The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047648	Klebsiella pneumoniae strain 156070 chromosome, complete genome	5415677	449452	482710	5415677	protease,integrase,tRNA,capsid,terminase,head,tail,portal	uncultured_Caudovirales_phage(73.33%)	33	467060:467077	483055:483072
WP_002919147.1|449452_450400_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|450414_450924_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|451052_452177_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|452148_452622_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|452647_453190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|453194_453767_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|453770_454589_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|454585_454843_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|454818_455373_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|461168_461390_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|461683_464794_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|464806_465946_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|466324_466975_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
467060:467077	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|467250_468477_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|468569_469511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|469692_469977_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|469987_470767_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|471218_471488_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|471480_471669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|471661_471976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|471972_472341_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|472337_472703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|472702_474838_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|475180_475516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|475564_476077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|476340_477507_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|477558_478119_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|478120_479362_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|479358_479694_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|479690_479990_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|479989_480433_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|480708_481065_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|481048_482710_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
483055:483072	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP047648	Klebsiella pneumoniae strain 156070 chromosome, complete genome	5415677	1171818	1257916	5415677	transposase,integrase,tRNA,capsid,lysis,terminase,plate,head,tail,coat,portal	Salmonella_phage(68.63%)	97	1185572:1185591	1235017:1235036
WP_002914765.1|1171818_1174446_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_000906486.1|1174809_1174995_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_002914359.1|1176516_1176831_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_002914357.1|1176956_1177523_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_002914355.1|1177519_1177948_+	DedA family protein	NA	NA	NA	NA	NA
WP_002914353.1|1178014_1179571_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_002914351.1|1179727_1180243_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_002914345.1|1180295_1181063_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914344.1|1181041_1182718_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002914342.1|1182854_1184393_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_002914339.1|1184408_1185581_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
1185572:1185591	attL	TTGCACTCATGTTATTCTCC	NA	NA	NA	NA
WP_002914337.1|1185706_1186237_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_002914335.1|1186327_1186663_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_002914333.1|1186652_1187399_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002914330.1|1187576_1188575_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_004151038.1|1188653_1189721_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_002914328.1|1189713_1190916_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
WP_002914327.1|1191272_1192235_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914325.1|1192245_1194387_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914321.1|1194359_1194770_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914320.1|1194766_1195012_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
WP_004151037.1|1195195_1195627_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004149442.1|1195715_1197068_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002914293.1|1197211_1197559_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_002914291.1|1197708_1198071_+	YgaC family protein	NA	NA	NA	NA	NA
WP_002914289.1|1198156_1198606_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002914287.1|1199334_1199736_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_002914284.1|1199808_1199988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914281.1|1200193_1201096_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
WP_002914279.1|1201076_1201622_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_002914277.1|1201629_1201929_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914274.1|1202004_1202610_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_004145715.1|1202713_1203622_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151036.1|1203704_1205492_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151035.1|1205755_1207276_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002914266.1|1207976_1208558_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000019473.1|1208772_1209753_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1209798_1210797_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1210799_1211429_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1211551_1211794_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1211826_1212336_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1212343_1212544_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1212507_1212846_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1212913_1213147_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1213146_1213374_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1213370_1214222_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1214218_1216603_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004152765.1|1217083_1218568_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1218675_1218864_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1218875_1219109_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1219204_1219888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1219874_1220954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1220953_1221955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1222476_1222746_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1222802_1223846_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1223845_1225609_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1225749_1226583_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1226599_1227652_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1227655_1228309_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1228404_1228869_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1228868_1229072_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1229075_1229291_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1229271_1229781_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1229785_1230169_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1230165_1230594_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150997.1|1230689_1231112_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1231104_1231551_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1231573_1232440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1232534_1233107_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1233103_1233466_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1233452_1234361_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1234353_1235025_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1235026_1236976_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
1235017:1235036	attR	GGAGAATAACATGAGTGCAA	NA	NA	NA	NA
WP_004200602.1|1236985_1238104_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1238155_1239229_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1239377_1240550_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1240559_1241075_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1241127_1241427_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1241441_1241561_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1241553_1244184_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1244180_1244666_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1244662_1245757_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1245823_1246042_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1246069_1246447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1247050_1247533_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004188817.1|1247643_1248120_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1248109_1248400_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1248466_1248808_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1248955_1250617_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1250703_1251582_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1251706_1252297_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1252416_1253703_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1253722_1254514_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1254677_1256042_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1256301_1256550_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1256568_1257117_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1257148_1257916_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP047648	Klebsiella pneumoniae strain 156070 chromosome, complete genome	5415677	1335807	1347460	5415677	integrase	Enterobacteria_phage(70.0%)	13	1323941:1323955	1346997:1347011
1323941:1323955	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|1335807_1338141_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|1338152_1338473_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|1338469_1338697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|1338693_1339251_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|1339247_1339514_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_062956184.1|1340055_1340793_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_004152203.1|1340789_1341035_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|1341052_1341619_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152979.1|1342186_1342612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|1342611_1343562_-	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|1343549_1344740_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|1345092_1346346_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|1346356_1347460_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1346997:1347011	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 4
NZ_CP047648	Klebsiella pneumoniae strain 156070 chromosome, complete genome	5415677	1990378	2047763	5415677	transposase,integrase,capsid,lysis,terminase,plate,head,tail,portal	Salmonella_phage(68.75%)	67	1990286:1990304	2028986:2029004
1990286:1990304	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_004151720.1|1990378_1991431_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
WP_004152765.1|1991849_1993334_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|1993432_1994377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087530321.1|1994388_1995267_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	6.6e-30
WP_000188448.1|1995412_1995634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1995666_1996176_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|1996183_1996384_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|1996347_1996689_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|1996756_1996990_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|1996989_1997217_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|1997213_1998071_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|1998067_2000482_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|2000635_2000824_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|2000834_2001068_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|2001182_2001860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|2002135_2003878_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|2003939_2004965_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|2004964_2006731_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|2006873_2007707_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|2007723_2008782_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|2008785_2009436_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|2009531_2009996_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|2009995_2010199_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|2010202_2010418_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|2010398_2010908_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|2010912_2011296_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|2011292_2011721_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896172.1|2011816_2012248_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|2012240_2012687_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_048255583.1|2012683_2013352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|2013465_2014446_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_002896177.1|2014670_2015243_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_032441567.1|2015239_2015602_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896182.1|2015588_2016497_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|2016489_2017089_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|2017090_2020042_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|2020045_2020777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|2020773_2020977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|2021006_2022083_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|2022221_2023394_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|2023403_2023919_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|2023971_2024271_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|2024285_2024405_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|2024397_2027025_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|2027021_2027507_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|2027503_2028604_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|2028695_2028914_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_004179131.1|2029133_2030819_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
2028986:2029004	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_002896351.1|2031085_2031469_+	membrane protein	NA	NA	NA	NA	NA
WP_002896352.1|2031475_2031739_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896354.1|2031941_2032229_+	YbjC family protein	NA	NA	NA	NA	NA
WP_002896363.1|2033050_2033953_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896365.1|2034041_2034521_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896368.1|2034869_2035982_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896370.1|2036145_2037279_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896371.1|2037289_2038243_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896372.1|2038239_2039085_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896376.1|2039142_2039631_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896378.1|2039672_2040800_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896380.1|2040878_2041595_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896382.1|2041591_2043064_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896384.1|2043106_2043838_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004150852.1|2044021_2044690_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896386.1|2044689_2045406_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_002896390.1|2045412_2046144_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032419144.1|2046164_2046893_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_001067855.1|2047058_2047763_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 5
NZ_CP047648	Klebsiella pneumoniae strain 156070 chromosome, complete genome	5415677	2301456	2390163	5415677	transposase,integrase,tRNA,capsid,lysis,terminase,head,tail,portal	Klebsiella_phage(44.19%)	93	2297754:2297768	2356702:2356716
2297754:2297768	attL	GGTGACGCAGCAGGG	NA	NA	NA	NA
WP_004150803.1|2301456_2302563_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|2302619_2303078_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|2303094_2303745_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|2303985_2305236_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_032418030.1|2305353_2306481_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_012542206.1|2306461_2306707_-	excisionase	NA	NA	NA	NA	NA
WP_001067855.1|2308144_2308849_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014228879.1|2309867_2310212_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023279538.1|2310254_2310449_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_040234937.1|2310839_2311154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077257742.1|2311475_2311913_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_071561166.1|2312001_2312226_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_046622349.1|2312228_2312783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077265602.1|2312842_2313847_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_047667474.1|2313839_2314304_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_032443841.1|2314317_2314758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|2315106_2316498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|2316586_2317456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954976.1|2317807_2318521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954975.1|2318694_2320056_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_004152765.1|2320896_2322381_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_025368263.1|2322459_2322693_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_077255782.1|2322704_2322995_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025861428.1|2323035_2323428_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_062955112.1|2323627_2324659_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_025861432.1|2324675_2325278_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_004147997.1|2325521_2325725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147999.1|2326462_2326612_-	small membrane protein	NA	NA	NA	NA	NA
WP_016160648.1|2327529_2327745_+|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_032432826.1|2327744_2328242_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160650.1|2328238_2328589_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_049115059.1|2329538_2329976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749552.1|2330014_2330239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|2330565_2330928_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_023297386.1|2330879_2331203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907818.1|2331199_2331631_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_012542168.1|2331879_2332314_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_021462603.1|2332313_2334035_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_017898992.1|2334028_2334208_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_023279520.1|2334207_2335467_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_014907815.1|2335503_2336424_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023328094.1|2336501_2337788_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_049010370.1|2337846_2338107_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_020317538.1|2338087_2338405_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_023328092.1|2338401_2338740_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_017880258.1|2338720_2339110_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328091.1|2339106_2339508_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_023328090.1|2339539_2340001_+	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228914.1|2340058_2340424_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328089.1|2340656_2343992_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_023328088.1|2343991_2344330_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328087.1|2344326_2345082_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_047666389.1|2345083_2345794_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_047666390.1|2345835_2346258_+	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_023328085.1|2346284_2346878_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_062955111.1|2346940_2359645_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
2356702:2356716	attR	GGTGACGCAGCAGGG	NA	NA	NA	NA
WP_023328083.1|2359713_2361210_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_004892953.1|2361364_2361517_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_004150799.1|2361789_2362503_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|2362499_2362892_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|2362884_2363208_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004140530.1|2363644_2363872_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140529.1|2363984_2365178_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004150795.1|2365799_2365985_+	general stress protein	NA	NA	NA	NA	NA
WP_004150794.1|2366075_2366570_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|2366596_2367103_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140512.1|2367119_2368007_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004150793.1|2368062_2369469_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140509.1|2369465_2370476_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|2370591_2370789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|2371355_2371988_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_153233540.1|2371966_2372155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|2372604_2373291_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140497.1|2373601_2375110_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150788.1|2375230_2376121_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150787.1|2376127_2377912_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150785.1|2377985_2379194_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150784.1|2379496_2380540_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148038.1|2381201_2382116_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|2382205_2382844_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|2382974_2383238_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|2383297_2383423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119317.1|2383540_2383615_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|2383614_2383716_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004150781.1|2383773_2384787_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150780.1|2385087_2385327_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|2385316_2385673_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150778.1|2385659_2386169_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|2386314_2387007_+	CTP synthase	NA	NA	NA	NA	NA
WP_004150777.1|2387038_2388223_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_002901073.1|2388324_2389116_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|2389099_2389546_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901088.1|2389662_2390163_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP047648	Klebsiella pneumoniae strain 156070 chromosome, complete genome	5415677	2553244	2591710	5415677	terminase,integrase	uncultured_Caudovirales_phage(34.04%)	56	2551325:2551339	2560265:2560279
2551325:2551339	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|2553244_2554006_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|2554222_2555755_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|2555953_2556502_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|2556698_2557880_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|2557860_2558103_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152149.1|2558281_2558761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|2558757_2558970_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|2558966_2559191_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|2559180_2559891_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|2559896_2560415_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
2560265:2560279	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|2560519_2561347_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|2561343_2561538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2561534_2561960_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|2561956_2562175_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|2562146_2562401_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|2562393_2562759_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|2562928_2563117_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2563109_2563424_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2563594_2564263_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2564360_2564582_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|2565158_2566817_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|2566818_2567781_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2567777_2568254_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|2568250_2569033_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|2569438_2569687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|2569689_2570220_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|2570216_2570606_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|2570840_2571161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152171.1|2571262_2572015_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152172.1|2571965_2573366_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|2573603_2575055_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|2575110_2575659_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|2575710_2576913_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|2576916_2577411_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|2577422_2578364_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|2578403_2578685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2578653_2579073_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|2579069_2579576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|2579575_2579962_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|2580056_2580497_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|2580500_2581646_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|2581656_2582097_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|2582100_2582526_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|2582561_2582714_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|2582703_2584707_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|2584706_2585306_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152568.1|2585306_2585609_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152569.1|2585611_2586634_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2586633_2586975_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|2587024_2587207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|2587249_2587816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2587869_2588523_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|2588524_2588878_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|2588877_2590074_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|2590070_2590844_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|2590843_2591710_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 7
NZ_CP047648	Klebsiella pneumoniae strain 156070 chromosome, complete genome	5415677	2820406	2831293	5415677		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2820406_2821027_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|2821019_2822285_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|2822296_2823199_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|2823459_2824221_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2824241_2825102_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|2825399_2825660_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|2825746_2826835_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|2826865_2828131_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|2828185_2831293_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 8
NZ_CP047648	Klebsiella pneumoniae strain 156070 chromosome, complete genome	5415677	3677849	3684897	5415677		Klebsiella_phage(50.0%)	9	NA	NA
WP_094819209.1|3677849_3678398_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	90.0	1.6e-87
WP_146965280.1|3678572_3680402_+	hypothetical protein	NA	A0A0U3C9T3	Klebsiella_phage	47.8	1.6e-158
WP_094819207.1|3680413_3680674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094819206.1|3680710_3680965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141223324.1|3680961_3683376_-	hypothetical protein	NA	A0A0U3DL17	Klebsiella_phage	45.6	3.6e-110
WP_094819204.1|3683458_3683617_-	DUF1378 family protein	NA	NA	NA	NA	NA
WP_094819203.1|3683613_3684144_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	47.3	5.0e-33
WP_094819202.1|3684140_3684680_-	lysozyme	NA	H6WRZ4	Salmonella_phage	79.8	7.0e-83
WP_094819201.1|3684681_3684897_-	hypothetical protein	NA	A5LH82	Enterobacteria_phage	61.0	5.2e-13
>prophage 9
NZ_CP047648	Klebsiella pneumoniae strain 156070 chromosome, complete genome	5415677	3694552	3720975	5415677	head,integrase,tail	Pectobacterium_phage(33.33%)	38	3688567:3688581	3727420:3727434
3688567:3688581	attL	CCCGCGCCGCCTGGG	NA	NA	NA	NA
WP_094819196.1|3694552_3696829_-	hypothetical protein	NA	A0A221SAL7	Ralstonia_phage	27.5	3.8e-69
WP_042945535.1|3696828_3697434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945537.1|3697495_3697969_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	39.2	2.3e-13
WP_042945539.1|3698007_3699003_-	phage protein	NA	W6MW28	Pseudomonas_phage	59.9	1.0e-103
WP_094819194.1|3699013_3699772_-	hypothetical protein	NA	M1I7K2	Pelagibacter_phage	24.0	4.8e-05
WP_029503969.1|3699758_3700082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094819193.1|3700084_3701749_-|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.1	1.3e-103
WP_160192557.1|3701748_3703143_-	hypothetical protein	NA	A0A1B1IPE1	uncultured_Mediterranean_phage	41.4	5.3e-66
WP_020947865.1|3703227_3703680_-	hypothetical protein	NA	A3EYX3	Salmonella_phage	66.4	1.5e-49
WP_094819190.1|3703686_3703947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094819189.1|3703930_3704161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094819188.1|3704221_3704506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945553.1|3704538_3704832_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	72.2	7.5e-31
WP_042945555.1|3704828_3705185_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094819187.1|3705172_3705496_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	52.0	4.0e-25
WP_094819186.1|3705485_3706079_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	72.1	3.2e-81
WP_064408055.1|3706147_3706339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094819185.1|3706521_3706860_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	1.5e-46
WP_094819184.1|3706859_3708821_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	55.9	8.2e-206
WP_094819212.1|3708817_3709078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094819183.1|3709105_3709723_-	hypothetical protein	NA	A0A2H4JEM6	uncultured_Caudovirales_phage	24.9	2.3e-05
WP_015365928.1|3709719_3709950_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	37.3	3.8e-06
WP_146962169.1|3709952_3710543_-	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	83.9	1.1e-94
WP_157668072.1|3710539_3710710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064164989.1|3710706_3710940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114499494.1|3710943_3711612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094819211.1|3711650_3713045_-	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	47.4	4.9e-104
WP_064167418.1|3713053_3714022_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.3	1.6e-37
WP_015365921.1|3714039_3714198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082236706.1|3714281_3714728_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.0e-26
WP_000364674.1|3714790_3715024_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
WP_094819180.1|3715132_3715588_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	54.3	1.2e-35
WP_050597398.1|3716311_3716545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146962167.1|3716589_3718770_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	32.6	1.9e-94
WP_064145722.1|3718766_3719333_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	63.0	3.6e-53
WP_015365915.1|3719334_3719520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365914.1|3719729_3719975_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	41.4	2.8e-07
WP_015365913.1|3719958_3720975_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.2	3.7e-125
3727420:3727434	attR	CCCGCGCCGCCTGGG	NA	NA	NA	NA
>prophage 10
NZ_CP047648	Klebsiella pneumoniae strain 156070 chromosome, complete genome	5415677	3867144	3879790	5415677		Escherichia_phage(36.36%)	12	NA	NA
WP_015958693.1|3867144_3867699_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_048996045.1|3867713_3868604_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_063002077.1|3868635_3869505_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_073547076.1|3869518_3870583_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_062955151.1|3871422_3872427_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	4.0e-31
WP_016947628.1|3872827_3872947_+	small membrane protein	NA	NA	NA	NA	NA
WP_000704907.1|3873375_3874542_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_004175260.1|3874721_3875276_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_048996045.1|3875290_3876181_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_062956182.1|3876212_3877082_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	3.4e-111
WP_062955056.1|3877095_3878160_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.4e-105
WP_062955058.1|3878383_3879790_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
>prophage 11
NZ_CP047648	Klebsiella pneumoniae strain 156070 chromosome, complete genome	5415677	3920525	3927431	5415677	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_062955084.1|3920525_3922004_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|3922000_3922723_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|3923041_3924403_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_002912636.1|3924648_3925542_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004899467.1|3925783_3926557_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|3926567_3927431_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 12
NZ_CP047648	Klebsiella pneumoniae strain 156070 chromosome, complete genome	5415677	4228680	4289625	5415677	protease,transposase,integrase,tRNA,holin	Salmonella_phage(27.03%)	61	4234322:4234339	4288614:4288631
WP_004152006.1|4228680_4230684_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|4230693_4231569_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|4231688_4232402_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_002913802.1|4232617_4233652_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|4233668_4234547_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
4234322:4234339	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_004145648.1|4234634_4235267_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|4235270_4235741_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|4235802_4236864_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002913807.1|4237086_4238550_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|4238559_4238919_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913812.1|4239046_4239958_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|4239954_4240656_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|4240754_4242041_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|4242136_4242763_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913829.1|4242980_4244414_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913833.1|4244423_4245317_-	beta-glucoside kinase	NA	NA	NA	NA	NA
WP_002913836.1|4245580_4246618_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|4246614_4247256_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913838.1|4247436_4249497_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|4249500_4251033_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913841.1|4251086_4253315_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913843.1|4253667_4253859_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
WP_002913846.1|4253955_4254843_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913847.1|4254940_4256173_+	MFS transporter	NA	NA	NA	NA	NA
WP_004162150.1|4256466_4257645_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004152009.1|4257628_4259497_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_062955008.1|4259683_4260184_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_062955009.1|4260180_4260810_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_023339240.1|4260799_4261105_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955010.1|4261091_4261496_-	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_077265603.1|4261582_4262899_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_000608644.1|4264007_4265270_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_073547080.1|4266138_4267119_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_153233543.1|4267100_4268366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062955131.1|4268406_4268670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|4271881_4273366_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_023339258.1|4273462_4273801_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_032441458.1|4273793_4273997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050491799.1|4273996_4274617_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_029602865.1|4274613_4274907_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_072200041.1|4274906_4275374_-	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_032441401.1|4275667_4276312_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_032441402.1|4276308_4276500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062955107.1|4276483_4276894_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_048328152.1|4277086_4277434_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_032418532.1|4277553_4278339_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_004207253.1|4278335_4279103_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|4279102_4279312_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|4279458_4279692_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004144290.1|4279846_4280428_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004164029.1|4280794_4281094_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_062955106.1|4281090_4281912_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_062955105.1|4281908_4282790_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955104.1|4282838_4283087_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_009485475.1|4283196_4283490_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_048264082.1|4283482_4283641_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_062955103.1|4283637_4284300_+	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_004197356.1|4284296_4284890_+	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955102.1|4285071_4286322_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_004151979.1|4286513_4288091_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|4288158_4289625_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
4288614:4288631	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
>prophage 13
NZ_CP047648	Klebsiella pneumoniae strain 156070 chromosome, complete genome	5415677	4790153	4797909	5415677	transposase,integrase	Enterobacteria_phage(50.0%)	7	4787371:4787385	4799457:4799471
4787371:4787385	attL	GCGGCAGGGCGACAA	NA	NA	NA	NA
WP_004152204.1|4790153_4790891_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4790887_4791133_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4791150_4791717_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_012579081.1|4792858_4793782_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_000019445.1|4794790_4795771_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_073547088.1|4795752_4796589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152198.1|4796646_4797909_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
4799457:4799471	attR	TTGTCGCCCTGCCGC	NA	NA	NA	NA
