The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045674	Klebsiella pneumoniae strain WSD411 chromosome, complete genome	5345246	2061595	2110751	5345246	transposase,plate,protease	Staphylococcus_phage(25.0%)	39	NA	NA
WP_004175481.1|2061595_2062342_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_004180416.1|2062821_2063679_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_020324956.1|2063834_2064821_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004180414.1|2064813_2065614_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004145488.1|2065651_2065774_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_020324950.1|2066391_2067333_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_004180413.1|2067426_2068416_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2068441_2069773_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_004175486.1|2069800_2071009_+	propionate kinase	NA	NA	NA	NA	NA
WP_004180412.1|2071037_2073332_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	1.4e-159
WP_022631354.1|2073761_2074877_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|2074986_2075901_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004148804.1|2075910_2077197_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004148803.1|2077193_2078069_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004175491.1|2078065_2078785_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|2078790_2079684_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|2079967_2081611_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|2081660_2082137_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2082237_2083164_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2083467_2084763_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004175495.1|2084777_2085584_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152315.1|2085558_2086458_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000608644.1|2087023_2088286_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|2088541_2089417_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|2089463_2089796_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_020324968.1|2092049_2092748_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	6.9e-06
WP_004899028.1|2092773_2093358_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2093427_2093757_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_015874925.1|2094324_2095665_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004180407.1|2095661_2096315_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004180406.1|2096318_2098016_+	OmpA family protein	NA	NA	NA	NA	NA
WP_020324953.1|2098477_2100934_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004180396.1|2102023_2102290_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004180395.1|2102293_2103451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020323959.1|2103434_2106845_+	intracellular multiplication/macrophage-killing	NA	NA	NA	NA	NA
WP_020323961.1|2106978_2108742_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022631358.1|2108741_2109788_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_021314026.1|2109762_2110305_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004175538.1|2110307_2110751_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP045674	Klebsiella pneumoniae strain WSD411 chromosome, complete genome	5345246	2814446	2825333	5345246		Escherichia_phage(87.5%)	9	NA	NA
WP_004179756.1|2814446_2817554_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2817608_2818874_+	MFS transporter	NA	NA	NA	NA	NA
WP_004179755.1|2818904_2819993_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176262.1|2820079_2820340_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179754.1|2820637_2821498_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|2821518_2822280_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2822540_2823443_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004179748.1|2823454_2824720_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002210516.1|2824712_2825333_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 3
NZ_CP045674	Klebsiella pneumoniae strain WSD411 chromosome, complete genome	5345246	3225424	3271095	5345246	portal,plate,integrase,tRNA,head,terminase,tail,capsid	Enterobacteria_phage(54.29%)	56	3230648:3230669	3267357:3267378
WP_004179374.1|3225424_3225925_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3226041_3226488_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3226471_3227263_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|3227364_3228549_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004179371.1|3228580_3229273_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3229418_3229928_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3229914_3230271_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004179368.1|3230260_3230500_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3230648:3230669	attL	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|3230764_3231016_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_020324077.1|3231059_3232199_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
WP_020324084.1|3232353_3233526_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
WP_004216461.1|3233525_3234041_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|3234086_3234404_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|3234403_3234562_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_020324072.1|3234548_3237524_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	1.8e-220
WP_032408799.1|3237539_3238031_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
WP_020324073.1|3238275_3239634_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	28.7	7.5e-49
WP_020324070.1|3239787_3240885_-|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_020324108.1|3240884_3241097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806131.1|3241093_3244120_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_020324110.1|3244109_3245033_-|plate	baseplate J-like protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
WP_020324083.1|3245034_3245385_-	lysozyme	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	9.3e-28
WP_009486481.1|3245381_3245969_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020324118.1|3245965_3246601_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_020324102.1|3246597_3247065_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_157833084.1|3247065_3247401_-	peptidase	NA	B6SD31	Bacteriophage	33.3	4.3e-06
WP_020324098.1|3247587_3248133_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
WP_020324103.1|3248129_3248414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|3248404_3248605_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_020324071.1|3248604_3249120_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
WP_020324091.1|3249224_3250091_-|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
WP_020324085.1|3250140_3251175_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
WP_020324109.1|3251185_3252025_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
WP_020324092.1|3252181_3253909_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
WP_044816202.1|3253902_3254964_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
WP_020324107.1|3255440_3256193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806129.1|3256506_3256659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324074.1|3257114_3258122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324106.1|3258114_3260061_-	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
WP_020324090.1|3260318_3262466_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
WP_020324116.1|3262503_3263439_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
WP_032408797.1|3263671_3264238_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
WP_020324115.1|3264234_3264459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324111.1|3264536_3264800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324119.1|3264815_3265193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|3265208_3265427_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|3265447_3265726_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|3265846_3266146_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_004216842.1|3266261_3267245_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
WP_004176549.1|3267509_3268523_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3267357:3267378	attR	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|3268580_3268682_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3268681_3268756_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3268873_3268999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190891.1|3269058_3269322_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_020324076.1|3269452_3270091_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_008807690.1|3270180_3271095_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
>prophage 4
NZ_CP045674	Klebsiella pneumoniae strain WSD411 chromosome, complete genome	5345246	3550270	3559733	5345246	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_020323882.1|3550270_3551992_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
WP_002898014.1|3552036_3552738_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3553091_3553310_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3553429_3555709_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3555739_3556057_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3556382_3556604_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3556680_3558621_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3558617_3559733_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP045675	Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence	177848	14798	60670	177848	transposase,integrase	Bacillus_phage(18.75%)	40	NA	NA
WP_071647026.1|14798_15722_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	1.1e-165
WP_077250517.1|15836_15995_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
WP_004213558.1|16307_17237_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_004213560.1|17381_18161_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_077250520.1|18157_18970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116430748.1|19902_20877_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_023302803.1|21513_22422_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_004213569.1|22808_23159_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	3.2e-20
WP_023302802.1|23302_23734_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004213574.1|25453_26134_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.7	1.3e-30
WP_004213577.1|26323_27709_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_004213578.1|27737_28100_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004213579.1|28213_29506_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000080200.1|30808_32422_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000624722.1|32452_32803_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|32799_33225_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000758228.1|35289_35730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|35856_38304_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|38344_38542_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|38575_39313_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|39601_40051_-	copper resistance protein	NA	NA	NA	NA	NA
WP_004213580.1|40284_42102_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_011251290.1|42101_42998_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|43037_43418_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004213583.1|43422_44352_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|44406_45087_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|45083_46484_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_000427623.1|47011_48016_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000405672.1|48106_48541_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004213585.1|48626_51032_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000118563.1|51028_52105_+	signal peptidase II	NA	NA	NA	NA	NA
WP_004213590.1|52234_52792_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
WP_004213592.1|52794_55764_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
WP_000427623.1|55842_56847_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004213594.1|57132_57627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213596.1|57687_57891_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004213598.1|57904_58135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213599.1|58329_58596_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004098919.1|58583_59066_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001567368.1|59266_60670_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP045675	Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence	177848	113798	159072	177848	transposase,protease	Caulobacter_phage(18.75%)	43	NA	NA
WP_029884700.1|113798_114794_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|114999_116013_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004210220.1|116125_116653_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077250518.1|116666_119624_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
WP_004144375.1|120465_121326_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_011251321.1|123057_123693_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_029884674.1|124029_125271_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.2	2.2e-10
WP_004026611.1|125355_125931_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
WP_004026609.1|126017_126596_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_012540178.1|126634_127675_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.1e-71
WP_004026604.1|127698_128154_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_023287201.1|128176_129328_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004210240.1|129324_129909_-	tellurium resistance protein	NA	K4JRX3	Caulobacter_phage	29.9	1.8e-12
WP_023302789.1|130220_131279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023287198.1|131290_132433_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	6.3e-33
WP_029884673.1|132425_133199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004210251.1|133200_134280_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	1.1e-39
WP_014386544.1|134279_135236_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_029884672.1|135246_136470_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_004026591.1|136472_136931_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_004210261.1|137410_138049_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|138073_138715_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_004210266.1|138715_139354_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004210269.1|139446_140487_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_029884671.1|140486_142220_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_029884670.1|142247_143747_+	kinase	NA	NA	NA	NA	NA
WP_029884669.1|144138_144867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029884668.1|144883_145717_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_071646983.1|146053_146458_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_004210285.1|146516_146795_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004210286.1|146888_147101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900807.1|148001_148454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001166628.1|149112_149568_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|149639_150005_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|150020_150296_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|150323_150749_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|150787_152473_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|152490_152856_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|152852_153089_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001067855.1|153159_153864_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001162012.1|154456_155014_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|155016_157989_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000427620.1|158067_159072_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP045675	Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence	177848	169647	177119	177848	transposase	Stx2-converting_phage(28.57%)	7	NA	NA
WP_004213807.1|169647_170616_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_014839879.1|170943_172536_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.2e-175
WP_004189161.1|172566_172917_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|172913_173354_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004902307.1|173550_173733_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004117790.1|174981_175953_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004211841.1|175952_177119_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
>prophage 1
NZ_CP045676	Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence	146858	1101	59545	146858	transposase,integrase,protease	Escherichia_phage(28.57%)	52	NA	NA
WP_001067855.1|1101_1806_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014386481.1|7025_7670_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_001067855.1|8542_9247_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|9792_10806_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|10961_11435_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|11655_11922_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|12064_12829_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|13089_14304_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|14337_15771_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001067855.1|16089_16794_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|19672_20005_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|20051_20927_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|21182_22445_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|23008_23566_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|23748_24609_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001120891.1|24818_25358_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|25329_26166_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|26165_26969_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|27029_27845_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|28174_28351_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|28532_29537_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|31135_31840_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001445937.1|32220_33177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|33361_33973_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|34026_34308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|34480_34816_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001067855.1|35836_36541_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001695382.1|36653_36995_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	50.0	3.4e-19
WP_015065500.1|37041_37692_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.6	1.8e-77
WP_019725651.1|37988_38984_+	hypothetical protein	NA	A0A2H4UVR4	Bodo_saltans_virus	34.9	2.1e-32
WP_019725650.1|39056_39380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567369.1|39799_40432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|40460_41864_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_023288255.1|41975_43508_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_032720638.1|45438_45762_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032720637.1|45810_46113_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153591440.1|46155_46323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032720701.1|46510_46690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032720636.1|46713_47097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032720635.1|47201_47774_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032720700.1|47775_48564_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_050548604.1|48599_49520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044266755.1|49822_50317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044266753.1|50347_50920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044266751.1|50916_51165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058650054.1|51730_52075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016338367.1|52182_52818_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_016338368.1|52817_54926_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
WP_016338369.1|54915_56193_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_032425563.1|57769_58186_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016338373.1|58182_58413_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_126834912.1|58630_59545_-|protease	CAAX protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP045676	Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence	146858	71507	83599	146858		Enterobacteria_phage(25.0%)	12	NA	NA
WP_004152345.1|71507_73535_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004227314.1|73646_73862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|74086_74419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|74795_75770_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|75766_76972_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|77293_78190_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|78590_79862_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|79861_80293_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|80524_81496_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|81498_82170_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|82230_82461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|82897_83599_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
>prophage 1
NZ_CP045677	Klebsiella pneumoniae strain WSD411 plasmid pWSD411_4, complete sequence	128536	0	94809	128536	transposase,tail,terminase,portal,integrase	Salmonella_phage(80.26%)	94	25794:25822	36665:36693
WP_019704554.1|0_1098_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.2e-73
WP_014342074.1|1549_1762_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_040120273.1|1761_2097_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.1e-37
WP_040120272.1|2806_3883_-	recombinase	NA	J9Q736	Salmonella_phage	96.4	3.8e-197
WP_040120271.1|3885_4152_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	83.0	1.1e-33
WP_021313784.1|4151_5096_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.6	2.8e-172
WP_032440516.1|5156_6164_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	88.3	2.1e-144
WP_032440517.1|6283_6715_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.1e-65
WP_040120270.1|6870_7170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021313788.1|7180_7600_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	62.6	6.3e-47
WP_040120269.1|7800_8244_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.7	1.5e-59
WP_072196429.1|8240_9410_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	92.8	5.2e-208
WP_071889212.1|9431_10127_-	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	37.1	4.9e-20
WP_074171157.1|10129_12493_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	86.9	0.0e+00
WP_032439780.1|12673_13906_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.4	2.2e-212
WP_040120268.1|14002_16288_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	62.9	2.3e-244
WP_014342091.1|16889_17270_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_040120267.1|17264_18365_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.6e-17
WP_021313793.1|18713_19073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279483.1|19137_19548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120266.1|19557_20175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026005930.1|20269_20515_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	5.3e-14
WP_040120265.1|20645_21422_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	66.5	1.0e-90
WP_040120264.1|21533_22406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022631165.1|23787_24708_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	47.0	2.3e-41
WP_001173919.1|24820_25396_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
WP_012585400.1|25522_25771_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
25794:25822	attL	CTGGTGCAGTCGTCTTCTGAAAATGACAC	NA	NA	NA	NA
WP_023277723.1|25877_26039_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	72.7	4.7e-11
WP_000845048.1|26213_27227_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000237816.1|27399_27852_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_022631163.1|27932_29186_-	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	29.7	3.0e-12
WP_022631510.1|29906_30461_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_015632396.1|30871_31651_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtF1	NA	NA	NA	NA	NA
WP_031281281.1|33299_33932_-	type B chloramphenicol O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.9	2.6e-28
WP_000376623.1|34714_35215_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152787.1|35197_35338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|35721_36486_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_023356273.1|36828_37068_+	hypothetical protein	NA	NA	NA	NA	NA
36665:36693	attR	CTGGTGCAGTCGTCTTCTGAAAATGACAC	NA	NA	NA	NA
WP_022631505.1|37067_37478_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_015632391.1|37481_40475_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	46.6	1.3e-258
WP_126834932.1|40519_40705_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	68.5	1.4e-11
WP_052115711.1|40949_41417_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	64.6	6.8e-50
WP_040120262.1|41496_42285_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	50.4	9.0e-71
WP_040120261.1|42572_43739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120260.1|43773_44892_-	DNA primase	NA	J9Q720	Salmonella_phage	91.6	1.1e-202
WP_004110189.1|45045_46386_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	95.7	1.6e-240
WP_040120259.1|46450_47176_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	3.3e-128
WP_021313114.1|47369_48128_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	98.0	1.6e-146
WP_019704530.1|48173_48536_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_032440479.1|48535_49201_-	P-loop NTPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_021313116.1|49357_50146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052115713.1|50146_50488_-	hypothetical protein	NA	A0A222YY00	Escherichia_phage	41.8	2.6e-14
WP_040120258.1|50961_51213_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	71.1	2.9e-23
WP_040120257.1|51215_51908_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	88.7	2.7e-119
WP_004109805.1|51921_52245_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_032422978.1|52340_53786_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	37.5	4.4e-39
WP_040120256.1|53838_66009_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	59.8	2.8e-30
WP_019704527.1|66025_66637_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_004109817.1|66624_67422_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_004109820.1|67414_68113_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_032423010.1|68199_68535_-|tail	tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
WP_040120255.1|68578_73108_-	tape measure protein	NA	J9Q712	Salmonella_phage	68.9	0.0e+00
WP_004109830.1|73115_73349_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
WP_004109835.1|73465_73783_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_040120254.1|73844_74591_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.4	1.6e-106
WP_021313125.1|74657_75050_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	67.5	1.0e-46
WP_021313126.1|75051_75525_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_004109848.1|75515_75860_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_032440486.1|75957_76791_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.8	3.7e-131
WP_032423015.1|76790_77225_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_040120253.1|77272_77701_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	69.7	2.3e-28
WP_004109857.1|77779_78658_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_014342135.1|78684_79584_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
WP_086626163.1|79606_81196_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.4	1.5e-274
WP_004109863.1|81213_82470_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_040120251.1|82472_83114_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	87.7	1.5e-95
WP_004109869.1|83289_83556_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_026005938.1|83565_84465_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	4.2e-165
WP_019704585.1|84461_84716_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	2.0e-40
WP_046882064.1|84708_85347_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.2	3.9e-109
WP_040120250.1|85343_86012_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	93.5	1.9e-106
WP_040120249.1|86011_86692_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.7	3.6e-108
WP_040120248.1|86775_88335_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.7	1.3e-278
WP_014342145.1|88337_88613_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
WP_019704582.1|88663_89101_-	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
WP_014342147.1|89256_89787_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_004109892.1|90420_91071_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_040120247.1|91916_92399_-	hypothetical protein	NA	J9Q805	Salmonella_phage	77.5	2.7e-70
WP_040120246.1|92604_92886_-	ABC transporter	NA	J9Q753	Salmonella_phage	82.8	2.9e-40
WP_021313142.1|92888_93263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004109918.1|93390_93798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120245.1|93917_94229_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.0	8.8e-30
WP_040120244.1|94365_94578_-	hypothetical protein	NA	J9Q804	Salmonella_phage	74.3	9.9e-25
WP_019704577.1|94590_94809_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
>prophage 2
NZ_CP045677	Klebsiella pneumoniae strain WSD411 plasmid pWSD411_4, complete sequence	128536	98753	128216	128536		Salmonella_phage(76.0%)	26	NA	NA
WP_040120289.1|98753_100310_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	1.9e-104
WP_040120288.1|100306_101530_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	23.2	5.4e-14
WP_040120287.1|101646_104763_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.7	2.3e-24
WP_040120285.1|105168_105747_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	56.5	8.6e-55
WP_040120284.1|105874_106030_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	59.2	3.7e-05
WP_032439715.1|106029_106455_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	80.9	7.5e-56
WP_023343110.1|106755_107295_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	46.0	6.4e-28
WP_019704565.1|107452_108040_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
WP_019704564.1|108612_108846_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.7e-31
WP_040120283.1|109822_110665_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	88.6	3.0e-104
WP_044816135.1|110885_111992_+	DUF697 domain-containing protein	NA	NA	NA	NA	NA
WP_021313768.1|112030_112573_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	96.6	8.6e-97
WP_040120281.1|112582_113002_-	hypothetical protein	NA	J9Q743	Salmonella_phage	96.4	1.3e-65
WP_040120280.1|113065_113710_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	99.5	2.0e-116
WP_040120279.1|113709_114186_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	98.7	7.5e-89
WP_032423043.1|114182_114596_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	77.4	6.2e-55
WP_032423044.1|114597_115701_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	80.1	6.7e-181
WP_040120278.1|115894_116770_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	84.4	1.7e-139
WP_014342181.1|116847_117990_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_040120277.1|118120_120424_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.7	0.0e+00
WP_021313773.1|120499_121069_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
WP_040120276.1|121078_121825_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	61.7	1.3e-79
WP_032443572.1|121814_123731_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.6	2.8e-299
WP_040120275.1|123960_125046_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.5	7.0e-183
WP_019704555.1|125698_127258_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	52.3	6.6e-57
WP_040120274.1|127571_128216_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.2	2.4e-98
>prophage 1
NZ_CP045678	Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence	94887	2915	47103	94887	transposase,integrase	Escherichia_phage(36.36%)	40	68:82	24639:24653
68:82	attL	GTGTTAACAATAAAC	NA	NA	NA	NA
WP_004197635.1|2915_3710_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_017899884.1|3907_4924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389906.1|4934_5249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380813.1|5275_5635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023785.1|5839_6145_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_006788213.1|6146_6365_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_016162066.1|6945_7515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568023.1|7655_8684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568022.1|8828_11633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839879.1|12217_13810_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.2e-175
WP_004189161.1|13840_14191_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|14187_14628_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_001531258.1|15308_16091_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_032441952.1|16087_17110_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.6	8.7e-175
WP_001568019.1|18139_19867_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001568018.1|20312_20561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632385.1|20557_21130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568016.1|21160_21655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568014.1|21887_22196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567366.1|22689_23238_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_001567367.1|23284_23719_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001567368.1|23989_25393_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
24639:24653	attR	GTGTTAACAATAAAC	NA	NA	NA	NA
WP_001567369.1|25421_26054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|26272_27676_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|27704_28337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077253394.1|28562_29909_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_126834976.1|29957_30362_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_015632388.1|31224_32508_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_015632389.1|32637_34830_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_001118616.1|35247_36171_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_022631502.1|36471_36672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|37086_38091_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100881.1|38169_41136_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|41210_41501_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|41497_41899_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|41888_42245_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|42499_42814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194048.1|43240_44422_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000509966.1|45081_45687_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001067855.1|46398_47103_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
