000761395.1|2323595_2324651_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229920.1|2324650_2325316_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.6e-36
>prophage 186
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2329055	2330264	2697945		Salmonella_phage(100.0%)	1	NA	NA
WP_031775239.1|2329055_2330264_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	7.9e-34
>prophage 187
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2342354	2343254	2697945		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524830.1|2342354_2343254_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	1.2e-15
>prophage 188
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2350621	2351041	2697945		Bacillus_phage(100.0%)	1	NA	NA
WP_000920238.1|2350621_2351041_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.1	1.0e-36
>prophage 189
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2356674	2357556	2697945		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730034.1|2356674_2357556_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	45.9	3.8e-62
>prophage 190
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2365434	2366070	2697945		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|2365434_2366070_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 191
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2379635	2383604	2697945		Staphylococcus_phage(50.0%)	4	NA	NA
WP_011447058.1|2379635_2380274_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JQU5	Staphylococcus_phage	48.1	2.6e-36
WP_000684145.1|2380584_2381709_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.2e-12
WP_000417015.1|2381788_2382742_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.9	2.9e-31
WP_000737705.1|2383103_2383604_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 192
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2387521	2388331	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717388.1|2387521_2388331_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 193
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2407313	2407919	2697945		Pithovirus(100.0%)	1	NA	NA
WP_000913019.1|2407313_2407919_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 194
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2420003	2423171	2697945		Leptospira_phage(100.0%)	1	NA	NA
WP_000592305.1|2420003_2423171_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	1.1e-61
>prophage 195
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2446855	2448522	2697945		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000389660.1|2446855_2447665_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	1.7e-19
WP_047928595.1|2447661_2448522_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	1.3e-09
>prophage 196
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2453954	2459472	2697945	protease	Vibrio_phage(50.0%)	3	NA	NA
WP_000402465.1|2453954_2455091_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7SAX5	Vibrio_phage	27.0	5.4e-08
WP_000655236.1|2457178_2457361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130136.1|2457807_2459472_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.8	1.4e-44
>prophage 197
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2464556	2467654	2697945		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001015492.1|2464556_2465405_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.4	1.7e-43
WP_001808034.1|2465624_2465750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333461.1|2466011_2466620_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_025174343.1|2466913_2467654_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.9	1.5e-14
>prophage 198
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2473975	2475388	2697945		Pandoravirus(100.0%)	1	NA	NA
WP_000169224.1|2473975_2475388_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	3.0e-48
>prophage 199
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2479355	2480918	2697945		Vibrio_phage(100.0%)	1	NA	NA
WP_000792342.1|2479355_2480918_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	1.2e-18
>prophage 200
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2491119	2492088	2697945		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989083.1|2491119_2492088_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.3e-15
>prophage 201
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2507975	2508884	2697945		Klosneuvirus(100.0%)	1	NA	NA
WP_000167871.1|2507975_2508884_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.3	1.4e-27
>prophage 202
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2512474	2519971	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047928587.1|2512474_2519971_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	24.9	3.1e-19
>prophage 203
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2526227	2529047	2697945		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334463.1|2526227_2528033_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.8	5.2e-98
WP_000908180.1|2528264_2529047_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.7	2.6e-09
>prophage 204
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2540238	2544070	2697945		Clostridium_phage(50.0%)	4	NA	NA
WP_000070866.1|2540238_2540682_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_000160304.1|2540802_2541513_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083325.1|2541827_2542490_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242319.1|2542768_2544070_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.7	6.1e-133
>prophage 205
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2552010	2553621	2697945		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2552010_2553621_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 206
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2561423	2569173	2697945		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2561423_2562023_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460242.1|2562023_2563100_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248735.1|2563086_2563923_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_072362259.1|2563955_2565053_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697335.1|2565049_2565472_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654185.1|2565575_2566100_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2566126_2567365_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2567392_2568022_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_047928577.1|2568045_2569173_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.6	1.8e-27
>prophage 207
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2579577	2579973	2697945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000932694.1|2579577_2579973_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 208
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2586081	2586729	2697945		Moumouvirus(100.0%)	1	NA	NA
WP_031590210.1|2586081_2586729_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	8.0e-09
>prophage 209
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2593928	2595449	2697945		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178942.1|2593928_2595449_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 210
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2601120	2603148	2697945		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546584.1|2601120_2603148_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	5.6e-24
>prophage 211
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2608298	2611683	2697945		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621175.1|2608298_2608661_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2609010_2610012_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2610130_2610457_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190829.1|2610458_2610938_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041102.1|2610912_2611683_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 212
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2625783	2630507	2697945		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_031588337.1|2625783_2627313_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
WP_020978284.1|2627342_2628362_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2628483_2628738_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047810.1|2628737_2630507_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	5.3e-63
>prophage 213
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2634267	2649043	2697945	tRNA	Moraxella_phage(16.67%)	11	NA	NA
WP_000159040.1|2634267_2635293_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	5.3e-63
WP_000106313.1|2635721_2637332_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	25.2	6.2e-18
WP_000602069.1|2638286_2640215_-	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	30.4	2.4e-53
WP_001283612.1|2640467_2641103_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_072414299.1|2641457_2642486_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581077.1|2642545_2642770_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052270.1|2642977_2644228_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	4.5e-40
WP_000790330.1|2644410_2645361_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000141414.1|2645509_2646994_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.6	4.0e-19
WP_001253314.1|2646990_2647950_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688498.1|2648326_2649043_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	3.0e-25
>prophage 214
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2656222	2671424	2697945	integrase,capsid	Staphylococcus_phage(46.15%)	17	2658182:2658201	2672511:2672530
WP_000917289.1|2656222_2656507_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240642.1|2656582_2658199_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
2658182:2658201	attL	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
WP_031912621.1|2658267_2659440_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	94.6	2.0e-212
WP_049949256.1|2659449_2660073_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_160179530.1|2660205_2660463_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_031912618.1|2660443_2661085_+	Bro-N domain-containing protein	NA	A0A2H4JB17	uncultured_Caudovirales_phage	83.6	1.0e-96
WP_031912617.1|2661098_2661416_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	96.2	2.3e-49
WP_031912616.1|2661551_2661776_+	hypothetical protein	NA	A0A1W6JPA6	Staphylococcus_phage	61.8	6.8e-16
WP_001103961.1|2661776_2662076_+	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	66.7	5.9e-31
WP_064137301.1|2662167_2664531_+	DNA primase	NA	A0A2H4JCU9	uncultured_Caudovirales_phage	41.3	9.4e-148
WP_001081424.1|2664951_2665296_+	hypothetical protein	NA	A0A1W6JQD5	Staphylococcus_phage	65.2	9.4e-41
WP_047928558.1|2665520_2665727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047928557.1|2665713_2666772_+|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_049949340.1|2666954_2667443_+	pathogenicity island protein	NA	A0A2H4JB26	uncultured_Caudovirales_phage	41.8	9.3e-26
WP_000801979.1|2667863_2668832_+	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	5.9e-24
WP_031792985.1|2669988_2670789_+	staphylococcal enterotoxin type B	NA	A0A097PAT7	Streptococcus_pyogenes_phage	45.9	2.3e-53
WP_001035619.1|2670866_2671424_-	DUF4888 domain-containing protein	NA	A0A1W6JQE5	Staphylococcus_phage	74.3	8.6e-68
2672511:2672530	attR	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
>prophage 215
NZ_CP047807	Staphylococcus aureus strain UP_1612 chromosome, complete genome	2697945	2678380	2697474	2697945	integrase	Staphylococcus_phage(100.0%)	32	2681223:2681237	2689613:2689627
WP_031588767.1|2678380_2679436_+	bi-component leukocidin LukGH subunit H	NA	A0A2I6PDF3	Staphylococcus_phage	32.1	1.3e-35
WP_160179532.1|2679457_2680474_+	bi-component leukocidin LukGH subunit G	NA	A0A1X9IGW5	Staphylococcus_phage	30.6	8.7e-26
2681223:2681237	attL	CTATCATTATCGAAT	NA	NA	NA	NA
WP_000857176.1|2681592_2682630_-|integrase	site-specific integrase	integrase	A7TWL3	Staphylococcus_phage	100.0	3.4e-179
WP_000191460.1|2682737_2683352_+	hypothetical protein	NA	A0A2I6PDE9	Staphylococcus_phage	100.0	1.3e-106
WP_001013104.1|2683348_2683495_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	89.6	1.1e-14
WP_000694772.1|2683530_2683713_-	hypothetical protein	NA	A0A2I6PDF8	Staphylococcus_phage	100.0	6.9e-27
WP_001208482.1|2683912_2684683_-	helix-turn-helix domain-containing protein	NA	A0A1P8L6G7	Staphylococcus_phage	100.0	6.2e-141
WP_000338186.1|2684841_2685066_+	DUF739 family protein	NA	A7TW90	Staphylococcus_phage	100.0	4.5e-36
WP_000435341.1|2685083_2685344_+	transcriptional regulator	NA	A7TW91	Staphylococcus_phage	100.0	2.7e-40
WP_000351243.1|2685367_2685907_-	hypothetical protein	NA	A7TW92	Staphylococcus_phage	100.0	1.7e-97
WP_024928163.1|2685963_2686716_+	oxidoreductase	NA	G4KNN1	Staphylococcus_phage	99.2	3.3e-139
WP_000939496.1|2686959_2687100_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
WP_000275058.1|2687114_2687747_-	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
WP_001120197.1|2687805_2688126_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_000066020.1|2688122_2688284_+	DUF1270 domain-containing protein	NA	A0A2I6PDF7	Staphylococcus_phage	100.0	1.9e-20
WP_000291488.1|2688376_2688637_+	DUF1108 family protein	NA	A0A2I6PDH1	Staphylococcus_phage	100.0	2.6e-43
WP_001205732.1|2688645_2688909_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700557.1|2688917_2690861_+	AAA family ATPase	NA	A0A2I6PDH3	Staphylococcus_phage	98.0	0.0e+00
2689613:2689627	attR	ATTCGATAATGATAG	NA	NA	NA	NA
WP_000138475.1|2690862_2691783_+	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	100.0	2.3e-166
WP_072399433.1|2691911_2692481_+	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	8.4e-87
WP_000934770.1|2692481_2692952_+	single-stranded DNA-binding protein	NA	A0A0E3T9H6	Staphylococcus_phage	99.4	4.8e-80
WP_000148301.1|2692981_2693866_+	DnaD domain protein	NA	S4V6D4	Staphylococcus_phage	95.9	3.1e-136
WP_000338528.1|2693872_2694091_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_000401964.1|2694099_2694504_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0E3XBN4	Staphylococcus_phage	100.0	1.4e-72
WP_031929144.1|2694516_2694888_+	phage protein	NA	A0A2I6PDG3	Staphylococcus_phage	92.7	9.8e-52
WP_001126836.1|2694888_2695137_+	hypothetical protein	NA	A0A2I6PDI0	Staphylococcus_phage	100.0	3.2e-43
WP_000982708.1|2695201_2695651_+	hypothetical protein	NA	A0A2I6PDH2	Staphylococcus_phage	100.0	9.3e-81
WP_001105620.1|2695647_2695932_+	hypothetical protein	NA	A0A2I6PDI3	Staphylococcus_phage	100.0	9.4e-47
WP_000370292.1|2695924_2696179_+	DUF1024 family protein	NA	A0A2I6PDI5	Staphylococcus_phage	100.0	6.5e-39
WP_000265042.1|2696298_2696499_+	DUF1514 domain-containing protein	NA	A0A2I6PDJ9	Staphylococcus_phage	100.0	1.4e-28
WP_000590124.1|2696526_2696943_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	99.3	3.7e-76
WP_000988332.1|2697174_2697474_+	HNH endonuclease	NA	A0A2I6PDH9	Staphylococcus_phage	100.0	3.5e-52
