The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047898	Pseudarthrobacter sp. YJ56 chromosome contig_1, complete sequence	4962517	713483	765809	4962517	integrase,transposase	Sulfolobales_Virus_YNP2(14.29%)	41	763347:763363	767375:767391
WP_160670398.1|713483_714878_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_160670401.1|715011_715188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160670404.1|715586_716600_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_160670407.1|716625_717072_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160670410.1|717286_718126_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_160670413.1|718459_719356_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160670416.1|719467_720268_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_160678863.1|720773_721352_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_160670419.1|721317_722379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160670422.1|722893_723625_+	polyprenol monophosphomannose synthase	NA	A0A0N9P7Z4	Sulfolobales_Virus_YNP2	31.1	3.9e-20
WP_160670425.1|730253_731003_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	24.5	1.3e-07
WP_160670428.1|730999_732556_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_160670431.1|732898_733279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160670434.1|733475_733748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160678865.1|733813_734014_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_160670437.1|734010_734379_+	death-on-curing protein	NA	A0A1B3AYM0	Gordonia_phage	53.1	6.4e-11
WP_160670440.1|735664_736279_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_160670443.1|737361_737637_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_160670446.1|737636_739019_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_160670449.1|739990_740392_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_160670452.1|741664_742339_-	response regulator	NA	NA	NA	NA	NA
WP_160678867.1|742335_743925_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_160670455.1|744419_745277_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	3.4e-31
WP_160670458.1|745273_746146_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_160678869.1|746219_747323_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160670461.1|747545_747782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160670463.1|748908_749571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160670466.1|749794_751267_+	hypothetical protein	NA	A0A1S5SEW3	Streptococcus_phage	33.8	5.6e-34
WP_160670469.1|751275_751854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160670398.1|752121_753516_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_160670472.1|753904_754198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160670475.1|754286_755624_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_160670478.1|755877_756168_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	41.3	6.1e-09
WP_160670481.1|757563_758265_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_160670484.1|758571_758754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160670487.1|759130_760654_+	aromatic amino acid lyase	NA	NA	NA	NA	NA
WP_160670490.1|761018_761618_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_160670493.1|761744_762479_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_160670496.1|762601_763225_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
763347:763363	attL	GTCGGCCGGTCCACCGT	NA	NA	NA	NA
WP_160678871.1|763773_764361_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	46.2	8.5e-34
WP_160670499.1|764357_765809_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
767375:767391	attR	GTCGGCCGGTCCACCGT	NA	NA	NA	NA
>prophage 2
NZ_CP047898	Pseudarthrobacter sp. YJ56 chromosome contig_1, complete sequence	4962517	1267741	1308909	4962517	integrase,tRNA,protease,tail	Tupanvirus(16.67%)	42	1296317:1296358	1309310:1309351
WP_160671522.1|1267741_1271128_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9V7W4	Bandra_megavirus	32.2	7.1e-149
WP_160671525.1|1271483_1272578_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_160671528.1|1273503_1274307_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_160671531.1|1274331_1274697_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_160671534.1|1274748_1277367_+|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	36.4	1.2e-156
WP_160671537.1|1277722_1278337_-	DsbA family protein	NA	NA	NA	NA	NA
WP_056340575.1|1278406_1279687_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.3	1.1e-137
WP_104060840.1|1279868_1280528_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	42.3	3.2e-37
WP_160671540.1|1280566_1281190_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	51.4	1.6e-43
WP_160671543.1|1283259_1284195_-	Fpg/Nei family DNA glycosylase	NA	A0A1V0CNR6	Kaumoebavirus	30.1	1.5e-08
WP_160671546.1|1284194_1284689_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_160671549.1|1284767_1285784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160671552.1|1288477_1288951_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
WP_160671555.1|1290088_1290781_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_160671558.1|1290785_1291238_+	globin	NA	NA	NA	NA	NA
WP_160671561.1|1291291_1291948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160671564.1|1292011_1292992_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_160671567.1|1293088_1294771_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.5	3.4e-43
WP_160678953.1|1294817_1295099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160671570.1|1295483_1296068_-	single-stranded DNA-binding protein	NA	A0A1V0E648	Streptomyces_phage	45.8	3.0e-15
1296317:1296358	attL	CTAATCCGCCGGTCGGGGGTTCGATTCCCTCCTGGGGCACAA	NA	NA	NA	NA
WP_160671573.1|1296451_1296775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160671576.1|1296767_1297064_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A222ZES9	Arthrobacter_phage	54.9	1.3e-22
WP_160671579.1|1297063_1297957_-|integrase	site-specific integrase	integrase	A0A222ZES9	Arthrobacter_phage	49.1	1.1e-64
WP_160671582.1|1297949_1298444_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_160671585.1|1298582_1298801_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160671588.1|1298911_1299097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160671591.1|1299093_1299282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160671593.1|1299278_1299521_+	DUF3039 domain-containing protein	NA	NA	NA	NA	NA
WP_160671596.1|1299631_1300306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160671599.1|1300302_1300587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160671602.1|1300583_1300727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160671605.1|1300723_1301077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160671608.1|1301077_1301257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160671611.1|1301253_1301892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160671614.1|1301888_1302338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160671617.1|1302680_1303220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160671620.1|1303253_1303922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160671623.1|1303925_1304090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160671626.1|1304496_1304796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160671629.1|1304963_1305347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160671632.1|1305454_1305829_+	hypothetical protein	NA	A0A249XNM6	Brevibacterium_phage	44.6	1.1e-15
WP_160671635.1|1305825_1308909_+|tail	phage tail tape measure protein	tail	I3NL90	Bifidobacterium_phage	40.3	4.1e-87
1309310:1309351	attR	CTAATCCGCCGGTCGGGGGTTCGATTCCCTCCTGGGGCACAA	NA	NA	NA	NA
>prophage 3
NZ_CP047898	Pseudarthrobacter sp. YJ56 chromosome contig_1, complete sequence	4962517	2286093	2295911	4962517	transposase	Escherichia_phage(50.0%)	11	NA	NA
WP_160670242.1|2286093_2287635_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_160673664.1|2287890_2288298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160670428.1|2288520_2290077_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_160670425.1|2290073_2290823_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	24.5	1.3e-07
WP_160673667.1|2291705_2291846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160672855.1|2291892_2293182_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_160679076.1|2293348_2294263_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_160673670.1|2294259_2295018_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	41.5	2.2e-50
WP_160673673.1|2295041_2295350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160673676.1|2295615_2295753_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_160673679.1|2295749_2295911_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP047898	Pseudarthrobacter sp. YJ56 chromosome contig_1, complete sequence	4962517	3647899	3681012	4962517	holin,transposase	Shigella_phage(40.0%)	27	NA	NA
WP_160676528.1|3647899_3649189_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_160676531.1|3649430_3650444_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.2	2.9e-29
WP_160670478.1|3650577_3650868_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	41.3	6.1e-09
WP_160676534.1|3651769_3651907_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_160676537.1|3653355_3653706_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160676540.1|3653707_3654079_+	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_160676543.1|3654075_3654885_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	3.4e-25
WP_160676546.1|3654881_3655643_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_160676549.1|3655741_3656611_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_160676552.1|3656666_3656885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160676555.1|3659417_3660101_-	response regulator	NA	W8CYM9	Bacillus_phage	29.6	1.3e-25
WP_160676558.1|3660097_3662674_-	sensor histidine kinase KdpD	NA	NA	NA	NA	NA
WP_160676562.1|3664383_3665640_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_160676565.1|3666561_3667407_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160676568.1|3667773_3668517_-	GAF and ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_160676571.1|3668657_3669440_-	GAF and ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_160679307.1|3669451_3669697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160676574.1|3669696_3670428_-	GAF and ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_160676577.1|3670629_3671616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160679309.1|3671826_3672630_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_160679311.1|3672859_3673513_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160676580.1|3673584_3674352_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_160676583.1|3674568_3675162_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_160676586.1|3675217_3675649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160676589.1|3676218_3678279_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_160676592.1|3678406_3679606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160676595.1|3679808_3681012_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.0	3.8e-28
