The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047593	Kiritimatiellaeota bacterium S-5007 chromosome, complete genome	3882676	959068	1037513	3882676	tRNA,holin,transposase	Bacillus_virus(14.29%)	55	NA	NA
WP_160627224.1|959068_960379_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_160627226.1|960778_961255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160627228.1|961680_962643_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_160627230.1|962815_963466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627232.1|963560_964430_-	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
WP_160627234.1|964468_965299_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_160627237.1|965295_966549_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.9	3.6e-29
WP_160627239.1|966569_967748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627241.1|967920_969852_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.4	1.9e-90
WP_160630049.1|969971_971435_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_160627243.1|971459_971756_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_160627245.1|972015_972273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160627247.1|972315_972969_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_160630050.1|972996_973233_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160627249.1|973229_976385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627251.1|976537_977980_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_160627253.1|977976_979062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627255.1|979063_980221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627257.1|980318_982715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627259.1|982873_983752_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160627261.1|984197_984545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627263.1|984788_985924_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_160627265.1|986745_988173_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	23.4	8.5e-11
WP_160627267.1|988169_990779_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_160627269.1|990775_992857_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_160627271.1|992858_994256_-	MFS transporter	NA	NA	NA	NA	NA
WP_160627272.1|994624_995794_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_160627274.1|995911_996910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627276.1|997004_997454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627277.1|997453_999103_-	hypothetical protein	NA	A0A0E3F215	Synechococcus_phage	35.7	1.6e-05
WP_160627279.1|999172_999475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627281.1|999601_1000156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627283.1|1000155_1002138_-	hypothetical protein	NA	A0A127KMK7	Cyanophage	40.0	1.4e-06
WP_160627285.1|1002152_1003532_-	MFS transporter	NA	NA	NA	NA	NA
WP_160627287.1|1003571_1004876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627289.1|1004972_1007831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627291.1|1007855_1010099_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_160627293.1|1010204_1012136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627295.1|1012239_1013652_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	26.1	1.6e-22
WP_160627298.1|1013661_1015611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627300.1|1015845_1017504_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_160627303.1|1017500_1018973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627305.1|1018973_1019816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627307.1|1019812_1021126_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_160627309.1|1021185_1023471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627311.1|1023484_1025032_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_160627313.1|1025073_1026717_-	sulfatase-like hydrolase/transferase	NA	A0A1V0SA98	Catovirus	25.4	1.2e-08
WP_160627315.1|1026768_1028487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627317.1|1028698_1029757_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_160627319.1|1029779_1031264_-	MFS transporter	NA	NA	NA	NA	NA
WP_160627321.1|1031287_1033522_-	family 78 glycoside hydrolase catalytic domain	NA	NA	NA	NA	NA
WP_160627322.1|1033833_1035099_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_160627323.1|1035232_1035778_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_160627325.1|1035799_1036261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627327.1|1036457_1037513_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP047593	Kiritimatiellaeota bacterium S-5007 chromosome, complete genome	3882676	1042202	1082267	3882676	transposase,integrase	Paenibacillus_phage(25.0%)	34	1055667:1055681	1082880:1082894
WP_160627337.1|1042202_1043222_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_160627339.1|1043583_1043781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160627341.1|1044006_1044336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627263.1|1044455_1045590_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_160627343.1|1045724_1046465_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_160627345.1|1047050_1048154_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_160625940.1|1048294_1049512_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	36.5	1.0e-57
WP_160627347.1|1049759_1050959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160627328.1|1051065_1051437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627327.1|1051536_1052592_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_160625940.1|1052901_1054119_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	36.5	1.0e-57
WP_160627349.1|1054383_1054875_-	DUF3859 domain-containing protein	NA	NA	NA	NA	NA
WP_160627351.1|1054943_1055633_-	hypothetical protein	NA	NA	NA	NA	NA
1055667:1055681	attL	AGCGGGCGGAGTCCG	NA	NA	NA	NA
WP_160627353.1|1055716_1056073_-	DUF2513 domain-containing protein	NA	Q3HQY9	Burkholderia_phage	44.1	8.0e-19
WP_160627071.1|1056140_1056536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627355.1|1056609_1056951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627357.1|1057029_1057374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627359.1|1057981_1058341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627361.1|1058406_1059267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627363.1|1059778_1060747_+|integrase	integron integrase	integrase	H7BUX8	unidentified_phage	24.6	1.2e-05
WP_160630051.1|1060770_1060905_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_160627366.1|1060901_1061051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160627368.1|1061029_1065640_-	hypothetical protein	NA	A6M964	Geobacillus_virus	31.2	1.6e-05
WP_160627370.1|1065453_1066887_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_160627372.1|1066974_1067937_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_160627373.1|1068031_1070317_-	family 78 glycoside hydrolase catalytic domain	NA	NA	NA	NA	NA
WP_160627375.1|1070306_1073135_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_160627377.1|1073593_1073785_-	SlyX protein	NA	NA	NA	NA	NA
WP_160627379.1|1073793_1075428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160627381.1|1075566_1076169_+	XTP/dITP diphosphatase	NA	C4N218	Cassava_brown_streak_virus	32.6	4.1e-15
WP_160630052.1|1076300_1076588_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_160627383.1|1076693_1079228_+	ATP-dependent helicase HrpB	NA	A0A2K9L0J3	Tupanvirus	30.7	9.4e-45
WP_160627385.1|1079438_1080899_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_160627387.1|1081046_1082267_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	50.5	2.0e-109
1082880:1082894	attR	CGGACTCCGCCCGCT	NA	NA	NA	NA
>prophage 3
NZ_CP047593	Kiritimatiellaeota bacterium S-5007 chromosome, complete genome	3882676	2588263	2653483	3882676	tRNA,transposase,protease,integrase	uncultured_Mediterranean_phage(18.18%)	57	2606020:2606039	2645328:2645347
WP_160629057.1|2588263_2589616_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MDN5	Escherichia_phage	26.9	1.7e-05
WP_160629058.1|2589899_2590634_-	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_160629059.1|2590745_2592923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160629060.1|2592938_2594003_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_160629061.1|2594077_2594305_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_160629062.1|2594606_2594912_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_160629063.1|2595068_2596907_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	40.3	2.4e-114
WP_160630099.1|2597029_2598310_+	citrate synthase	NA	NA	NA	NA	NA
WP_160629064.1|2598804_2598981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160629065.1|2598977_2600012_+	UDP-N-acetylglucosamine pyrophosphorylase	NA	NA	NA	NA	NA
WP_160629066.1|2600025_2601390_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_160629067.1|2601386_2602487_-	[FeFe] hydrogenase H-cluster radical SAM maturase HydE	NA	NA	NA	NA	NA
WP_160629068.1|2602565_2603969_-	[FeFe] hydrogenase H-cluster radical SAM maturase HydG	NA	NA	NA	NA	NA
WP_160629069.1|2603965_2605174_-	[FeFe] hydrogenase H-cluster maturation GTPase HydF	NA	NA	NA	NA	NA
WP_160629070.1|2605170_2606499_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
2606020:2606039	attL	TTTTTCCAAGGTTTGGAAAA	NA	NA	NA	NA
WP_160629071.1|2606495_2606747_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_160630100.1|2606903_2608646_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_160629072.1|2608671_2610459_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_160629073.1|2610470_2610863_-	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_160629074.1|2610866_2611415_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_160629075.1|2611419_2611887_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_160629076.1|2612187_2612811_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_160629077.1|2612836_2613337_+	molybdenum cofactor carrier	NA	NA	NA	NA	NA
WP_160629078.1|2613390_2614572_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_160629079.1|2614568_2615927_+	response regulator	NA	NA	NA	NA	NA
WP_160629080.1|2615996_2617826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160629081.1|2617840_2618779_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	31.9	1.7e-15
WP_160629082.1|2618717_2620841_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_160629083.1|2620852_2620942_-	AURKAIP1/COX24 domain-containing protein	NA	NA	NA	NA	NA
WP_160629084.1|2620964_2621837_-	ATP phosphoribosyltransferase	NA	A0A1V0SIZ6	Klosneuvirus	26.6	7.3e-05
WP_160629085.1|2621975_2622605_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_160629086.1|2622760_2623369_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_160629087.1|2623377_2626911_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_160629088.1|2627151_2628561_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.7	3.8e-27
WP_160629089.1|2628710_2629325_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_160629090.1|2629338_2629749_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	52.9	3.1e-30
WP_160629091.1|2629794_2631297_-|protease	trypsin-like serine protease	protease	S4VWN0	Pandoravirus	27.3	5.1e-06
WP_160629092.1|2631305_2631683_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_160629093.1|2631776_2632466_-	7-cyano-7-deazaguanine synthase QueC	NA	E7DN66	Pneumococcus_phage	42.3	2.2e-33
WP_160629094.1|2632499_2633273_-	4Fe-4S cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_160629095.1|2633428_2634466_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_160630101.1|2634514_2634934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160625940.1|2635064_2636282_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	36.5	1.0e-57
WP_160629096.1|2636667_2637699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629097.1|2638258_2639611_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.4	1.4e-55
WP_160629098.1|2639897_2641067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629099.1|2641259_2641565_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_160629100.1|2641568_2644019_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_160629101.1|2644081_2646355_+	hypothetical protein	NA	NA	NA	NA	NA
2645328:2645347	attR	TTTTCCAAACCTTGGAAAAA	NA	NA	NA	NA
WP_160629102.1|2646385_2647036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629103.1|2647228_2648488_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	32.3	1.8e-49
WP_160629104.1|2648567_2648912_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_160629105.1|2649042_2649399_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_160629106.1|2649423_2649621_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_160629107.1|2649706_2650651_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_160629108.1|2650890_2652066_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_160629109.1|2652427_2653483_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP047593	Kiritimatiellaeota bacterium S-5007 chromosome, complete genome	3882676	2988662	3000146	3882676		Escherichia_phage(33.33%)	10	NA	NA
WP_160629354.1|2988662_2990639_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	29.8	3.2e-32
WP_160629355.1|2990730_2991783_+	GDP-mannose 4,6-dehydratase	NA	A0A0E3F7G9	Synechococcus_phage	66.4	1.3e-128
WP_160630116.1|2992213_2993182_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1J0F9I6	Only_Syngen_Nebraska_virus	53.1	4.0e-97
WP_160629356.1|2993188_2994064_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	5.4e-32
WP_160629357.1|2994060_2995140_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.3	1.2e-97
WP_160629358.1|2995223_2995577_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_160630117.1|2995703_2996585_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	63.8	1.0e-99
WP_160629359.1|2997064_2997607_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.8	4.8e-47
WP_160629360.1|2997789_2999115_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	27.6	3.4e-22
WP_160630118.1|2999153_3000146_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	46.6	1.5e-78
>prophage 5
NZ_CP047593	Kiritimatiellaeota bacterium S-5007 chromosome, complete genome	3882676	3530418	3601687	3882676	tRNA,transposase,protease,integrase	Paramecium_bursaria_Chlorella_virus(16.67%)	58	3594622:3594636	3600525:3600539
WP_160629776.1|3530418_3531168_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_160629777.1|3531169_3531847_-	ribonuclease III	NA	M1H375	Paramecium_bursaria_Chlorella_virus	36.7	1.4e-16
WP_160629778.1|3531984_3532800_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_160629779.1|3533032_3534826_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2I2L4Y8	Orpheovirus	32.6	6.1e-06
WP_160629780.1|3534843_3536091_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_160629781.1|3536104_3536386_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_160629782.1|3536499_3537093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629783.1|3537118_3538624_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	36.0	4.4e-82
WP_160629784.1|3538918_3539365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160630138.1|3539361_3540216_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_160629785.1|3540275_3541070_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_160629786.1|3541132_3542116_-	phosphoglycerate dehydrogenase	NA	NA	NA	NA	NA
WP_160629787.1|3542295_3544257_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_160629788.1|3544326_3545088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629789.1|3545180_3545819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629790.1|3545829_3546879_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_160629791.1|3546991_3550360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629792.1|3550461_3551178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629793.1|3551199_3553176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629794.1|3553211_3554450_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_160629795.1|3554439_3556671_-	sodium/solute symporter	NA	NA	NA	NA	NA
WP_160629796.1|3556788_3559992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629797.1|3560268_3562887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160629798.1|3562961_3563783_+	DUF1961 family protein	NA	NA	NA	NA	NA
WP_160629799.1|3563843_3564863_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_160629800.1|3565006_3565822_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_160629801.1|3565840_3566614_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_160629802.1|3566613_3567981_-	flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_160629803.1|3568066_3568615_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160629804.1|3568801_3569350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629805.1|3569366_3569807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629806.1|3569806_3570418_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_160629807.1|3570443_3571154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629808.1|3571226_3572567_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_160629809.1|3572563_3573868_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_160629810.1|3573864_3574722_-	prephenate dehydrogenase/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_160629811.1|3574895_3576212_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_160629812.1|3576208_3578101_+	response regulator	NA	A0A1V0SGX0	Hokovirus	34.0	5.0e-51
WP_160629813.1|3578119_3580576_-	AAA domain-containing protein	NA	A0A0A8J958	Klebsiella_phage	36.3	5.4e-114
WP_160629814.1|3580752_3581586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160629815.1|3581613_3583290_-	DUF4445 domain-containing protein	NA	NA	NA	NA	NA
WP_160629816.1|3583359_3583983_-	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_160629817.1|3584140_3585364_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160629818.1|3585402_3586188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629819.1|3586256_3586556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629820.1|3586690_3587452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629821.1|3587448_3588273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629822.1|3588337_3589609_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_160629823.1|3589681_3591895_+	ammonia-forming cytochrome c nitrite reductase subunit c552	NA	NA	NA	NA	NA
WP_160629824.1|3591901_3592996_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_160629825.1|3592992_3593877_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_160629329.1|3594129_3595305_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
3594622:3594636	attL	ATCGCTGACGATCAA	NA	NA	NA	NA
WP_160629826.1|3595388_3595706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160629827.1|3596303_3598778_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_160629828.1|3599060_3599375_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_160629829.1|3599371_3599851_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_160625940.1|3600017_3601235_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	36.5	1.0e-57
3600525:3600539	attR	ATCGCTGACGATCAA	NA	NA	NA	NA
WP_160629830.1|3601453_3601687_+|transposase	transposase	transposase	NA	NA	NA	NA
