The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030262	Ensifer adhaerens strain Corn53 chromosome, complete genome	4049947	2046385	2068053	4049947	terminase,tail,head	Sinorhizobium_phage(65.0%)	27	NA	NA
WP_159415632.1|2046385_2048974_-	hypothetical protein	NA	A0A076G8H4	Sinorhizobium_phage	64.9	2.7e-241
WP_159415491.1|2048997_2049405_-	hypothetical protein	NA	A0A076G6J4	Sinorhizobium_phage	55.7	3.0e-38
WP_159415492.1|2049410_2050013_-	hypothetical protein	NA	A0A076G707	Sinorhizobium_phage	73.0	2.0e-78
WP_159415493.1|2050013_2050748_-	hypothetical protein	NA	A0A076GD29	Sinorhizobium_phage	66.4	3.9e-92
WP_159415494.1|2050751_2053574_-|tail	phage tail tape measure protein	tail	A0A076G7H2	Sinorhizobium_phage	93.0	0.0e+00
WP_159415495.1|2053577_2053871_-	hypothetical protein	NA	A0A076G6J1	Sinorhizobium_phage	92.8	2.2e-46
WP_159415496.1|2053924_2054341_-	hypothetical protein	NA	A0A076G701	Sinorhizobium_phage	97.8	1.9e-67
WP_159415497.1|2054340_2055078_-	hypothetical protein	NA	A0A076GD25	Sinorhizobium_phage	98.8	2.9e-132
WP_159415498.1|2055135_2055567_-	hypothetical protein	NA	A0A076G7G6	Sinorhizobium_phage	89.5	1.6e-69
WP_159415499.1|2055739_2056222_-	hypothetical protein	NA	A0A076G8G8	Sinorhizobium_phage	98.1	6.3e-83
WP_159415500.1|2056221_2057274_-|head	head morphogenesis protein	head	A0A076G6I6	Sinorhizobium_phage	97.0	2.1e-179
WP_159415501.1|2057554_2058103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159415502.1|2058121_2058484_-	hypothetical protein	NA	A0A076G8G5	Sinorhizobium_phage	81.7	5.8e-49
WP_159415503.1|2058483_2058978_-	hypothetical protein	NA	A0A059VG19	Pseudomonas_phage	42.0	1.2e-17
WP_159415504.1|2059049_2059427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159415505.1|2059465_2059822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159415506.1|2059834_2060773_-	DUF2184 domain-containing protein	NA	L7TMZ5	Rhizobium_phage	39.6	5.5e-51
WP_159415507.1|2060784_2061249_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_159415508.1|2061248_2062397_-	DUF2213 domain-containing protein	NA	A0A2R3UA67	Siphoviridae_environmental_samples	46.6	4.8e-73
WP_159415509.1|2062511_2062766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159415510.1|2062767_2064600_-	DUF1073 domain-containing protein	NA	L7TRA1	Rhizobium_phage	53.3	4.2e-180
WP_159415511.1|2064608_2066009_-|terminase	phage terminase large subunit	terminase	D4N436	Pseudomonas_phage	38.7	1.5e-84
WP_159415512.1|2065995_2066460_-	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	55.6	2.2e-37
WP_159415513.1|2066483_2066708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159415633.1|2066704_2067325_-	hypothetical protein	NA	H9C189	Pectobacterium_phage	52.2	3.2e-55
WP_159415514.1|2067437_2067719_+	CRISPR-associated protein Cas2	NA	NA	NA	NA	NA
WP_060530064.1|2067801_2068053_-	hypothetical protein	NA	A0A076G7F1	Sinorhizobium_phage	96.4	8.9e-41
>prophage 2
NZ_CP030262	Ensifer adhaerens strain Corn53 chromosome, complete genome	4049947	2076656	2084042	4049947		Sinorhizobium_phage(33.33%)	13	NA	NA
WP_159415529.1|2076656_2077550_-	hypothetical protein	NA	A0A076GD00	Sinorhizobium_phage	70.1	5.6e-77
WP_113479490.1|2077546_2077765_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159415530.1|2077859_2078498_+	helix-turn-helix domain-containing protein	NA	B5WZX5	Pseudomonas_phage	29.8	3.7e-06
WP_159415531.1|2078509_2079361_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_159415532.1|2079545_2079845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159415533.1|2080038_2080263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159415534.1|2080262_2080499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159415535.1|2080495_2080873_+	hypothetical protein	NA	A0A240F4V4	Ochrobactrum_phage	66.4	1.5e-39
WP_159415536.1|2080869_2081106_+	hypothetical protein	NA	A0A076G7C7	Sinorhizobium_phage	88.5	7.6e-34
WP_159415537.1|2081105_2081639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159415538.1|2081641_2082652_+	phage recombination protein Bet	NA	NA	NA	NA	NA
WP_159415539.1|2082654_2083176_+	hypothetical protein	NA	B0VK83	Azospirillum_phage	45.4	9.3e-32
WP_159415540.1|2083175_2084042_+	DUF5131 family protein	NA	A0A240F4U9	Ochrobactrum_phage	54.3	4.7e-65
>prophage 3
NZ_CP030262	Ensifer adhaerens strain Corn53 chromosome, complete genome	4049947	2170956	2186356	4049947	tRNA	uncultured_Mediterranean_phage(83.33%)	15	NA	NA
WP_034796609.1|2170956_2173527_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.6	8.0e-60
WP_034796611.1|2173572_2173908_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	36.5	1.3e-10
WP_034796613.1|2174210_2175080_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_034796615.1|2175196_2176750_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	35.9	1.1e-14
WP_034796617.1|2176937_2177582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034796623.1|2177798_2178452_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	35.1	1.8e-16
WP_034796625.1|2178448_2179219_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	32.2	3.6e-24
WP_034796627.1|2179245_2180529_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.5	7.5e-99
WP_034796629.1|2180575_2181418_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	42.8	5.9e-44
WP_034796640.1|2181414_2182131_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_034796642.1|2182205_2182412_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	72.7	5.7e-09
WP_034796644.1|2182503_2183616_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	32.6	2.5e-10
WP_034796646.1|2183698_2184427_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	46.4	2.9e-39
WP_034796647.1|2184419_2185286_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.7	2.5e-34
WP_034796757.1|2185339_2186356_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.6	6.9e-23
>prophage 1
NZ_CP030263	Ensifer adhaerens strain Corn53 plasmid AA, complete sequence	1790007	922486	969274	1790007	protease,transposase	Acidithiobacillus_phage(18.18%)	38	NA	NA
WP_090428670.1|922486_923131_+|protease	DUF922 domain-containing Zn-dependent protease	protease	NA	NA	NA	NA
WP_034800086.1|923185_923800_-	acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	26.4	3.9e-05
WP_034800087.1|923796_924504_-	phosphonate C-P lyase system protein PhnL	NA	F2Y302	Organic_Lake_phycodnavirus	31.4	3.0e-09
WP_043623284.1|924507_925284_-	phosphonate C-P lyase system protein PhnK	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.3e-13
WP_159415827.1|925280_926159_-	carbon-phosphorus lyase	NA	NA	NA	NA	NA
WP_089046001.1|926203_926398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159415828.1|926424_927534_-	carbon-phosphorus lyase complex subunit PhnI	NA	NA	NA	NA	NA
WP_159415829.1|927537_928146_-	phosphonate C-P lyase system protein PhnH	NA	NA	NA	NA	NA
WP_159416104.1|928145_928613_-	phosphonate C-P lyase system protein PhnG	NA	NA	NA	NA	NA
WP_029742729.1|928703_929453_+	phosphonate metabolism transcriptional regulator PhnF	NA	A0A2H5BLU5	Streptomyces_phage	39.1	3.7e-05
WP_034800094.1|929622_931017_+	selenium-binding protein	NA	NA	NA	NA	NA
WP_029742731.1|931050_931677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029742732.1|931697_932390_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_034800095.1|932481_933072_-	VOC family protein	NA	NA	NA	NA	NA
WP_034800096.1|933359_933959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051659534.1|933955_934549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034800098.1|934560_935100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034800100.1|935080_936343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034800101.1|936423_938562_-	methylmalonyl-CoA mutase	NA	NA	NA	NA	NA
WP_159415830.1|938602_940606_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_034800118.1|940636_940903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034800104.1|940938_942471_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_034800105.1|942628_944047_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_089046011.1|944158_945307_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_034800107.1|945330_946389_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_034800108.1|946447_947344_+	3-hydroxyisobutyrate dehydrogenase	NA	A0A077SLF7	Escherichia_phage	31.8	2.2e-25
WP_112773444.1|954058_955217_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	31.2	1.2e-18
WP_034803546.1|955654_955834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113133356.1|956045_956822_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.0	3.0e-58
WP_127891008.1|956834_958388_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.7	1.0e-105
WP_159415831.1|960078_960975_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.3	8.8e-30
WP_101792965.1|960971_962486_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_060529439.1|964633_964981_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	65.4	1.8e-39
WP_034804356.1|964977_965373_-	IS66 family insertion sequence hypothetical protein	NA	A0A1B0YZU7	Pseudomonas_phage	59.1	3.9e-06
WP_034805409.1|965686_966805_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_060529438.1|967127_967538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051659427.1|967525_968056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112772867.1|968213_969274_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP030263	Ensifer adhaerens strain Corn53 plasmid AA, complete sequence	1790007	1004511	1013546	1790007		Synechococcus_phage(33.33%)	8	NA	NA
WP_112772860.1|1004511_1006401_-	sulfate adenylyltransferase subunit CysN	NA	A0A2K9L4R9	Tupanvirus	43.6	6.6e-27
WP_112772859.1|1006400_1007300_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_159415842.1|1007411_1007768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112772870.1|1007820_1008834_-	glycosyltransferase	NA	I1TED8	Salmonella_phage	33.3	5.4e-44
WP_112772857.1|1008848_1009829_-	NAD(P)-dependent oxidoreductase	NA	A0A0E3FNQ3	Synechococcus_phage	26.3	1.4e-12
WP_090427312.1|1009922_1011146_-	class I SAM-dependent methyltransferase	NA	A0A1V0SJ68	Klosneuvirus	29.9	6.8e-41
WP_112772856.1|1011148_1012399_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	C7U074	Ostreococcus_tauri_virus	44.0	1.5e-72
WP_112772855.1|1012388_1013546_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.7	1.3e-14
>prophage 3
NZ_CP030263	Ensifer adhaerens strain Corn53 plasmid AA, complete sequence	1790007	1132551	1176765	1790007	transposase,integrase	Rhizobium_phage(27.27%)	38	1163010:1163069	1182278:1182362
WP_034800463.1|1132551_1133631_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159415890.1|1133960_1134251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112984665.1|1134296_1135322_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_159415891.1|1135353_1136895_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.9	5.8e-13
WP_159415892.1|1137061_1137991_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060529656.1|1138220_1139033_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_159415893.1|1139352_1140396_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_060529654.1|1140425_1141457_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_159415894.1|1141621_1142713_+	fatty acid desaturase	NA	V5LQD0	Emiliania_huxleyi_virus	25.5	8.8e-08
WP_127890676.1|1142743_1143061_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_159415895.1|1143110_1144337_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159415896.1|1144383_1145181_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_159415897.1|1145262_1146105_+	fatty acid hydroxylase family protein	NA	NA	NA	NA	NA
WP_159415898.1|1146296_1146452_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159415899.1|1149372_1149585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159415900.1|1150556_1151621_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_159415901.1|1151739_1154766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159415902.1|1155334_1155718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159415903.1|1155745_1156129_-	GNAT family N-acetyltransferase	NA	B4UTR3	Rhizobium_phage	72.4	8.0e-49
WP_159415904.1|1157055_1158054_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	38.2	7.7e-43
WP_159415905.1|1158053_1159211_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L470	Tupanvirus	29.1	4.2e-32
WP_159415906.1|1159207_1159918_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	29.5	5.2e-09
WP_159415907.1|1159886_1161020_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_159415908.1|1161158_1162211_+	pseudaminic acid synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	33.3	4.6e-30
WP_159415909.1|1162227_1162476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159415910.1|1162752_1163037_+|transposase	transposase	transposase	NA	NA	NA	NA
1163010:1163069	attL	TCGATCGCACCCGTTGTCCGCCACTTAGCGAAACGCTTGTCCGCGACTTGCTGAAATGAA	NA	NA	NA	NA
WP_159415911.1|1163521_1164310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159415912.1|1164306_1165350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159415913.1|1165621_1165987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159415914.1|1167221_1167857_+	methyltransferase domain-containing protein	NA	B4UTR6	Rhizobium_phage	66.4	2.0e-44
WP_159415915.1|1168291_1168507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159416111.1|1168807_1169122_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_159415916.1|1170075_1170711_+	methyltransferase domain-containing protein	NA	B4UTR6	Rhizobium_phage	64.9	5.4e-42
WP_112773458.1|1170781_1171231_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_018328350.1|1171227_1171581_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	53.8	1.5e-30
WP_159415917.1|1171627_1173328_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.5	6.0e-88
WP_159415918.1|1173634_1173847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112773470.1|1175241_1176765_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1182278:1182362	attR	TTCATTTCAGCAAGTCGCGGACAAGCGTTTCGCTAAGTGGCGGACAACGGGTGCGATCGAATTCCGGTTGCCTGGTTGCTGTTAC	NA	NA	NA	NA
