The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047679	Serratia marcescens strain 4201 chromosome, complete genome	5331789	810132	888821	5331789	tRNA,integrase,plate,tail	Salmonella_phage(23.53%)	76	817501:817526	838292:838317
WP_033641888.1|810132_811179_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_101453529.1|811156_811921_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.3	7.4e-54
WP_004932585.1|811914_812541_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	5.3e-34
WP_123061395.1|812848_813865_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	37.5	3.1e-07
WP_019455119.1|813919_814918_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.2e-32
WP_160203971.1|814997_817559_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.0	1.1e-27
817501:817526	attL	AGGTACTGCTGCATCATCGGCGTGTG	NA	NA	NA	NA
WP_160203972.1|817717_819178_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PGY7	Moraxella_phage	26.6	1.1e-21
WP_160203973.1|819174_820437_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_160203974.1|820433_822452_+	RNA-directed DNA polymerase	NA	A0A0H4TEY7	Erysipelothrix_phage	26.5	1.8e-30
WP_160203975.1|822717_823317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160203976.1|823331_824297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160203977.1|824410_824848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032417543.1|824874_825093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064189535.1|825291_825846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160203978.1|826278_827478_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_102011737.1|827461_828976_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_160203979.1|828963_830961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105577148.1|830941_831361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102011740.1|831582_831996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160203980.1|832383_832674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112001669.1|832685_833276_-	DUF4755 domain-containing protein	NA	NA	NA	NA	NA
WP_160203981.1|833484_834657_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_160203982.1|834662_835028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160203983.1|835603_837799_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_047572624.1|838902_839520_-	cell division protein Fic	NA	NA	NA	NA	NA
838292:838317	attR	AGGTACTGCTGCATCATCGGCGTGTG	NA	NA	NA	NA
WP_033644195.1|839714_840599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122004202.1|840737_841709_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_101453863.1|841721_842480_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.9	7.2e-17
WP_042783708.1|842628_843522_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004932561.1|843939_844257_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_033641899.1|844269_845631_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_101453528.1|845674_847060_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_004932550.1|847075_847924_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_160203984.1|848072_848834_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_033641904.1|848843_850223_-	MFS transporter	NA	NA	NA	NA	NA
WP_033641905.1|850466_850955_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	46.1	1.0e-24
WP_004932541.1|851066_852131_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	1.7e-112
WP_160203985.1|852191_852707_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_033641907.1|852840_855468_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.7	3.2e-80
WP_004091602.1|855720_855906_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_033641908.1|857260_857827_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_004932520.1|857823_858252_+	DedA family protein	NA	NA	NA	NA	NA
WP_033641909.1|858334_859897_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_033641910.1|860063_860579_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_016929024.1|860644_861934_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004932506.1|861976_862768_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004932504.1|862937_864299_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004932501.1|864513_864762_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_019455135.1|864780_865329_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_046688258.1|865381_866149_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015376707.1|866197_866554_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_160203986.1|866697_866925_-	transcriptional regulator	NA	Q37973	Salmonella_virus	65.7	4.6e-20
WP_069101122.1|867014_868109_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	49.7	2.5e-103
WP_033641914.1|868105_868579_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	57.2	8.1e-43
WP_033641915.1|868601_870695_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	45.5	2.4e-14
WP_033641916.1|870687_870810_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	74.3	2.8e-08
WP_033641917.1|870842_871130_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	58.9	3.0e-24
WP_033641919.1|871194_871704_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	69.0	1.6e-65
WP_033641920.1|871716_872886_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	79.9	5.8e-183
WP_050594401.1|873026_873584_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	39.6	1.7e-28
WP_033641921.1|873583_875461_-|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	53.2	1.0e-59
WP_122016508.1|875457_878751_-|tail	phage tail protein I	tail	G5DEL7	Salmonella_phage	48.8	1.5e-273
WP_033641923.1|878743_879652_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	76.5	1.5e-122
WP_033641924.1|879656_880007_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	4.4e-38
WP_033641925.1|880003_880639_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	55.0	3.2e-58
WP_033641926.1|880724_881189_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	52.6	1.7e-37
WP_046688264.1|881242_881755_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	64.1	1.1e-58
WP_033641928.1|881738_881957_-	hypothetical protein	NA	B6SD15	Bacteriophage	50.9	8.1e-06
WP_033641929.1|881960_882164_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	68.7	1.8e-20
WP_033641930.1|882355_882550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080273365.1|882613_884710_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	48.4	5.9e-194
WP_033641931.1|884693_884915_-	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	56.5	6.9e-13
WP_033641932.1|884993_885299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160203987.1|885541_886438_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	53.1	5.8e-82
WP_033641933.1|886484_887249_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016929016.1|887744_888821_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	9.0e-90
>prophage 3
NZ_CP047679	Serratia marcescens strain 4201 chromosome, complete genome	5331789	2193790	2220829	5331789	protease,coat	Moraxella_phage(50.0%)	25	NA	NA
WP_046686934.1|2193790_2195209_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_033642834.1|2195355_2195565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033638276.1|2196344_2196737_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_160204205.1|2196741_2197341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033642836.1|2197396_2197636_-	YebV family protein	NA	NA	NA	NA	NA
WP_033644260.1|2197771_2198704_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_160204712.1|2198723_2201066_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_046686936.1|2201217_2201985_-	molecular chaperone	NA	NA	NA	NA	NA
WP_033642838.1|2202005_2202548_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033642839.1|2202541_2203045_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_046686938.1|2203047_2203584_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_033642841.1|2203856_2204393_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_139120317.1|2204658_2206095_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_033644262.1|2206197_2208828_-	PqiB family protein	NA	NA	NA	NA	NA
WP_033644263.1|2208796_2210044_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_046686940.1|2210299_2210797_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004931497.1|2210893_2211604_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033642845.1|2211623_2213672_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	1.5e-85
WP_160204206.1|2213738_2214584_-	DMT family transporter	NA	NA	NA	NA	NA
WP_042784329.1|2214580_2215888_-	opine metallophore biosynthesis dehydrogenase	NA	NA	NA	NA	NA
WP_033642848.1|2215880_2216678_-	nicotianamine synthase	NA	NA	NA	NA	NA
WP_047026224.1|2216665_2217451_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	8.8e-10
WP_052133798.1|2217447_2218488_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_042784331.1|2218490_2219582_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033652481.1|2219950_2220829_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NZ_CP047679	Serratia marcescens strain 4201 chromosome, complete genome	5331789	2234575	2303973	5331789	protease,terminase,head,tRNA,integrase,lysis,coat	Cronobacter_phage(31.25%)	80	2252856:2252872	2296939:2296955
WP_033652468.1|2234575_2235856_-|protease	protease	protease	NA	NA	NA	NA
WP_025302601.1|2236041_2236602_+	membrane protein	NA	NA	NA	NA	NA
WP_033642864.1|2236637_2237507_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_033652467.1|2237747_2238602_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_016927980.1|2238601_2239462_-	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_033642866.1|2239461_2240352_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	28.1	4.2e-08
WP_033642867.1|2240348_2241293_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033642868.1|2241424_2241724_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_004931439.1|2241833_2242499_+	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	46.3	1.0e-06
WP_160204210.1|2242803_2243529_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_004931432.1|2243531_2245313_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_129993130.1|2245325_2246663_+	cytochrome c	NA	NA	NA	NA	NA
WP_102948152.1|2246920_2248204_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_160204211.1|2248354_2249488_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046686950.1|2249525_2250212_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_047576023.1|2250319_2250547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033642876.1|2250770_2251820_+	YrzE family protein	NA	NA	NA	NA	NA
WP_160204212.1|2252059_2252683_+	hypothetical protein	NA	NA	NA	NA	NA
2252856:2252872	attL	CATGTGATCTGTCGTGT	NA	NA	NA	NA
WP_160204213.1|2253032_2254235_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	60.4	3.8e-137
WP_071532844.1|2254198_2254447_-	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	53.0	1.6e-13
WP_160204214.1|2254629_2255277_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	76.4	1.9e-90
WP_160204215.1|2255273_2255462_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160204216.1|2255476_2255857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160204713.1|2255859_2256048_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	48.2	5.3e-06
WP_142590549.1|2256161_2256947_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.4	9.3e-60
WP_160204217.1|2257786_2257984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160204218.1|2258001_2258202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160204714.1|2258943_2259537_-	LexA family transcriptional regulator	NA	Q76H56	Enterobacteria_phage	61.0	1.8e-15
WP_041033757.1|2259647_2259860_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	75.4	1.4e-23
WP_041033759.1|2259885_2260176_+	hypothetical protein	NA	I6PCV6	Cronobacter_phage	44.0	7.2e-10
WP_160204219.1|2260184_2260334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089192596.1|2260514_2261159_+	phage regulatory protein/antirepressor Ant	NA	A0A2I7RHG4	Vibrio_phage	48.8	4.3e-47
WP_160204220.1|2261161_2261338_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	51.0	1.4e-08
WP_160204221.1|2262595_2263570_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	40.9	2.3e-68
WP_160204222.1|2263566_2263923_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	66.4	4.1e-39
WP_060706489.1|2263919_2264318_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	56.1	2.2e-33
WP_033646506.1|2265596_2265842_+|lysis	lysis protein	lysis	A0A127KNH9	Pseudomonas_phage	36.2	1.2e-05
WP_160204715.1|2265850_2266327_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	61.6	2.4e-50
WP_160204223.1|2266326_2266695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160204224.1|2266855_2267410_-	hypothetical protein	NA	S4TR57	Salmonella_phage	30.9	1.3e-10
WP_033646503.1|2267509_2267764_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	65.5	2.0e-24
WP_160204225.1|2267814_2268060_+	DUF2560 family protein	NA	NA	NA	NA	NA
WP_160204226.1|2268809_2269253_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.4	7.1e-49
WP_160204227.1|2269256_2270747_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	80.7	6.0e-241
WP_160204228.1|2270757_2272185_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	65.0	1.3e-168
WP_160204716.1|2272252_2273134_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.3	3.2e-109
WP_160204229.1|2273167_2273803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160204230.1|2273854_2275243_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	58.5	1.1e-148
WP_160204231.1|2275246_2275684_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	64.1	2.2e-42
WP_046688419.1|2275694_2276771_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	75.4	1.0e-154
WP_160204232.1|2276780_2277182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160204717.1|2277181_2277562_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	77.0	1.6e-49
WP_160204233.1|2277656_2278004_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	59.5	2.9e-29
WP_060431663.1|2278005_2278374_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	75.4	1.2e-46
WP_160204234.1|2278370_2278754_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	63.0	8.6e-43
WP_160204235.1|2278778_2279537_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	79.1	6.6e-79
WP_160204236.1|2279588_2280263_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	56.2	7.4e-66
WP_160204237.1|2280409_2280952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060660822.1|2281064_2281265_+	lipoprotein	NA	NA	NA	NA	NA
WP_160204238.1|2281339_2281813_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	42.7	1.9e-23
WP_160204239.1|2281855_2282206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160204240.1|2282356_2282638_+	hypothetical protein	NA	A0A1V0E5N1	Salmonella_phage	47.8	1.2e-17
WP_160204241.1|2282700_2285829_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	50.7	1.9e-188
WP_046688430.1|2285866_2286334_+	hypothetical protein	NA	A0A173GC35	Salmonella_phage	64.1	3.2e-52
WP_160204242.1|2286334_2286805_+	DUF1833 domain-containing protein	NA	R9TPR6	Aeromonas_phage	57.5	1.4e-47
WP_160204718.1|2286824_2287217_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	63.9	2.1e-44
WP_160204243.1|2287176_2289669_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	54.9	3.1e-258
WP_160204244.1|2289669_2291586_+	sialate O-acetylesterase	NA	A0A286S1P0	Klebsiella_phage	47.8	3.2e-162
WP_160204245.1|2291585_2292344_+	hypothetical protein	NA	A0A286S1R5	Klebsiella_phage	46.2	1.2e-48
WP_033637997.1|2292491_2292914_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	55.0	3.0e-33
WP_160204246.1|2292913_2294182_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	71.3	2.0e-176
WP_160204719.1|2294423_2295722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160204247.1|2296009_2296717_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	53.7	7.1e-67
WP_025159696.1|2296984_2298913_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.5e-132
2296939:2296955	attR	CATGTGATCTGTCGTGT	NA	NA	NA	NA
WP_048233542.1|2298916_2299468_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_004931418.1|2299566_2299764_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004931417.1|2299807_2300164_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_147880682.1|2300230_2300326_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_043143373.1|2300587_2301571_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	2.2e-34
WP_089196984.1|2301585_2303973_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.0	3.1e-05
>prophage 5
NZ_CP047679	Serratia marcescens strain 4201 chromosome, complete genome	5331789	3870631	3877725	5331789		Salmonella_phage(33.33%)	10	NA	NA
WP_033644018.1|3870631_3870985_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	47.0	1.6e-19
WP_033644019.1|3871185_3871416_+	hypothetical protein	NA	J9Q735	Salmonella_phage	50.7	4.2e-13
WP_033644020.1|3871429_3871969_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	56.6	4.0e-46
WP_025159568.1|3871982_3872684_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_016926729.1|3872956_3873472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016926728.1|3873505_3873754_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_033644021.1|3873801_3875091_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.2	7.8e-64
WP_004941642.1|3875167_3875794_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025303843.1|3876049_3877087_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.9	3.8e-69
WP_033644022.1|3877086_3877725_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.2	3.2e-26
>prophage 6
NZ_CP047679	Serratia marcescens strain 4201 chromosome, complete genome	5331789	4039993	4102750	5331789	portal,terminase,head,tail,capsid,tRNA,integrase,holin	Cronobacter_phage(62.5%)	68	4069445:4069460	4109601:4109616
WP_033644114.1|4039993_4040500_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	32.2	4.5e-07
WP_160204498.1|4040617_4041670_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_070914447.1|4041715_4042372_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_160204499.1|4042375_4043737_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_033644118.1|4043755_4044649_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_033644119.1|4044816_4045665_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160204500.1|4045718_4045979_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	2.9e-18
WP_004929169.1|4046025_4046406_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_033651585.1|4046405_4047137_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_015378804.1|4047208_4047940_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004929162.1|4047946_4048855_-	GTPase Era	NA	NA	NA	NA	NA
WP_004929158.1|4048851_4049532_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.3	9.6e-21
WP_033644122.1|4049766_4050744_-	signal peptidase I	NA	NA	NA	NA	NA
WP_019452315.1|4050776_4052576_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.4	2.5e-23
WP_033644123.1|4053095_4053932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033644124.1|4053928_4054405_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_160204501.1|4054404_4055361_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_033644125.1|4055360_4056014_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_004929136.1|4056044_4056620_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_160204502.1|4056798_4058436_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_033644126.1|4058474_4059254_-	methyltransferase	NA	NA	NA	NA	NA
WP_016929798.1|4059353_4060676_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	27.3	3.6e-40
WP_160204503.1|4060728_4061484_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_033644128.1|4061476_4062436_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_004929114.1|4062620_4063004_-	autonomous glycyl radical cofactor GrcA	NA	C3V1I5	Escherichia_virus	70.2	6.1e-33
WP_004929112.1|4063350_4064034_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.4	1.1e-53
WP_089195095.1|4064090_4064675_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004929107.1|4064800_4065679_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_033644129.1|4065765_4067427_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004929101.1|4067667_4068006_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004929098.1|4069430_4069715_-	RnfH family protein	NA	NA	NA	NA	NA
4069445:4069460	attL	TTTCTGCCCGTTGCCG	NA	NA	NA	NA
WP_086016675.1|4069707_4070196_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_016929804.1|4070303_4070786_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	44.9	3.2e-26
WP_160204504.1|4071394_4072210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160204505.1|4072860_4074003_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_160204506.1|4074309_4075971_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	54.1	1.4e-169
WP_076741080.1|4075967_4076528_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	58.8	1.3e-50
WP_160204507.1|4076502_4077225_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	39.4	1.1e-38
WP_123061539.1|4077214_4077643_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.2	5.8e-24
WP_160204508.1|4077645_4080825_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	65.9	7.0e-106
WP_160204509.1|4080830_4081436_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	68.2	4.5e-70
WP_160204510.1|4081428_4082613_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	67.3	1.1e-152
WP_047730045.1|4082590_4082938_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.7	5.2e-31
WP_160204511.1|4082937_4085469_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	52.4	1.2e-137
WP_123061536.1|4085656_4085926_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	1.1e-20
WP_160204512.1|4086073_4086418_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	57.7	2.1e-24
WP_103681986.1|4086417_4086759_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	77.2	1.6e-40
WP_160204513.1|4086745_4087048_-|holin	holin	holin	C7BGD7	Burkholderia_phage	54.1	2.4e-16
WP_047730038.1|4087057_4087513_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	64.2	9.2e-52
WP_076741074.1|4087509_4088634_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	65.6	1.0e-139
WP_047730036.1|4088630_4089341_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	66.5	1.6e-82
WP_103681983.1|4089337_4089841_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	44.5	5.6e-34
WP_103681982.1|4089837_4090290_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	54.0	1.2e-38
WP_160204514.1|4090389_4091094_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	60.9	8.9e-78
WP_160204515.1|4091099_4092116_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	76.3	5.3e-140
WP_160204516.1|4092164_4093004_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	44.4	3.8e-59
WP_160204517.1|4093169_4094951_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	70.3	4.8e-245
WP_160204518.1|4094947_4095997_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.6	6.4e-141
WP_160204519.1|4095993_4096320_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	63.7	3.4e-32
WP_160204737.1|4096599_4098648_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	66.5	1.3e-259
WP_060437277.1|4098751_4098991_-	DUF2732 family protein	NA	A0A0F7LBR4	Escherichia_phage	61.1	5.6e-08
WP_160204520.1|4099069_4099519_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	56.3	3.8e-34
WP_060437281.1|4099521_4099941_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	55.7	5.7e-32
WP_047730024.1|4099943_4100147_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_047730023.1|4100156_4100666_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	51.3	2.2e-38
WP_047730856.1|4100698_4100959_-	hypothetical protein	NA	F1BUS7	Erwinia_phage	46.0	5.9e-11
WP_160204521.1|4101115_4101679_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	42.4	3.1e-33
WP_160204522.1|4101682_4102750_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	79.9	1.2e-163
4109601:4109616	attR	CGGCAACGGGCAGAAA	NA	NA	NA	NA
>prophage 7
NZ_CP047679	Serratia marcescens strain 4201 chromosome, complete genome	5331789	4953955	4962883	5331789		environmental_Halophage(16.67%)	7	NA	NA
WP_129993646.1|4953955_4956034_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	71.9	1.0e-52
WP_129993645.1|4956074_4957292_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.4	4.7e-26
WP_033645386.1|4957423_4957999_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	63.2	6.1e-69
WP_033645261.1|4958071_4959595_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.6	1.9e-77
WP_160204667.1|4959746_4960472_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_044029984.1|4960471_4962157_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	72.8	1.2e-224
WP_060660178.1|4962313_4962883_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	31.7	1.3e-07
>prophage 1
NZ_CP047680	Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence	94056	2915	30136	94056	integrase,transposase	Salmonella_phage(33.33%)	28	16504:16517	22577:22590
WP_004197635.1|2915_3710_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_017899884.1|3907_4924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389906.1|4934_5249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380813.1|5275_5635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023785.1|5839_6145_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001568025.1|6146_6365_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001261282.1|6952_7183_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|7179_7596_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|7669_9232_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|9216_10239_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000427619.1|11772_12777_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|12855_13290_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|13361_13712_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|13725_14001_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|14036_14459_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|14510_16205_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|16222_16585_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
16504:16517	attL	GCGGCGCGCGGCGT	NA	NA	NA	NA
WP_000993386.1|16581_16818_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|16814_17522_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|17560_18865_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|18911_19616_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014343468.1|19655_20129_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_013213985.1|20251_21232_+|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_004199234.1|21507_22389_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213989.1|24248_24674_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
22577:22590	attR	GCGGCGCGCGGCGT	NA	NA	NA	NA
WP_013213990.1|24784_25063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161490.1|26605_27166_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|27169_30136_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
