The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047576	Escherichia coli strain 94EC chromosome, complete genome	4811585	290070	357220	4811585	protease,lysis,portal,capsid,terminase,integrase,head,tail	Enterobacteria_phage(44.9%)	74	287169:287183	338280:338294
287169:287183	attL	CTGGGCGGCTGCGGC	NA	NA	NA	NA
WP_001260840.1|290070_290892_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|290991_291075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743960.1|291167_291503_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091838.1|291899_293153_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|293259_294153_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|294287_295508_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|295632_296328_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|296280_297573_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|297731_298346_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|298388_299243_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|299244_299862_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|299872_302296_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041535.1|302356_304783_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
WP_001295396.1|304981_305287_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|305394_306105_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|306107_306668_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|306702_307044_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|307178_307505_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|307710_308925_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|308936_309956_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001389342.1|310013_310142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|310143_311424_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001296941.1|311458_311695_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001083273.1|314347_314539_-	YebW family protein	NA	NA	NA	NA	NA
WP_001331023.1|314535_314724_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331024.1|315124_315277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171928.1|315263_315479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|315638_315794_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000362155.1|316059_316479_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|316579_316861_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693836.1|316844_317270_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262352.1|317341_318412_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_001151151.1|318452_318875_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|319215_321213_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_104681743.1|321276_322554_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000019008.1|322684_323566_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000957771.1|323562_324255_-	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_001718323.1|324266_325466_-	MFS transporter	NA	NA	NA	NA	NA
WP_122083109.1|325977_326085_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013637.1|326129_326342_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_011478175.1|326509_326788_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265040.1|326789_327839_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
WP_000904112.1|327851_328226_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762868.1|328222_329044_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
WP_000562553.1|329943_330075_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506937.1|330441_330870_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|331041_331416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|331667_331883_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001135280.1|331882_332380_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|332596_332779_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|332869_333163_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_032195597.1|333525_333720_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	93.8	2.2e-26
WP_061089094.1|334108_334654_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_021514143.1|334628_336554_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|336550_336757_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_094317377.1|336753_338355_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.1	3.0e-307
338280:338294	attR	CTGGGCGGCTGCGGC	NA	NA	NA	NA
WP_024238048.1|339664_339997_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_001357871.1|340052_341078_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_000158875.1|341119_341515_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|341526_341880_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000985116.1|341891_342470_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_001357870.1|342466_342862_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	2.9e-70
WP_001357869.1|342869_343610_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.4	1.6e-130
WP_001357868.1|343625_344048_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
WP_000459457.1|344029_344464_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_094317378.1|344456_347018_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.0	0.0e+00
WP_000847345.1|347014_347344_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152502.1|347343_348042_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_047088332.1|348047_348791_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_140903137.1|348727_349360_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	6.5e-96
WP_160192013.1|349420_352834_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	98.0	0.0e+00
WP_001230353.1|352903_353503_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	3.5e-107
WP_160192015.1|353567_356639_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_001593356.1|356638_357220_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
>prophage 2
NZ_CP047576	Escherichia coli strain 94EC chromosome, complete genome	4811585	1383511	1448980	4811585	protease,lysis,holin,portal,capsid,terminase,transposase,tRNA,integrase,head,tail	Enterobacteria_phage(44.23%)	73	1392769:1392815	1438773:1438819
WP_073470664.1|1383511_1384648_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_160192042.1|1387917_1390890_+	phage receptor	NA	NA	NA	NA	NA
WP_001224602.1|1390890_1391781_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177455.1|1391963_1392725_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1392769:1392815	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201822.1|1393237_1394191_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226381.1|1394377_1395862_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937500.1|1396045_1396351_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000742376.1|1396419_1397076_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071586406.1|1397130_1397229_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000355700.1|1397268_1397562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204581.1|1397571_1397850_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_021531100.1|1397846_1399907_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	65.7	4.2e-152
WP_021531099.1|1399971_1400571_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	1.3e-106
WP_062880614.1|1400638_1404118_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	90.0	0.0e+00
WP_140903137.1|1404178_1404811_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	6.5e-96
WP_047088332.1|1404747_1405491_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_001152502.1|1405496_1406195_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847345.1|1406194_1406524_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_094317378.1|1406520_1409082_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.0	0.0e+00
WP_000459457.1|1409074_1409509_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001357868.1|1409490_1409913_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
WP_001357869.1|1409928_1410669_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.4	1.6e-130
WP_001357870.1|1410676_1411072_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	2.9e-70
WP_000985116.1|1411068_1411647_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000785282.1|1411658_1412012_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|1412023_1412419_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_001357871.1|1412460_1413486_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_024238048.1|1413541_1413874_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_094317377.1|1415183_1416785_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.1	3.0e-307
WP_000198149.1|1416781_1416988_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_021514143.1|1416984_1418910_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_061089094.1|1418884_1419430_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000881608.1|1419994_1420177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|1420383_1420710_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000738423.1|1421190_1421484_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_077877966.1|1421574_1421757_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	6.5e-17
WP_000992182.1|1421973_1422507_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.4	2.6e-98
WP_000370548.1|1422612_1422885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250557.1|1422850_1423195_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	3.5e-35
WP_000284486.1|1423199_1423415_-|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_000502162.1|1423437_1423629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021546022.1|1424508_1425570_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	97.4	1.3e-202
WP_001317671.1|1425719_1425914_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	95.3	5.7e-27
WP_000966854.1|1426095_1426626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047122.1|1426780_1427533_-	antitermination protein	NA	Q8SBE4	Shigella_phage	97.6	8.4e-135
WP_001535863.1|1427546_1428536_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.4e-193
WP_001061427.1|1428543_1429386_-	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.5	1.1e-138
WP_000767127.1|1429405_1429795_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210176.1|1429791_1430118_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_001573323.1|1430117_1430612_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_021546021.1|1430608_1431550_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.7	9.5e-152
WP_001250269.1|1431539_1431719_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515847.1|1431894_1432446_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
WP_001191674.1|1432438_1432699_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|1432796_1433489_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000559922.1|1433808_1434324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|1434794_1435157_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|1435222_1436047_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008165.1|1436174_1436711_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|1436701_1437064_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000206812.1|1437063_1437369_+	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	9.2e-48
WP_000433951.1|1437368_1437740_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	80.2	1.0e-45
WP_001624790.1|1437595_1438759_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	5.2e-200
WP_000805428.1|1439093_1439726_+	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1438773:1438819	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250422.1|1439728_1440244_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691080.1|1440254_1441262_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001331008.1|1441274_1443884_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988379.1|1443914_1444607_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|1444826_1445369_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729154.1|1445849_1446716_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1446717_1446930_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|1447037_1447559_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_094317372.1|1447594_1448980_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 3
NZ_CP047576	Escherichia coli strain 94EC chromosome, complete genome	4811585	1771621	1833882	4811585	protease,transposase,tRNA,plate	Enterobacteria_phage(12.5%)	49	NA	NA
WP_000611738.1|1771621_1772035_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_087904585.1|1772038_1773841_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|1773852_1774935_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|1774959_1776240_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|1776236_1776761_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|1776763_1778095_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343302.1|1778099_1778861_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614420.1|1778869_1781689_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.9	1.2e-80
WP_000088859.1|1781685_1782429_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|1782433_1783846_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001087745.1|1787412_1788765_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|1788788_1789271_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|1789314_1790229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|1790238_1790718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|1790854_1791640_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|1792179_1792911_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|1792975_1793443_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|1793439_1794162_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052710.1|1794195_1794951_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1795022_1796381_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211690.1|1796428_1797199_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|1797276_1798077_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000997010.1|1799228_1800032_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140174.1|1805789_1806362_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|1806549_1807581_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|1807573_1808227_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|1808266_1809082_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|1809199_1809604_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|1809600_1810308_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|1810419_1812138_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399647.1|1813218_1814199_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|1814448_1815159_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635316.1|1815172_1815595_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|1815591_1816137_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|1816302_1816503_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|1816489_1816750_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|1816798_1818097_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|1818161_1818551_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|1818607_1820749_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|1820847_1821807_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|1821819_1825302_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|1825338_1825935_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|1825931_1827080_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|1827079_1827868_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1827871_1828327_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|1828431_1829457_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|1829460_1829946_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|1830067_1832500_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|1832529_1833882_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 4
NZ_CP047576	Escherichia coli strain 94EC chromosome, complete genome	4811585	2174727	2229692	4811585	protease,tRNA,integrase,transposase	Enterobacteria_phage(20.0%)	51	2163497:2163511	2203904:2203918
2163497:2163511	attL	ACCATCATGGATACC	NA	NA	NA	NA
WP_085948260.1|2174727_2175939_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001470157.1|2176122_2176746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077632214.1|2177073_2177550_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000080195.1|2177580_2179194_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|2179224_2179575_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2179571_2179997_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_140903129.1|2180067_2180496_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012311738.1|2181119_2181320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001342709.1|2181409_2181796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774671.1|2181853_2182888_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	42.2	6.7e-66
WP_000350135.1|2182923_2183763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032155801.1|2183765_2184323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000718842.1|2184319_2187556_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_000991122.1|2187555_2188842_-	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001053122.1|2188841_2190821_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	25.6	8.4e-33
WP_000648433.1|2190887_2191385_-	addiction module antitoxin	NA	NA	NA	NA	NA
WP_000019340.1|2192371_2192539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001477155.1|2192777_2193518_+	porin family protein	NA	NA	NA	NA	NA
WP_012311728.1|2193691_2195191_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001218930.1|2195514_2196780_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
WP_001514390.1|2197285_2197495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294545.1|2197577_2199080_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001295681.1|2199198_2200281_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|2200280_2201381_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2201647_2203159_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_001188289.1|2203253_2203736_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416392.1|2203735_2206591_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
2203904:2203918	attR	ACCATCATGGATACC	NA	NA	NA	NA
WP_000079641.1|2206646_2207843_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059414.1|2208035_2208539_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|2208584_2209001_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000086237.1|2209162_2210167_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001309158.1|2210267_2210498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001331059.1|2210484_2211828_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001331058.1|2211950_2212403_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000256656.1|2212547_2213141_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500727.1|2213211_2213925_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230281.1|2214055_2214451_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|2214731_2214866_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|2214869_2215805_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2215817_2216279_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2216351_2216738_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_001118337.1|2216803_2217259_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000471866.1|2217303_2220000_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|2220140_2220194_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|2220378_2221326_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001299664.1|2221444_2222866_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001331056.1|2222915_2224571_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187778.1|2224964_2227103_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|2227261_2227726_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_001232240.1|2227770_2228157_-	cytochrome b562	NA	NA	NA	NA	NA
WP_000852988.1|2228339_2229692_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 5
NZ_CP047576	Escherichia coli strain 94EC chromosome, complete genome	4811585	3869919	3877059	4811585		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3869919_3870558_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590388.1|3870554_3871817_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_000847985.1|3871813_3872722_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|3872917_3873685_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|3873735_3874392_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272894.1|3874497_3877059_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.3e-30
>prophage 6
NZ_CP047576	Escherichia coli strain 94EC chromosome, complete genome	4811585	3952401	4042315	4811585	protease,lysis,portal,terminase,tRNA,integrase,tail	Enterobacteria_phage(50.0%)	93	3952128:3952142	3962345:3962359
3952128:3952142	attL	ATATCGCCTTGATCA	NA	NA	NA	NA
WP_001341819.1|3952401_3953631_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_045171897.1|3954255_3955071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145022.1|3955060_3955444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206590.1|3955457_3956630_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.0	2.0e-146
WP_001331174.1|3956590_3956797_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001075212.1|3956838_3957705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072646408.1|3957813_3958338_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.7	9.1e-96
WP_160192081.1|3958466_3959291_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135680.1|3959356_3959719_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859460.1|3960387_3961062_-	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
WP_000649477.1|3961152_3961353_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|3961396_3961948_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_001087352.1|3961944_3962781_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	98.9	5.1e-149
3962345:3962359	attR	TGATCAAGGCGATAT	NA	NA	NA	NA
WP_015364394.1|3962785_3963010_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	91.9	1.2e-33
WP_000061506.1|3963006_3963825_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	89.5	2.7e-126
WP_077881878.1|3963821_3964319_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	94.5	7.6e-84
WP_001442792.1|3964315_3964969_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_000210170.1|3964965_3965292_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_063112468.1|3965288_3965678_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	97.7	2.3e-67
WP_001061379.1|3965697_3966507_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_001360050.1|3966514_3967504_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001047105.1|3967517_3968270_+	antitermination protein	NA	A0A291AWZ5	Escherichia_phage	100.0	1.3e-138
WP_000217632.1|3968550_3968976_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_000595432.1|3969199_3969403_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	97.0	3.0e-31
WP_096843940.1|3969553_3970606_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	1.8e-207
WP_000839596.1|3970672_3970888_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000075159.1|3970887_3971385_+	lysozyme	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
WP_001228685.1|3971601_3971787_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000232224.1|3971870_3972233_+	hypothetical protein	NA	A5LH85	Enterobacteria_phage	99.2	8.9e-66
WP_000373425.1|3972686_3973181_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001700320.1|3973180_3975283_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.9	0.0e+00
WP_001072975.1|3975279_3975492_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_160192083.1|3975491_3977000_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	8.6e-288
WP_023363265.1|3976944_3978972_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097045.1|3979059_3979383_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283153.1|3979375_3979651_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677106.1|3979662_3980241_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_023363259.1|3980237_3980639_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	5.4e-72
WP_000211104.1|3980649_3981393_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.6	7.8e-133
WP_001299384.1|3981453_3981840_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	4.7e-65
WP_001161009.1|3981848_3982178_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_063112470.1|3982149_3985215_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
WP_000447253.1|3985214_3985544_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_063112471.1|3985553_3986252_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.5e-133
WP_063112472.1|3986256_3987000_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	7.7e-149
WP_063112473.1|3986936_3987545_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.5	2.4e-103
WP_063112474.1|3987605_3991103_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
WP_001233090.1|3991173_3991773_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_071938245.1|3991837_3995236_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_063112476.1|3995235_3995820_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	2.4e-105
WP_001597763.1|3996005_3996161_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	92.6	2.2e-05
WP_024190590.1|3996220_3997291_+	type II toxin-antitoxin system RnlA family toxin	NA	NA	NA	NA	NA
WP_000461705.1|3997283_3997646_+	type II toxin-antitoxin system RnlB family antitoxin	NA	NA	NA	NA	NA
WP_000429347.1|3997783_3998053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162574.1|3998930_3999413_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|3999544_4000021_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|4000010_4000301_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|4000362_4000704_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|4000852_4002514_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|4002599_4003478_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|4003600_4004194_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|4004248_4005535_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|4005555_4006347_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|4006513_4007875_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|4008123_4008372_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|4008390_4008939_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|4008969_4009737_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|4009778_4010126_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|4010202_4010685_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969042.1|4010700_4011927_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|4011916_4012435_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_001168054.1|4013187_4014258_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225221.1|4014268_4015390_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200098.1|4015432_4016593_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|4016691_4016739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|4016842_4017184_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|4017454_4018192_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079107.1|4018326_4019307_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|4019303_4020035_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|4020164_4022738_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000230376.1|4028601_4029900_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|4029896_4030220_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|4030265_4031621_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082949.1|4031734_4034395_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001307345.1|4034426_4035125_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|4035193_4035613_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|4035819_4036857_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|4036904_4037594_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|4037898_4038282_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|4038337_4038925_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365855.1|4039027_4039909_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219195.1|4040117_4041446_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298974.1|4041577_4042315_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP047576	Escherichia coli strain 94EC chromosome, complete genome	4811585	4503978	4513420	4811585		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|4503978_4504905_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|4504909_4505641_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4505621_4505729_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|4505788_4506520_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|4506741_4508427_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4508423_4509143_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4509189_4509660_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4509700_4510162_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001331478.1|4510286_4512287_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292767.1|4512283_4513420_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 8
NZ_CP047576	Escherichia coli strain 94EC chromosome, complete genome	4811585	4604762	4611055	4811585		Enterobacteria_phage(50.0%)	6	NA	NA
WP_044861940.1|4604762_4606157_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
WP_000183071.1|4606331_4607225_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_000699439.1|4607596_4608682_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.1e-102
WP_001023643.1|4608681_4609581_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	1.1e-27
WP_000857539.1|4609638_4610517_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	8.7e-107
WP_021542163.1|4610521_4611055_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.9	8.8e-54
>prophage 9
NZ_CP047576	Escherichia coli strain 94EC chromosome, complete genome	4811585	4674029	4752751	4811585	protease,holin,portal,capsid,terminase,transposase,integrase,head,tail	Escherichia_phage(46.0%)	92	4666185:4666200	4698131:4698146
4666185:4666200	attL	GGCTCTGCACTGAATG	NA	NA	NA	NA
WP_045171449.1|4674029_4675055_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.6	2.6e-102
WP_000096344.1|4675054_4675258_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_065203452.1|4675316_4677788_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.7	1.1e-58
WP_000449192.1|4678845_4679034_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122998275.1|4679394_4679580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|4679583_4679802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042030300.1|4679873_4680173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233320.1|4680531_4680951_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|4681030_4681285_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693845.1|4681281_4681707_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|4681729_4682692_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000788950.1|4682698_4683445_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000451007.1|4683466_4684237_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_021543289.1|4684252_4684678_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	2.2e-63
WP_000150294.1|4684852_4685518_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001013627.1|4685698_4685911_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	3.4e-25
WP_024193993.1|4686078_4686357_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_061091384.1|4686358_4687408_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.8e-109
WP_061091385.1|4687420_4687792_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.7e-35
WP_024190351.1|4687784_4688150_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	89.2	6.4e-56
WP_024190350.1|4688185_4688584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021526743.1|4688573_4688837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021526742.1|4688852_4689734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839572.1|4690631_4690847_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_042068861.1|4690851_4691202_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	98.8	1.8e-39
WP_000992100.1|4691265_4691799_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_137443514.1|4692015_4692201_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.7	3.2e-19
WP_001100260.1|4692418_4692685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000351660.1|4692690_4693230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111090.1|4693368_4693719_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
WP_001312917.1|4693866_4694349_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001140903.1|4694348_4696106_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_000478564.1|4696117_4696300_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	95.0	2.5e-24
WP_000466255.1|4696299_4697541_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193631.1|4697518_4698169_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
4698131:4698146	attR	GGCTCTGCACTGAATG	NA	NA	NA	NA
WP_000257522.1|4698183_4699389_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.3	1.0e-222
WP_000601355.1|4699439_4699628_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000983037.1|4699639_4699945_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_001147820.1|4699953_4700292_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_001312916.1|4700288_4700738_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	7.9e-64
WP_001209399.1|4700734_4701079_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000097533.1|4701138_4701843_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_001312914.1|4701842_4702229_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_071590020.1|4702270_4702531_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_024257906.1|4702577_4705805_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_001330090.1|4705782_4706139_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152456.1|4706138_4706837_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
WP_032241748.1|4706841_4707585_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.7e-148
WP_000090949.1|4707521_4708124_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	2.6e-86
WP_048236358.1|4708184_4711580_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	90.5	0.0e+00
WP_001233121.1|4711647_4712247_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	7.2e-105
WP_160192108.1|4712311_4715725_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.4e-11
WP_048236353.1|4715724_4716306_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.7	3.0e-100
WP_001079073.1|4717796_4718327_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	7.2e-56
WP_001317164.1|4718668_4719340_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240105.1|4719575_4720211_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000730130.1|4720211_4721216_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|4721324_4721738_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|4721870_4722542_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826769.1|4722541_4723900_+	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_000218209.1|4724007_4724859_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824375.1|4725449_4726613_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_001313057.1|4727179_4727545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365564.1|4727584_4728280_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.5	7.3e-08
WP_001157239.1|4728346_4729765_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786004.1|4729745_4730216_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212248.1|4730204_4731125_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|4731297_4732215_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009306.1|4732293_4732476_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_012565123.1|4732646_4734341_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000491500.1|4734337_4735153_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|4735450_4735678_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_071524607.1|4735786_4736029_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103987.1|4736072_4736696_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000983977.1|4736985_4737771_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|4737779_4738049_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253450.1|4738058_4738796_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001349974.1|4738795_4739161_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|4739163_4739577_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|4739573_4740578_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133112.1|4740582_4741047_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620113.1|4741151_4742279_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807584.1|4742275_4742719_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213318.1|4742737_4744111_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282706.1|4744110_4744797_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|4744789_4745785_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_094317380.1|4745777_4747436_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274295.1|4747650_4747965_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|4748298_4748631_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000734031.1|4748799_4749351_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879833.1|4749360_4750158_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000826403.1|4751542_4752751_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.5e-205
>prophage 1
NZ_CP047577	Escherichia coli strain 94EC plasmid p94EC-1, complete sequence	178137	1262	56303	178137	transposase,integrase,protease	Macacine_betaherpesvirus(18.75%)	50	NA	NA
WP_001603634.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_032145890.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|2685_3594_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|3656_4766_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|5198_6152_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|7424_7583_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085949156.1|7766_8979_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_024133197.1|8945_9092_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	7.0e-06
WP_000928804.1|10433_11621_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733250.1|11617_13558_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001312828.1|13561_14932_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|15728_16670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|18930_20124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085974881.1|21346_22620_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.1e-174
WP_000616196.1|22739_23186_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	55.3	1.8e-28
WP_015387373.1|23281_23539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523378.1|24267_24480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513516.1|25606_25783_-	lasso peptide microcin J25	NA	NA	NA	NA	NA
WP_001513515.1|26122_26749_+	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_001513514.1|26751_28293_+	lasso peptide isopeptide bond-forming cyclase	NA	NA	NA	NA	NA
WP_001513513.1|28295_30038_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.4	2.7e-19
WP_001238646.1|31905_33072_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_000817028.1|33071_34043_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_000092896.1|36841_37054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000082154.1|37314_38286_-|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
WP_072256028.1|38810_39113_+	antirestriction protein	NA	NA	NA	NA	NA
WP_042007484.1|39112_39574_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001027505.1|39573_39756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|40749_40980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170681.1|41031_42393_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001311069.1|42439_43003_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	38.0	2.7e-21
WP_002433376.1|43154_43403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032175643.1|43453_43648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290793.1|43875_44403_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	54.3	6.7e-46
WP_000006004.1|44458_44692_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
WP_000845901.1|46059_46494_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276234.1|46490_47210_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001299721.1|47221_47410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|47489_47648_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_042808424.1|48148_48337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107535.1|48569_48857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234469.1|48977_49799_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000243709.1|50095_50698_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001151524.1|51018_51402_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000283385.1|51588_52278_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_001309237.1|52376_52772_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000994779.1|52804_53170_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012106.1|53184_53496_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399792.1|53517_54084_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000080195.1|54689_56303_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 2
NZ_CP047577	Escherichia coli strain 94EC plasmid p94EC-1, complete sequence	178137	79046	125525	178137	transposase,integrase,bacteriocin,tRNA	Salmonella_phage(20.0%)	43	87374:87389	126679:126694
WP_000911324.1|79046_79445_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_077916033.1|79444_79675_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_011117356.1|79753_85024_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_160192136.1|85043_85790_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.2	1.2e-08
WP_000139359.1|85844_86405_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_012311405.1|86542_86755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233871.1|86997_87459_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.7	5.5e-20
87374:87389	attL	TTCAGAATGAAGCCAG	NA	NA	NA	NA
WP_001333231.1|87504_87714_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000083818.1|88563_88824_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|89049_89124_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130940.1|89116_89974_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_021514894.1|90889_91096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021514893.1|91277_93965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021514892.1|94468_96715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021514891.1|96716_97805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351729.1|99644_100037_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|100174_101059_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|101090_102290_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|102395_103046_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|103077_103320_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001138014.1|103377_106344_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001067855.1|106429_107134_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001446887.1|107714_108452_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|108448_108673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120891.1|108883_109423_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|109394_110231_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|110230_111034_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|111094_111910_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|112239_112416_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001067855.1|113405_114110_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_042033193.1|114121_114361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|114855_115206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796228.1|115249_115939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016493.1|115935_116727_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000864812.1|116904_117258_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_032494162.1|117307_118123_-|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000203272.1|118366_118894_+	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|119251_119533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014640552.1|119996_120233_+	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001259758.1|120210_120522_+	colicin V	NA	NA	NA	NA	NA
WP_109045958.1|120691_122806_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_012006529.1|122780_124022_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_134092058.1|124251_125525_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.3	2.7e-173
126679:126694	attR	TTCAGAATGAAGCCAG	NA	NA	NA	NA
>prophage 1
NZ_CP047578	Escherichia coli strain 94EC plasmid p94EC-2, complete sequence	134426	6866	63749	134426	transposase,integrase	Escherichia_phage(52.38%)	57	5792:5806	61802:61816
5792:5806	attL	ATCTCAGCGATCTGT	NA	NA	NA	NA
WP_001067855.1|6866_7571_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|7684_8461_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000742814.1|8689_9715_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|10136_10889_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_075322286.1|12470_13745_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001053381.1|13819_14593_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.4	5.5e-73
WP_021545039.1|14592_15618_-|transposase	IS21-like element ISEc57 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	44.1	6.6e-74
WP_094309310.1|16206_17364_-	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_094323890.1|17353_18274_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001120888.1|18981_20475_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|20586_20892_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058657119.1|20919_22134_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001447541.1|22350_23235_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000898043.1|23265_24189_-|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|24276_24981_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_049824851.1|24990_25461_+	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_014839978.1|25480_26269_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014839979.1|26268_26787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|26791_27208_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|27593_28298_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012579081.1|30048_30972_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_013188475.1|31051_31927_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_000434930.1|32431_33058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|33154_33859_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000535297.1|34022_34802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302628.1|34854_35169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246635.1|35849_36845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991830.1|36848_37781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952231.1|38078_39167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000253407.1|39168_40038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741348.1|40094_41660_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001261287.1|41967_42198_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|42194_42611_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000350635.1|42772_44911_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000343085.1|45264_45522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194575.1|45521_46112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058649952.1|46374_47931_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000521603.1|48121_48739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160192139.1|49031_50165_-	permease	NA	NA	NA	NA	NA
WP_001175594.1|50269_50593_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024159726.1|50693_51404_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	3.1e-94
WP_001286342.1|51412_51958_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011117603.1|52033_52396_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_011117602.1|52416_54174_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_011117601.1|54247_54616_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|55260_55965_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_160192141.1|56032_56755_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	96.4	2.4e-54
WP_000239529.1|56892_57168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|57161_57806_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103690.1|58034_59006_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000340829.1|59010_59403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457496.1|59407_60679_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000109071.1|60678_61116_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|61112_61361_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_001134388.1|61754_62681_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
61802:61816	attR	ACAGATCGCTGAGAT	NA	NA	NA	NA
WP_013307862.1|62684_62990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086137.1|63065_63749_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.3e-30
