The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041973	Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 chromosome, complete genome	4690706	476943	482996	4690706		Salmonella_virus(50.0%)	6	NA	NA
WP_105789229.1|476943_477111_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
WP_105789228.1|477126_477270_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_000400616.1|478259_480182_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_000703599.1|480199_480454_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|480422_480812_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000377779.1|482054_482996_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 2
NZ_CP041973	Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 chromosome, complete genome	4690706	719420	728591	4690706	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|719420_720368_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|720351_721083_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|721063_721171_-	protein YohO	NA	NA	NA	NA	NA
WP_001240420.1|721230_721962_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
WP_000272845.1|722184_723870_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|723866_724586_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|724632_725100_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|725156_725687_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|725858_726317_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|726557_728591_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP041973	Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 chromosome, complete genome	4690706	795789	806296	4690706		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|795789_797193_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|797370_798264_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|798640_799726_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|799725_800625_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|800672_801551_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|801551_802103_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|802108_803083_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|803098_803872_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|803876_804956_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|804982_806296_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP041973	Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 chromosome, complete genome	4690706	919218	966714	4690706	plate,holin,integrase,tail,transposase,portal,protease,terminase,capsid,head	Salmonella_phage(77.78%)	60	922119:922133	970493:970507
WP_001680077.1|919218_920493_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
WP_001675175.1|921156_921447_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	1.2e-07
WP_000598920.1|921818_922616_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
922119:922133	attL	AGGGATGCCGCTGGC	NA	NA	NA	NA
WP_000532847.1|922907_923897_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|923898_924141_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061370.1|924165_924735_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_000208076.1|924731_925595_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_000267991.1|925591_925885_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000065085.1|926156_926516_-	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000071068.1|926512_927028_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000764235.1|927024_927255_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|927325_927865_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000551790.1|927959_928877_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_000078504.1|929446_929698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067433.1|929773_929959_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_001020644.1|930164_930860_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_001191666.1|930957_931182_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509728.1|931210_931765_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
WP_001087406.1|931761_932919_+	peptidase	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_000620702.1|932915_933140_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000096529.1|933136_934111_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000054227.1|934107_934581_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_000200166.1|934577_935459_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000779149.1|935467_935857_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_001061459.1|935873_936734_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
WP_012543375.1|936741_937731_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_001047141.1|937744_938497_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
WP_000357930.1|938546_939620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765639.1|939632_940205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294874.1|940293_940683_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000226304.1|940669_940951_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001075993.1|940950_941568_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000127618.1|941564_942104_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001135228.1|942127_942478_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000501481.1|942624_943062_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_000257219.1|943061_944792_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
WP_077905357.1|945063_946158_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000003793.1|946150_946753_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_000766103.1|946762_947992_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000927251.1|948071_948395_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000776844.1|948391_948796_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_001135695.1|948767_949280_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000779215.1|949276_949837_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_000497739.1|949840_950005_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007993.1|949994_951491_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000515952.1|951490_951847_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|951843_952170_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785387.1|952254_954183_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000863817.1|954216_955557_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_001066630.1|955553_956612_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273650.1|956611_957145_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_000605050.1|957149_957563_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001699732.1|957555_958635_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	5.5e-204
WP_001207832.1|958637_959225_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554738.1|959211_960774_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	9.8e-287
WP_000760554.1|960773_961343_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000492926.1|961627_962635_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|962847_963069_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_001176778.1|964411_965230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028172.1|965691_966714_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
970493:970507	attR	AGGGATGCCGCTGGC	NA	NA	NA	NA
>prophage 5
NZ_CP041973	Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 chromosome, complete genome	4690706	1499077	1515019	4690706	holin,tRNA	Escherichia_phage(62.5%)	21	NA	NA
WP_001082296.1|1499077_1499512_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|1499561_1499900_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000802786.1|1500745_1501291_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|1501287_1501569_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|1501558_1501747_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|1501668_1502064_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|1504234_1504771_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|1504767_1505058_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|1505057_1505657_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|1506180_1506393_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556390.1|1506761_1507694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|1507690_1508245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|1508406_1508736_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|1509007_1509475_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|1509859_1510015_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|1510122_1510644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|1511081_1511303_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|1511387_1511705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|1511732_1512350_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|1512666_1513602_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|1513645_1515019_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP041973	Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 chromosome, complete genome	4690706	1739444	1755559	4690706	tail,holin,lysis,integrase	Salmonella_phage(30.77%)	16	1736074:1736103	1755695:1755724
1736074:1736103	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|1739444_1740308_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|1742948_1743644_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|1743733_1744267_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|1745161_1745641_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|1745658_1746111_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|1746094_1746424_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|1746699_1747386_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|1747746_1748196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|1748569_1749094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|1749190_1749880_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|1750009_1750237_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|1750233_1750833_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|1750896_1751202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|1751833_1753813_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|1754226_1754505_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|1754479_1755559_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
1755695:1755724	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP041973	Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 chromosome, complete genome	4690706	1927944	1968640	4690706	tail,protease	Salmonella_phage(28.57%)	39	NA	NA
WP_000938186.1|1927944_1928625_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|1929243_1929903_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|1929989_1930319_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|1930315_1930597_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|1930645_1931425_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|1931450_1931999_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|1932213_1933425_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|1933482_1933800_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|1933844_1934261_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_151256218.1|1934431_1935163_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|1935187_1935646_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|1935681_1937736_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|1937859_1938306_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|1938324_1940478_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|1940464_1941070_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|1941286_1941796_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|1942152_1943205_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|1943276_1943729_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|1943914_1945675_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|1945743_1946262_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|1946361_1946529_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|1946784_1947348_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|1947344_1948985_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|1948989_1950243_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|1950257_1952165_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|1952177_1954286_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_001574119.1|1955489_1956032_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|1956197_1957208_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|1957415_1960028_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|1960454_1960646_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|1960916_1961603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|1961962_1962589_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|1963236_1964205_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|1964430_1964679_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|1964682_1965264_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|1965263_1966973_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|1966969_1967596_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|1967579_1968209_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|1968229_1968640_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 8
NZ_CP041973	Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 chromosome, complete genome	4690706	2039917	2047230	4690706	integrase,protease	Ralstonia_phage(16.67%)	7	2034714:2034728	2045966:2045980
2034714:2034728	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2039917_2040295_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2040456_2040654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2040866_2043143_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2043173_2043494_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2043817_2044039_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2044168_2046115_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2045966:2045980	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2046111_2047230_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
