The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032002	Acinetobacter haemolyticus strain 11616 chromosome, complete genome	3493479	838771	967387	3493479	tRNA,protease,transposase,integrase	Escherichia_phage(22.73%)	100	893337:893362	913700:913725
WP_005080957.1|838771_840355_-|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	9.4e-144
WP_000618091.1|840429_840765_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001055585.1|840761_841145_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_005082988.1|842869_843325_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005082987.1|843391_843820_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017394512.1|843950_844181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005082982.1|844402_844810_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_005082975.1|846221_847934_-	flotillin family protein	NA	NA	NA	NA	NA
WP_004640325.1|847968_848613_-	YqiJ family protein	NA	NA	NA	NA	NA
WP_004640323.1|849018_850032_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004640320.1|850200_851118_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_005081931.1|851611_852544_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.6	8.7e-57
WP_160124190.1|853249_867607_+	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_020846312.1|867737_869393_+	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
WP_125316946.1|869404_872593_+	CapA family protein	NA	NA	NA	NA	NA
WP_160124191.1|872592_872895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124192.1|872848_874045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005084352.1|874037_874775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005084354.1|874857_875172_+	MGMT family protein	NA	NA	NA	NA	NA
WP_004640302.1|875351_875789_-	universal stress protein	NA	NA	NA	NA	NA
WP_004640300.1|876014_876641_-	CatB-related O-acetyltransferase	NA	NA	NA	NA	NA
WP_004640299.1|876703_876919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004640296.1|877019_877496_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005084359.1|877588_880822_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_004640293.1|880836_881976_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_004640291.1|882336_882879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005084362.1|882931_883468_-	DOMON-like domain-containing protein	NA	NA	NA	NA	NA
WP_004640287.1|883473_883800_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_004640284.1|884064_884715_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_160124349.1|884739_885768_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004640283.1|885958_887854_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	46.8	2.6e-108
WP_005084367.1|887987_888839_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_005084369.1|888965_890585_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_171057132.1|890718_891009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005084373.1|891039_892638_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
893337:893362	attL	ATGAACCGTACCGGGTTTGTCGGAGA	NA	NA	NA	NA
WP_087486619.1|893376_894596_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_005084378.1|895501_896104_+	nicotinamide mononucleotide transporter	NA	K4FAY9	Cronobacter_phage	29.9	4.8e-08
WP_005084380.1|896153_897293_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_005084382.1|897499_899113_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_005084384.1|899454_902556_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_004640257.1|902835_904173_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005084386.1|904249_904828_+	DUF4112 domain-containing protein	NA	NA	NA	NA	NA
WP_004640254.1|904890_905796_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_161414322.1|906013_906790_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	53.7	9.2e-36
WP_004640251.1|907373_908279_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.2	3.1e-91
WP_004640249.1|908475_908859_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005084391.1|908906_910016_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_125316950.1|910390_910867_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_005084955.1|911232_912438_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.5	7.3e-64
WP_010326927.1|912611_913637_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_160124193.1|913750_914918_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.2	2.1e-71
913700:913725	attR	ATGAACCGTACCGGGTTTGTCGGAGA	NA	NA	NA	NA
WP_001223318.1|914911_915613_-|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_160124350.1|915809_916823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005082417.1|916869_917136_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_104470630.1|918126_919346_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.2	7.6e-77
WP_160124194.1|919358_919571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160124195.1|919576_920782_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_004669036.1|921669_922506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004669035.1|922529_922850_-	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_005082424.1|923383_924415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004669030.1|924419_924755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004669028.1|924877_925135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004669027.1|925147_925297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124196.1|925358_925856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124197.1|925871_926486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005082429.1|926560_926896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124198.1|927002_927293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124199.1|927319_928393_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	38.1	4.5e-57
WP_125503032.1|928624_929752_+	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	42.1	1.6e-41
WP_004880447.1|929902_930799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004880446.1|930902_931175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160124351.1|931189_932071_-	CopD family protein	NA	NA	NA	NA	NA
WP_125317011.1|932138_932519_-	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_160124200.1|932668_933812_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_125317012.1|934036_935111_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	2.3e-45
WP_125317040.1|935822_936806_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_125317013.1|937497_938913_+	anthranilate 1,2-dioxygenase large subunit	NA	NA	NA	NA	NA
WP_125317014.1|938915_939407_+	anthranilate 1,2-dioxygenase small subunit	NA	NA	NA	NA	NA
WP_125317015.1|939417_940449_+	anthranilate 1,2-dioxygenase electron transfer component AntC	NA	NA	NA	NA	NA
WP_160124201.1|940830_941991_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_160124202.1|942018_942744_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_160124203.1|943171_944497_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_160124200.1|945051_946196_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005243610.1|946952_947591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005243609.1|947671_948979_+	MFS transporter	NA	NA	NA	NA	NA
WP_005243607.1|949142_950495_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	68.8	7.0e-31
WP_005243591.1|950497_951418_-	chromate resistance protein	NA	NA	NA	NA	NA
WP_005243577.1|951634_951922_-	DUF2591 family protein	NA	NA	NA	NA	NA
WP_005243575.1|951933_952137_-	exodeoxyribonuclease VII	NA	NA	NA	NA	NA
WP_005243573.1|952129_953389_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_005243572.1|953553_953826_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_005243569.1|953815_955039_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A222YXG1	Escherichia_phage	47.1	4.1e-22
WP_100223926.1|955390_956555_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.5e-138
WP_010590140.1|957597_958980_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	4.5e-09
WP_005243563.1|958963_959752_+	TIGR02646 family protein	NA	NA	NA	NA	NA
WP_100223926.1|960663_961828_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.5e-138
WP_001055585.1|964015_964399_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000618091.1|964395_964731_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005080957.1|964805_966389_+|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	9.4e-144
WP_020846310.1|966454_967387_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
>prophage 2
NZ_CP032002	Acinetobacter haemolyticus strain 11616 chromosome, complete genome	3493479	984232	1034479	3493479	transposase	Enterobacteria_phage(26.67%)	43	NA	NA
WP_020846310.1|984232_985165_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_005084465.1|985265_985916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005084468.1|985988_989675_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	60.0	5.6e-14
WP_171057142.1|990213_991743_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_160124204.1|991850_993069_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.1	3.5e-21
WP_020846310.1|993097_994030_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_005086202.1|994527_995598_-	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_005086199.1|995680_997069_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_005086196.1|997426_998926_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_005086194.1|999258_999498_+	lipoprotein	NA	NA	NA	NA	NA
WP_005086193.1|999520_1000771_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_005086192.1|1000776_1001631_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_004640183.1|1001630_1002305_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005086190.1|1002301_1002913_-	LysE family translocator	NA	NA	NA	NA	NA
WP_161414287.1|1003069_1003957_+	tyrosine recombinase	NA	A0A0K0MWE8	Gordonia_phage	29.1	9.6e-13
WP_005086189.1|1004395_1005145_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_004952903.1|1005162_1006095_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_005086188.1|1006210_1006726_+	DinB family protein	NA	NA	NA	NA	NA
WP_005086186.1|1007068_1009798_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	28.5	1.3e-92
WP_160124205.1|1009822_1010935_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004640160.1|1010931_1012062_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004757626.1|1012065_1013226_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_008941743.1|1013238_1014735_-	TolC family protein	NA	NA	NA	NA	NA
WP_020846310.1|1014923_1015856_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_005086184.1|1016096_1017176_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	49.6	2.0e-89
WP_100222743.1|1017280_1018505_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.1	4.6e-21
WP_004757630.1|1018570_1018714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005084475.1|1018749_1019688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004640146.1|1019896_1020367_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_004640144.1|1020374_1021268_+	EamA family transporter	NA	NA	NA	NA	NA
WP_004640143.1|1021282_1021867_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_005084477.1|1021892_1023128_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004640139.1|1023120_1023807_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	37.8	2.9e-33
WP_005084481.1|1023890_1026329_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	45.9	8.8e-16
WP_005084485.1|1026317_1027274_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_005084487.1|1027413_1028436_+	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	27.2	5.0e-13
WP_005084488.1|1028582_1029380_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_171055806.1|1029426_1030056_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.9	1.5e-28
WP_004640125.1|1030052_1031123_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.7	1.2e-78
WP_005084490.1|1031256_1032453_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004640121.1|1032473_1033172_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_125316983.1|1033284_1033539_+	CSLREA domain-containing protein	NA	NA	NA	NA	NA
WP_020846310.1|1033546_1034479_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
>prophage 3
NZ_CP032002	Acinetobacter haemolyticus strain 11616 chromosome, complete genome	3493479	1114377	1171092	3493479	tRNA,protease,transposase	uncultured_Caudovirales_phage(16.67%)	51	NA	NA
WP_005084620.1|1114377_1115403_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_004639978.1|1115459_1116365_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_171055803.1|1116371_1117271_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005084622.1|1117403_1118585_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000760495.1|1118661_1118826_-	rubredoxin	NA	NA	NA	NA	NA
WP_005084625.1|1119178_1119616_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_005084627.1|1119776_1121303_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	39.1	2.2e-89
WP_005084628.1|1121456_1122908_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_004639965.1|1123234_1124143_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_005084633.1|1124188_1125802_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.4	7.5e-40
WP_004639959.1|1126001_1126517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005084635.1|1126565_1126829_+	ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_005084636.1|1126865_1128194_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005084639.1|1128299_1129289_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026057263.1|1129828_1131430_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_026057262.1|1131514_1131982_-	copper resistance protein NlpE N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005084644.1|1132348_1133779_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.3	6.2e-54
WP_005084646.1|1134054_1135032_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	8.9e-36
WP_004639946.1|1135035_1135575_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_005084648.1|1135619_1136168_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_005084650.1|1136151_1136700_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_005084652.1|1136699_1137446_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-21
WP_005084653.1|1137635_1139171_+	TolC family protein	NA	NA	NA	NA	NA
WP_005084655.1|1139167_1141291_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.5	2.7e-29
WP_004639933.1|1141303_1142494_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005084657.1|1142587_1143187_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	38.4	1.1e-20
WP_125316988.1|1143179_1143794_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	52.4	8.1e-11
WP_005084661.1|1143910_1144753_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	5.9e-36
WP_005084663.1|1144872_1145541_-	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	36.7	1.3e-25
WP_171057129.1|1145675_1146332_-	peptidase M15	NA	NA	NA	NA	NA
WP_004639922.1|1146507_1146837_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_160124352.1|1147085_1147433_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087486619.1|1147486_1148705_+|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_005084669.1|1149046_1151686_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.0	3.7e-36
WP_005084671.1|1152304_1152523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100223926.1|1153065_1154231_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.5e-138
WP_160124208.1|1155174_1156068_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010326927.1|1156064_1157090_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_020846310.1|1158775_1159708_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_026056278.1|1160560_1160788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004639899.1|1160932_1161163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639896.1|1161451_1162063_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	55.3	2.8e-48
WP_125316989.1|1162067_1163366_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	46.7	9.8e-107
WP_125316990.1|1163532_1164633_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_075315268.1|1164900_1165551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125316991.1|1165568_1166534_+	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.2	1.2e-16
WP_008942019.1|1166635_1167223_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_075315274.1|1167347_1168790_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_125316992.1|1168849_1169344_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005089750.1|1169390_1169756_+	GFA family protein	NA	NA	NA	NA	NA
WP_100222370.1|1169963_1171092_+|transposase	IS3-like element ISAcsp5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP032002	Acinetobacter haemolyticus strain 11616 chromosome, complete genome	3493479	1188157	1252055	3493479	tRNA,transposase,integrase	uncultured_Caudovirales_phage(21.43%)	57	1215936:1215989	1237906:1237959
WP_125317000.1|1188157_1189291_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_075315305.1|1189295_1189784_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_125317001.1|1189886_1190345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125317002.1|1190360_1190900_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_005084817.1|1190997_1192146_-	D-alanyl-D-alanine carboxypeptidase PBP5/6	NA	B6DZZ7	Stx2-converting_phage	38.1	4.8e-65
WP_125317003.1|1192298_1192694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125317004.1|1192873_1193236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005084823.1|1193375_1193747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639644.1|1193899_1194673_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.3	3.4e-54
WP_017396769.1|1194783_1195614_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	45.7	2.6e-12
WP_005084828.1|1195761_1196691_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005084830.1|1196755_1199389_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_005089847.1|1199576_1201754_+	MFS transporter	NA	NA	NA	NA	NA
WP_004639634.1|1201756_1202158_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_005084835.1|1202297_1203266_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_004639630.1|1203465_1203690_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017395546.1|1203802_1205896_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_008941999.1|1205877_1207632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005089852.1|1207645_1208662_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_004639622.1|1208748_1209318_+	elongation factor P	NA	NA	NA	NA	NA
WP_161409507.1|1209583_1211614_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_008941998.1|1211600_1211903_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_005084848.1|1211984_1212944_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_005089857.1|1212958_1213876_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_005089860.1|1213880_1215872_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
1215936:1215989	attL	TACGTTGACATCGTAGAGGTCTCCAGTTCGAGTCTGGATATACCTACCAAAATT	NA	NA	NA	NA
WP_016543150.1|1216190_1217213_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	43.8	3.2e-68
WP_008941996.1|1217237_1217540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160124210.1|1217888_1218584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160124211.1|1219087_1220035_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_016653652.1|1220187_1221042_-	hypothetical protein	NA	A0A2H4JC99	uncultured_Caudovirales_phage	31.9	2.1e-28
WP_016541972.1|1221025_1221373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016653653.1|1221876_1222230_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_160124212.1|1223070_1223679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124213.1|1223770_1224535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124214.1|1225310_1226606_-	DUF4113 domain-containing protein	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	62.9	7.4e-163
WP_023013911.1|1226605_1227091_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	56.1	3.2e-42
WP_020846310.1|1227318_1228251_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_160124215.1|1228253_1229789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010326927.1|1229833_1230859_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_160124216.1|1230855_1231326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124354.1|1231601_1231877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017480642.1|1233738_1234188_-	cyanase	NA	NA	NA	NA	NA
WP_008303564.1|1234468_1235278_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_160124217.1|1235329_1237054_+	protein kinase	NA	D7F602	Apocheima_cinerarium_nucleopolyhedrovirus	22.6	1.2e-06
WP_005089862.1|1238416_1238593_-	hypothetical protein	NA	NA	NA	NA	NA
1237906:1237959	attR	TACGTTGACATCGTAGAGGTCTCCAGTTCGAGTCTGGATATACCTACCAAAATT	NA	NA	NA	NA
WP_004639604.1|1238931_1239141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100223926.1|1239520_1240686_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.5e-138
WP_161403048.1|1240907_1241027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639601.1|1241802_1242486_-	pirin family protein	NA	NA	NA	NA	NA
WP_004639599.1|1242678_1244022_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	79.4	7.6e-54
WP_004639597.1|1244252_1244642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639596.1|1244811_1246842_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_034589178.1|1247228_1247612_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_160124218.1|1247608_1247944_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_160124355.1|1248018_1249665_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	8.8e-145
WP_125316971.1|1249772_1251359_-	histidine-type phosphatase	NA	A0A218MNG5	uncultured_virus	60.9	1.6e-103
WP_160124219.1|1251671_1252055_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP032002	Acinetobacter haemolyticus strain 11616 chromosome, complete genome	3493479	1269364	1317372	3493479	transposase,integrase	Enterobacteria_phage(36.36%)	43	1280338:1280354	1311733:1311749
WP_160124235.1|1269364_1270555_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.5	2.1e-79
WP_160124236.1|1270761_1271658_+	hydrolase or metal-binding protein	NA	NA	NA	NA	NA
WP_100222370.1|1273004_1274134_-|transposase	IS3-like element ISAcsp5 family transposase	transposase	NA	NA	NA	NA
WP_000884834.1|1274275_1275199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000179851.1|1275208_1275928_-	DUF3944 domain-containing protein	NA	NA	NA	NA	NA
WP_171503501.1|1276145_1277078_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_160124238.1|1277029_1277167_-	DUF2559 family protein	NA	NA	NA	NA	NA
WP_160124239.1|1277468_1279754_+	N-6 DNA methylase	NA	A0A220A2U5	Liberibacter_phage	25.1	1.7e-29
WP_160124240.1|1279753_1281106_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
1280338:1280354	attL	ACAACAACTGATTGAAC	NA	NA	NA	NA
WP_160124241.1|1281102_1284354_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_005324694.1|1284441_1285374_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	1.4e-54
WP_005324696.1|1285603_1285834_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_005324697.1|1286137_1287010_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005324702.1|1287025_1288378_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	67.1	4.9e-149
WP_100223928.1|1288409_1289000_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	54.2	4.9e-21
WP_005324707.1|1289066_1289450_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_005324717.1|1289496_1290249_-	pyrimidine utilization protein B	NA	NA	NA	NA	NA
WP_005064337.1|1290245_1291364_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_005324718.1|1291723_1292311_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_005324720.1|1292307_1293114_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_017395975.1|1295217_1296495_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	38.1	8.3e-74
WP_125317005.1|1296829_1298038_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.2	3.1e-62
WP_125317036.1|1298123_1299176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004671840.1|1299546_1299810_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_125317037.1|1299793_1300057_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_125317006.1|1300473_1300740_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_160124242.1|1300833_1301874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001055585.1|1302127_1302511_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000618091.1|1302507_1302843_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005080957.1|1302917_1304501_+|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	9.4e-144
WP_020846310.1|1306342_1307275_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_160124243.1|1307558_1307879_-	DUF1255 family protein	NA	NA	NA	NA	NA
WP_160124244.1|1308497_1309613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124245.1|1309605_1309965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124246.1|1310087_1310273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171503417.1|1310932_1311106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124247.1|1311127_1311817_+	hypothetical protein	NA	NA	NA	NA	NA
1311733:1311749	attR	ACAACAACTGATTGAAC	NA	NA	NA	NA
WP_160124248.1|1311857_1312502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124356.1|1312628_1312955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124249.1|1312972_1313377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124250.1|1313462_1313882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124251.1|1313899_1314955_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	39.8	3.6e-59
WP_087486619.1|1316153_1317372_+|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
>prophage 6
NZ_CP032002	Acinetobacter haemolyticus strain 11616 chromosome, complete genome	3493479	1640896	1685810	3493479	protease,transposase	Enterobacteria_phage(18.18%)	44	NA	NA
WP_005080553.1|1640896_1641310_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	47.1	9.0e-14
WP_125316749.1|1641366_1641555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639237.1|1641714_1641837_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
WP_004639236.1|1641933_1644219_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.2	1.5e-163
WP_005090434.1|1644218_1644581_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	57.5	1.5e-25
WP_005080559.1|1644972_1646016_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LZD8	Serratia_phage	45.7	7.9e-83
WP_005090437.1|1646074_1646995_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004639232.1|1646994_1647555_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004639231.1|1647630_1649703_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017396081.1|1649775_1650192_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_125316750.1|1650222_1650939_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_160124269.1|1650960_1652049_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005080572.1|1652120_1652585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639226.1|1652953_1654591_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.8	2.2e-151
WP_004639225.1|1654621_1655479_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	1.1e-50
WP_004639224.1|1655570_1656860_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.5	1.1e-137
WP_004639223.1|1656989_1657355_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_004639222.1|1657344_1658052_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005090442.1|1658178_1658655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004639220.1|1658713_1659478_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004639219.1|1659474_1659846_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_005080585.1|1660061_1660475_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005090445.1|1660476_1660890_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005080588.1|1660904_1661777_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_160124270.1|1661945_1662557_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_100223926.1|1662609_1663774_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.5e-138
WP_005080592.1|1664060_1664321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005090449.1|1664447_1665032_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_171057921.1|1665046_1666603_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_035375121.1|1666788_1667064_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_026056359.1|1667084_1668194_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	27.6	8.9e-32
WP_005090465.1|1668453_1670280_+	allophanate hydrolase	NA	NA	NA	NA	NA
WP_160124271.1|1670295_1673901_+	urea carboxylase	NA	NA	NA	NA	NA
WP_004639207.1|1673912_1674608_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017396669.1|1674919_1675852_+|transposase	IS5-like element ISAha2 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.6	7.1e-59
WP_160124359.1|1675886_1676189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942430.1|1676379_1677255_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_008942429.1|1677262_1678267_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_161412296.1|1678367_1679252_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_008942427.1|1679399_1680401_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_005080626.1|1680462_1681338_-	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_008942425.1|1682019_1683087_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004639199.1|1683112_1684660_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_020846310.1|1684877_1685810_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
>prophage 7
NZ_CP032002	Acinetobacter haemolyticus strain 11616 chromosome, complete genome	3493479	2444746	2483202	3493479	tRNA,transposase,integrase	uncultured_Mediterranean_phage(25.0%)	32	2439877:2439892	2474076:2474091
2439877:2439892	attL	TTTTTAGAAAAAGCAG	NA	NA	NA	NA
WP_005091373.1|2444746_2445478_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005091376.1|2445506_2446322_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005091378.1|2446307_2446757_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_118903117.1|2446861_2447746_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005091382.1|2447952_2448834_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005081540.1|2449035_2450226_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.6	6.2e-15
WP_004638187.1|2450318_2452457_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	24.7	2.4e-49
WP_004638185.1|2452634_2453105_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004638184.1|2453265_2453640_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_005091386.1|2453811_2455149_-	EcsC family protein	NA	NA	NA	NA	NA
WP_004638181.1|2455439_2456669_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_005091388.1|2456701_2457154_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017395860.1|2457643_2458048_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_017395859.1|2458139_2458478_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_005081532.1|2458760_2458925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100222603.1|2459480_2460570_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005091392.1|2460958_2462584_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.7	4.8e-95
WP_005091394.1|2462576_2463608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005081519.1|2464544_2464808_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	56.2	3.1e-20
WP_004638166.1|2464809_2465301_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.9	5.3e-29
WP_005091398.1|2465617_2466865_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0IRB7	Acinetobacter_phage	56.9	2.9e-124
WP_087554624.1|2467944_2469104_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.4	3.7e-49
WP_005091401.1|2469868_2470234_-	copper-binding protein	NA	NA	NA	NA	NA
WP_005091405.1|2473426_2474926_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
2474076:2474091	attR	TTTTTAGAAAAAGCAG	NA	NA	NA	NA
WP_005091408.1|2474925_2476230_-	TolC family protein	NA	NA	NA	NA	NA
WP_100833373.1|2476310_2476715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091414.1|2476846_2478676_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_004699719.1|2478665_2478923_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_005091417.1|2478933_2480229_-	cation transporter	NA	NA	NA	NA	NA
WP_004880426.1|2480313_2480718_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_005091419.1|2480767_2481649_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_104470630.1|2481982_2483202_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.2	7.6e-77
>prophage 8
NZ_CP032002	Acinetobacter haemolyticus strain 11616 chromosome, complete genome	3493479	2496577	2538650	3493479	tRNA,transposase	Ralstonia_phage(20.0%)	40	NA	NA
WP_100223926.1|2496577_2497742_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.5e-138
WP_005091440.1|2498553_2498919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091441.1|2498919_2500044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091442.1|2500506_2501427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125269079.1|2502201_2503420_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.9	2.4e-78
WP_118901380.1|2504246_2505405_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.1	1.5e-50
WP_118903119.1|2505373_2507848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091447.1|2508214_2509066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091449.1|2509269_2509506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005091450.1|2509507_2509702_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_005091452.1|2509828_2510302_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.3	2.5e-23
WP_005081517.1|2510337_2510910_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_005081516.1|2510993_2511734_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_005091456.1|2511814_2512864_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004638161.1|2512935_2513925_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_005091458.1|2514112_2515990_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.3	7.9e-57
WP_017395860.1|2516697_2517102_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_017395859.1|2517193_2517532_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_160124291.1|2517557_2517716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004638159.1|2518086_2519370_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_008942493.1|2519530_2521168_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005081509.1|2521172_2521754_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_005081506.1|2521767_2522601_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_004638154.1|2523190_2524144_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.9	2.1e-42
WP_005081504.1|2524240_2524537_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_005081501.1|2524556_2525138_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_004638150.1|2525283_2525664_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_005091465.1|2525843_2527634_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_020846296.1|2527630_2528818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091467.1|2528823_2529063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005081497.1|2529494_2530154_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	M4QPK3	Synechococcus_phage	41.7	9.9e-39
WP_005081494.1|2530197_2530872_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_005081491.1|2530965_2531733_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_005091469.1|2531962_2534011_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005081486.1|2534085_2534559_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_004638139.1|2534774_2535017_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.1	4.3e-08
WP_004655272.1|2535205_2535442_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	43.2	1.4e-11
WP_004638137.1|2535528_2536263_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.1	5.9e-16
WP_118903147.1|2536259_2537246_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_008942576.1|2537492_2538650_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP032002	Acinetobacter haemolyticus strain 11616 chromosome, complete genome	3493479	2750414	2813075	3493479	tRNA,transposase,integrase	uncultured_Caudovirales_phage(31.25%)	47	2768569:2768589	2804205:2804225
WP_005092317.1|2750414_2751134_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.6	3.0e-89
WP_005092315.1|2751126_2752167_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_005092314.1|2752178_2752652_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	49.4	3.6e-35
WP_004637919.1|2752658_2752979_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	65.1	1.3e-23
WP_005092312.1|2753036_2753471_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.0	3.3e-43
WP_008942181.1|2753746_2754340_-	LysE family transporter	NA	NA	NA	NA	NA
WP_008942182.1|2755121_2756135_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	25.4	2.4e-07
WP_008942183.1|2756300_2759402_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.6	3.1e-74
WP_005274609.1|2760716_2761646_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.3	8.4e-52
WP_008942186.1|2762827_2764222_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_008942187.1|2764218_2765652_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_008942188.1|2765641_2767372_-	type I restriction-modification system subunit M	NA	NA	NA	NA	NA
WP_160124293.1|2767700_2768681_-	hydrolase or metal-binding protein	NA	NA	NA	NA	NA
2768569:2768589	attL	ACTTTACCGATACTGATTCGC	NA	NA	NA	NA
WP_008942190.1|2770092_2771133_-	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	36.8	2.8e-43
WP_008942191.1|2771301_2772345_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	39.5	8.6e-61
WP_008942192.1|2772402_2772690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065286431.1|2772903_2774991_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_017396499.1|2775545_2775800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942226.1|2775931_2776156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942225.1|2776171_2776831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942222.1|2780819_2782457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065286433.1|2782621_2783548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942217.1|2783550_2784447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008942216.1|2784584_2784860_+	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_008942215.1|2784843_2785995_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	44.2	1.7e-89
WP_017396681.1|2786130_2787150_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_004637913.1|2787407_2787863_+	CHAP domain-containing protein	NA	D5GVH7	Campylobacter_virus	43.2	1.3e-13
WP_005092264.1|2787885_2788677_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	28.5	3.5e-14
WP_005092262.1|2788739_2789933_-	MFS transporter	NA	NA	NA	NA	NA
WP_005092261.1|2790038_2792795_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_008942213.1|2792920_2793736_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_008942212.1|2793797_2794694_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_008942211.1|2794800_2795619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004637906.1|2795692_2797285_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	32.9	1.5e-11
WP_017396682.1|2797561_2798434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008942209.1|2798722_2800327_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_004637903.1|2800383_2801889_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_160124045.1|2802194_2802323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942208.1|2802328_2802679_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004637901.1|2802683_2803508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223318.1|2803980_2804682_+|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
2804205:2804225	attR	GCGAATCAGTATCGGTAAAGT	NA	NA	NA	NA
WP_020846310.1|2804782_2805715_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_008942207.1|2806171_2806567_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_008942206.1|2806726_2808238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942205.1|2808532_2809240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942204.1|2809469_2810615_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005089444.1|2812142_2813075_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.3	7.4e-56
>prophage 10
NZ_CP032002	Acinetobacter haemolyticus strain 11616 chromosome, complete genome	3493479	3109852	3169666	3493479	tRNA,transposase	Escherichia_phage(20.0%)	54	NA	NA
WP_085947913.1|3109852_3110943_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_160124297.1|3111189_3111702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005087925.1|3111949_3113845_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_004637613.1|3113920_3114532_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_017395049.1|3114554_3115370_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_005083939.1|3115573_3116107_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004637609.1|3116109_3117042_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_017395048.1|3117104_3118298_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_005087920.1|3118308_3119667_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_017395047.1|3119838_3120090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160124298.1|3120102_3121956_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_017394530.1|3121952_3122213_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_035374893.1|3122363_3123284_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.4	1.8e-33
WP_026056261.1|3123416_3124232_+	DsbC family protein	NA	NA	NA	NA	NA
WP_005087913.1|3124671_3125973_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_004637599.1|3126031_3127171_+	threonine synthase	NA	NA	NA	NA	NA
WP_005087912.1|3127230_3128295_-	D-alanyl-D-alanine endopeptidase PBP7/8	NA	NA	NA	NA	NA
WP_005083960.1|3128505_3129141_+	response regulator	NA	NA	NA	NA	NA
WP_160124299.1|3129159_3130725_+	histidine kinase	NA	A0A1V0SGX0	Hokovirus	23.6	8.2e-07
WP_005087908.1|3130747_3132175_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005087906.1|3132226_3133393_-	hypothetical protein	NA	A0A0R6PIZ1	Moraxella_phage	30.0	1.7e-12
WP_005087904.1|3133402_3134947_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_004637591.1|3135071_3136142_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_004637590.1|3136141_3137242_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_026056263.1|3137397_3138846_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.0	4.5e-52
WP_005087898.1|3138849_3139257_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_005087896.1|3139292_3139919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005083982.1|3139965_3140625_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.1	1.5e-34
WP_005087895.1|3140787_3141627_-	aquaporin	NA	NA	NA	NA	NA
WP_004637583.1|3142025_3143318_-	DNA adenine methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.8	1.6e-37
WP_005087893.1|3143314_3144415_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.1	6.7e-48
WP_004637581.1|3144427_3144892_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_005087891.1|3145027_3146419_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	33.0	1.3e-35
WP_000780326.1|3146487_3146826_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_004637578.1|3147098_3147326_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_160124300.1|3147395_3148250_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_171294499.1|3148409_3148859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223318.1|3149207_3149909_-|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_000693745.1|3149984_3151940_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	41.1	2.1e-129
WP_014538385.1|3152297_3153266_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	31.0	2.4e-25
WP_125269079.1|3153341_3154561_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.9	2.4e-78
WP_046128207.1|3154672_3155320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046128206.1|3155748_3156831_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	36.0	2.0e-36
WP_001141890.1|3157036_3157216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046128205.1|3157329_3158343_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_046128204.1|3158342_3160055_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_005314752.1|3160060_3160522_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_023187982.1|3160524_3161919_+	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_057066693.1|3161963_3163856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104470630.1|3163903_3165123_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.2	7.6e-77
WP_171503503.1|3165352_3166264_-	cation transporter	NA	NA	NA	NA	NA
WP_008942233.1|3166460_3167030_-	ester cyclase	NA	NA	NA	NA	NA
WP_008942232.1|3167010_3167394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125269079.1|3168447_3169666_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.9	2.4e-78
>prophage 11
NZ_CP032002	Acinetobacter haemolyticus strain 11616 chromosome, complete genome	3493479	3303500	3374805	3493479	transposase,integrase	Staphylococcus_phage(18.18%)	53	3302291:3302336	3358842:3358887
3302291:3302336	attL	CTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCA	NA	NA	NA	NA
WP_039047371.1|3303500_3304682_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	30.6	7.2e-40
WP_004858371.1|3304674_3304923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039047370.1|3304991_3305534_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_039047369.1|3305544_3306291_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	37.5	1.0e-44
WP_079270859.1|3307226_3307622_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_039047368.1|3307781_3309860_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004907087.1|3309972_3311241_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_004985732.1|3311290_3312883_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_004985737.1|3313023_3314148_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004985739.1|3314149_3316906_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	3.4e-24
WP_004907097.1|3316902_3317961_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004985741.1|3317979_3319377_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_100834158.1|3319381_3320077_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125316847.1|3320612_3322031_+	phosphate--AMP phosphotransferase	NA	NA	NA	NA	NA
WP_100834159.1|3322584_3323256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000004527.1|3323255_3325583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000557620.1|3328871_3329234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001060549.1|3329357_3331718_+	DEAD/DEAH box helicase family protein	NA	W8W2E1	Invertebrate_iridovirus	29.2	1.3e-32
WP_001005874.1|3332004_3332313_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016164863.1|3332309_3333599_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_005064486.1|3335031_3335964_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.9	5.0e-60
WP_000734101.1|3336076_3336397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000733361.1|3336520_3336904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160124306.1|3336928_3337066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040037.1|3337106_3338039_-|transposase	IS5-like element ISAha2 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.6	1.9e-59
WP_017396282.1|3338622_3339885_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_004985675.1|3340049_3340691_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004985679.1|3340791_3341190_-	OsmC family protein	NA	NA	NA	NA	NA
WP_004985681.1|3341186_3342134_-	pirin family protein	NA	NA	NA	NA	NA
WP_004985683.1|3342439_3342742_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_004985684.1|3342768_3343158_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_004985686.1|3343172_3343697_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104470630.1|3345610_3346830_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.2	7.6e-77
WP_125316848.1|3347536_3349708_+	AAA family ATPase	NA	A0A2H4J1E0	uncultured_Caudovirales_phage	67.4	1.5e-104
WP_032012138.1|3349780_3350053_-	hypothetical protein	NA	A0A2H4IYJ6	uncultured_Caudovirales_phage	59.1	1.2e-19
WP_004907175.1|3351444_3351747_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_118902202.1|3351751_3353011_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_160124307.1|3353741_3357089_-	SWIM zinc finger family protein	NA	Q2NP48	Hyphantria_cunea_nuclear_polyhedrosis_virus	30.7	4.0e-51
WP_000557943.1|3357504_3357768_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_043975117.1|3357754_3358018_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_160124308.1|3358945_3360298_-	MFS transporter	NA	NA	NA	NA	NA
3358842:3358887	attR	CTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCA	NA	NA	NA	NA
WP_160124309.1|3360416_3361442_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_160124310.1|3361454_3362228_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_004956740.1|3362249_3363377_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005092614.1|3363388_3365038_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	8.4e-79
WP_005092616.1|3365126_3366011_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_005085784.1|3366024_3367542_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004637436.1|3367708_3368590_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171057913.1|3368662_3370087_-	amino acid permease	NA	NA	NA	NA	NA
WP_171057912.1|3370287_3370605_-	RidA family protein	NA	NA	NA	NA	NA
WP_005085790.1|3371783_3373040_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004637431.1|3373177_3373645_+	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_080591915.1|3373776_3374805_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP032003	Acinetobacter haemolyticus strain 11616 plasmid pAhaem11616f, complete sequence	86699	7662	84819	86699	integrase,transposase	Escherichia_phage(23.81%)	56	NA	NA
WP_001067783.1|7662_8367_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	2.3e-118
WP_004281883.1|8537_9596_-	2,3-butanediol dehydrogenase	NA	NA	NA	NA	NA
WP_160124365.1|9863_11483_-	oleate hydratase	NA	NA	NA	NA	NA
WP_160124366.1|12581_13514_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	41.7	1.6e-58
WP_160124368.1|13620_16098_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.4	2.0e-92
WP_004281879.1|16276_16471_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_020846310.1|17040_17973_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.6	1.5e-61
WP_087486619.1|18649_19869_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_004778435.1|20198_21431_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_086393391.1|21891_22203_+	type II toxin-antitoxin system HigB family toxin	NA	F5A3A2	Riemerella_phage	37.4	1.1e-08
WP_001067783.1|23403_24108_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	2.3e-118
WP_171503505.1|25391_25955_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	29.5	7.5e-11
WP_160124369.1|27219_28515_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_160124370.1|28525_29743_-	PucR family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005244938.1|29739_31017_-	cytosine permease	NA	NA	NA	NA	NA
WP_004778193.1|31379_31811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005244939.1|32028_32700_+	lipase chaperone	NA	NA	NA	NA	NA
WP_160124371.1|32696_33581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010589064.1|40457_41414_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	2.2e-55
WP_004986500.1|42060_43356_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	52.7	4.4e-131
WP_004986501.1|43370_43997_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	42.2	9.1e-26
WP_004986506.1|44108_44750_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	53.5	3.2e-50
WP_004986518.1|45290_45527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004986524.1|47441_47732_+	type II toxin-antitoxin system HigB family toxin	NA	F5A3A2	Riemerella_phage	36.5	6.1e-09
WP_004986525.1|47733_48135_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002045824.1|49231_50395_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.4	9.4e-08
WP_004986534.1|51396_51537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004986535.1|51604_53683_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.0	1.0e-134
WP_160124378.1|53973_54663_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_103800267.1|54664_55755_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004981674.1|55917_56214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004986537.1|56321_56498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004986541.1|57120_58527_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_004986545.1|58728_58962_-	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_104794984.1|59227_60241_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005005846.1|60228_61005_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_005005841.1|60997_61597_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048766483.1|61593_62238_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004986555.1|62621_63812_+	MFS transporter	NA	NA	NA	NA	NA
WP_004986558.1|63875_65312_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_004986561.1|65299_66151_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_004986570.1|66691_67393_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	53.6	1.6e-34
WP_004986572.1|67456_67651_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004986576.1|67643_68906_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_004984985.1|69468_69696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004984984.1|69789_70059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160124373.1|72165_73365_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	28.3	2.4e-38
WP_160124379.1|73392_73614_+	antitoxin HicB	NA	NA	NA	NA	NA
WP_004762875.1|73810_74062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004762874.1|74257_74479_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_160124374.1|74671_75634_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.0	1.5e-32
WP_100834114.1|76640_77784_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	28.1	4.6e-15
WP_020899627.1|78562_79888_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_160124377.1|81164_81869_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	84.1	6.7e-118
WP_039908973.1|83129_83525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087486619.1|83600_84819_+|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
