The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046703	Nostoc sp. ATCC 53789 chromosome, complete genome	7340101	409936	492313	7340101	transposase,protease	Tupanvirus(37.5%)	43	NA	NA
WP_159402611.1|409936_411158_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_114082663.1|411331_413098_-	fatty acyl-AMP ligase	NA	A0A2K9KZV5	Tupanvirus	22.1	4.7e-11
WP_159402431.1|413461_413611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114082664.1|413784_415389_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_114082665.1|415582_415936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114082666.1|415987_416608_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_114082667.1|416983_419077_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_114082668.1|419083_420214_-	DUF928 domain-containing protein	NA	NA	NA	NA	NA
WP_114082669.1|420234_422880_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_114082670.1|422952_425973_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_114082671.1|426919_429352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082672.1|429348_430341_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_114082673.1|430423_432085_+	urea transporter	NA	NA	NA	NA	NA
WP_114082674.1|432371_432743_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_114082675.1|432708_433215_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_114082678.1|434765_435587_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_114082679.1|435626_436733_-	zinc-binding dehydrogenase	NA	A0A2L2DIY2	Acanthamoeba_polyphaga_mimivirus	26.7	3.3e-10
WP_114082680.1|436781_437579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114082681.1|437680_439285_-	serine hydrolase	NA	NA	NA	NA	NA
WP_114082682.1|439383_441402_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	22.4	2.0e-05
WP_114082683.1|442086_453294_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	30.8	2.6e-219
WP_114082684.1|453290_467702_+	non-ribosomal peptide synthase/polyketide synthase	NA	A0A2K9KZV5	Tupanvirus	27.4	1.3e-130
WP_114082685.1|468282_470193_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_114082687.1|470693_471683_-	radical SAM/Cys-rich domain protein	NA	NA	NA	NA	NA
WP_114082688.1|471726_472686_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_114082689.1|472811_473780_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_114082690.1|474044_474719_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_114082691.1|474913_475201_-	nitrogenase	NA	NA	NA	NA	NA
WP_114082692.1|475575_476199_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_114082693.1|476311_476809_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_114082694.1|477131_477332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082695.1|478015_478345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082696.1|478417_478966_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_114082697.1|479013_480498_+	YARHG domain-containing protein	NA	A0A1V0SDQ4	Indivirus	27.1	1.5e-10
WP_114082698.1|481180_481540_+	nitrogenase	NA	NA	NA	NA	NA
WP_012408581.1|482402_483149_+	creatininase family protein	NA	NA	NA	NA	NA
WP_114082700.1|483293_483896_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_114082701.1|483990_485055_-	DUF3326 domain-containing protein	NA	NA	NA	NA	NA
WP_114082702.1|485661_488079_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_114082703.1|488326_488725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114082704.1|488963_490220_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_114082705.1|490444_490858_-|transposase	IS200/IS605 family transposase	transposase	A0A1L2BWN1	Bacteriophage	63.0	5.4e-43
WP_114082706.1|490924_492313_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	45.6	4.0e-82
>prophage 2
NZ_CP046703	Nostoc sp. ATCC 53789 chromosome, complete genome	7340101	553986	640842	7340101	transposase,protease	Tupanvirus(38.46%)	55	NA	NA
WP_114084414.1|553986_554400_-|transposase	IS200/IS605 family transposase	transposase	A0A7E6	Microcystis_virus	47.4	1.2e-29
WP_114084415.1|554453_555641_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	33.6	3.1e-51
WP_114084416.1|555680_556712_-	dihydroorotate dehydrogenase-like protein	NA	NA	NA	NA	NA
WP_114084417.1|556729_560365_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_159402433.1|561025_561217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114084419.1|561291_563235_-	alpha-amylase	NA	NA	NA	NA	NA
WP_114084420.1|563319_564726_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_114084421.1|565088_565541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114084422.1|565675_567304_-	NAD(P)-binding protein	NA	D2XAA7	Marseillevirus	24.8	6.7e-20
WP_114084423.1|567332_569252_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_114084424.1|569288_571196_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_114084425.1|571587_571806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114084426.1|572609_573917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114084429.1|574447_574762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114084427.1|574902_576798_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_114084428.1|576891_577569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159402434.1|577701_578715_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_114084430.1|578855_580712_+	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	28.6	4.6e-17
WP_114084431.1|581477_581828_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_114084432.1|583086_583767_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_114084433.1|583777_584209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114084434.1|584922_589212_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2K9L3I8	Tupanvirus	27.0	4.5e-07
WP_114084435.1|589212_594051_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.5	6.5e-111
WP_147262558.1|594193_594790_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_114084436.1|594799_595498_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_114084437.1|595510_596305_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_114084438.1|596398_601348_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.7	7.1e-97
WP_114084439.1|601382_601961_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	46.0	5.1e-31
WP_114084462.1|601990_603160_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_114084440.1|603179_604979_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_114084441.1|604999_605929_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_114084442.1|605952_607596_+	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
WP_114084443.1|607650_608145_+	GtrA family protein	NA	NA	NA	NA	NA
WP_114084444.1|608154_609291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114084445.1|609332_610853_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	33.3	2.5e-61
WP_114084446.1|610913_611888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114084447.1|612091_616735_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.0	3.1e-86
WP_114084463.1|616770_616950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114084448.1|616991_618365_+	MFS transporter	NA	A0A1B0RXG2	Streptococcus_phage	31.1	3.4e-33
WP_114084449.1|618594_620607_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	24.0	2.6e-05
WP_114084450.1|620998_623806_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_114084464.1|623837_624293_-|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_114084452.1|624933_626004_+	Photosystem Q(B) protein 1	NA	A0A1D8KNW7	Synechococcus_phage	66.8	8.0e-139
WP_114084453.1|626165_626921_-	TspO/MBR family protein	NA	NA	NA	NA	NA
WP_114084454.1|627307_627646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114084455.1|628043_629492_-	Ni/Fe hydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_114084456.1|629615_630254_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_114084457.1|630325_630871_-	oxidoreductase	NA	NA	NA	NA	NA
WP_114084458.1|631113_631638_-	DUF3122 domain-containing protein	NA	NA	NA	NA	NA
WP_114084459.1|631674_632391_-	bidirectional hydrogenase complex protein HoxU	NA	NA	NA	NA	NA
WP_114084460.1|632885_633536_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_114080505.1|635428_636478_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_159402435.1|638467_639040_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159402436.1|639581_640103_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_114080507.1|640158_640842_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP046703	Nostoc sp. ATCC 53789 chromosome, complete genome	7340101	1291643	1327239	7340101	transposase	Streptococcus_phage(25.0%)	36	NA	NA
WP_159402613.1|1291643_1292866_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_114081705.1|1293506_1294064_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_159402451.1|1294060_1294597_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_114080559.1|1294700_1294895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080558.1|1294948_1297588_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	26.4	7.6e-05
WP_114080557.1|1297792_1299106_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_159402452.1|1299104_1299272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080556.1|1299378_1300239_-	Tab2/Atab2 family RNA-binding protein	NA	NA	NA	NA	NA
WP_114080555.1|1300598_1301243_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_114080554.1|1301457_1302651_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_114080553.1|1302833_1303457_+	radical SAM protein	NA	A0A0K1Y4M0	Klebsiella_phage	32.1	1.6e-14
WP_147262440.1|1303475_1303877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080551.1|1303876_1304914_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_114080550.1|1305421_1305742_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_114081709.1|1306167_1306737_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_114081708.1|1306727_1307228_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_114086208.1|1307383_1307833_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_114086209.1|1308074_1308374_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A222YX16	Synechococcus_phage	68.1	7.2e-29
WP_114086210.1|1308477_1309332_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_159402453.1|1309461_1309635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114086212.1|1309950_1310661_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_114086213.1|1311514_1312051_+	DUF1772 domain-containing protein	NA	NA	NA	NA	NA
WP_159402454.1|1312197_1312809_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_114086215.1|1312871_1314851_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_114086216.1|1315152_1316892_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_114086217.1|1317301_1317958_+	DUF2301 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_114086218.1|1317957_1318647_+	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_114086219.1|1318761_1319898_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_114086220.1|1320063_1321179_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_147262609.1|1321578_1321791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114086221.1|1321759_1323325_-	serine hydrolase	NA	Q1MVP3	Enterobacteria_phage	25.6	1.5e-05
WP_114086222.1|1323498_1324239_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_114086223.1|1324412_1325327_+	homoserine kinase	NA	NA	NA	NA	NA
WP_114086224.1|1325370_1325880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159402451.1|1326148_1326685_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_114081705.1|1326681_1327239_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP046703	Nostoc sp. ATCC 53789 chromosome, complete genome	7340101	1893167	1946358	7340101	transposase,tRNA,bacteriocin	Bacillus_phage(33.33%)	47	NA	NA
WP_114081517.1|1893167_1894496_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	30.5	7.6e-38
WP_114082610.1|1894945_1895986_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_114082609.1|1896288_1896750_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_114082608.1|1897031_1897538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082607.1|1897764_1898091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082606.1|1898317_1899562_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_114082605.1|1899569_1900520_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_114082604.1|1900534_1901137_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_114082603.1|1901321_1902284_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_114082602.1|1902315_1903086_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	3.5e-19
WP_114082601.1|1903101_1903983_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_114082600.1|1904076_1904916_-	DUF4351 domain-containing protein	NA	NA	NA	NA	NA
WP_114082599.1|1905093_1905825_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	1.0e-15
WP_114082598.1|1905858_1906422_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_114082597.1|1906716_1907364_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_114082596.1|1907448_1908474_+	glucokinase	NA	NA	NA	NA	NA
WP_114082595.1|1908519_1909122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082593.1|1911204_1911492_+	DUF1816 domain-containing protein	NA	NA	NA	NA	NA
WP_114082592.1|1911455_1911860_-	DUF3775 domain-containing protein	NA	NA	NA	NA	NA
WP_114082591.1|1912258_1914571_+	NACHT domain-containing NTPase	NA	NA	NA	NA	NA
WP_159402475.1|1914691_1914838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114082590.1|1914919_1915390_+	response regulator	NA	NA	NA	NA	NA
WP_114082589.1|1915550_1916768_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_114082588.1|1916778_1918245_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_114082611.1|1919149_1920055_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_159402476.1|1920071_1920224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012411359.1|1920403_1921414_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_114082587.1|1921472_1922393_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_114082586.1|1922521_1923334_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_114082585.1|1923431_1923677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114082584.1|1924140_1924689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114082583.1|1924776_1925700_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_114082582.1|1926180_1928229_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	24.2	2.6e-37
WP_114082581.1|1928561_1929458_+	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	29.8	2.4e-19
WP_167756008.1|1929574_1929967_+	nuclease	NA	NA	NA	NA	NA
WP_114082579.1|1930047_1930887_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_114082578.1|1931223_1931721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114082577.1|1931979_1932174_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_114082576.1|1932252_1933536_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.3	6.9e-28
WP_114082574.1|1933880_1935107_-	(E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_159402477.1|1935275_1935446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114082573.1|1935719_1936004_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_114082572.1|1935996_1938213_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_114082571.1|1938657_1941543_-|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	27.3	8.2e-37
WP_114082570.1|1941812_1942739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114082569.1|1942807_1943983_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	34.7	1.5e-50
WP_114082568.1|1944102_1946358_-|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	25.5	2.0e-30
>prophage 5
NZ_CP046703	Nostoc sp. ATCC 53789 chromosome, complete genome	7340101	3668351	3726015	7340101	transposase	Paenibacillus_phage(33.33%)	42	NA	NA
WP_167756004.1|3668351_3669392_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_114081519.1|3669431_3670172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114081265.1|3671750_3673454_-	D-aminoacylase	NA	NA	NA	NA	NA
WP_114086198.1|3675199_3675466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114086199.1|3675455_3676748_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_114086200.1|3676837_3678121_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_114086201.1|3678129_3678768_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_114086202.1|3679603_3681793_+	DUF1929 domain-containing protein	NA	NA	NA	NA	NA
WP_114086203.1|3684370_3686500_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_159402518.1|3687140_3687386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114086205.1|3687396_3688911_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_114086206.1|3689000_3691460_-	S-layer family protein	NA	NA	NA	NA	NA
WP_114086207.1|3691793_3695096_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_114081800.1|3695206_3695515_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	30.1	2.1e-07
WP_114081801.1|3695511_3696060_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_114081511.1|3696074_3697061_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_159402428.1|3697063_3698536_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_114080578.1|3698592_3699861_-	carbamoylphosphate synthase large subunit	NA	NA	NA	NA	NA
WP_114080577.1|3700056_3700929_-	peptidase T	NA	NA	NA	NA	NA
WP_114080576.1|3701445_3702741_+	chloride channel protein	NA	NA	NA	NA	NA
WP_114080575.1|3702985_3703441_-	DUF2214 family protein	NA	NA	NA	NA	NA
WP_159402519.1|3703735_3703894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080574.1|3703862_3704126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080573.1|3704246_3705185_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_114080579.1|3706544_3707078_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_012411639.1|3707214_3707562_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	45.3	4.9e-13
WP_114080572.1|3707781_3708108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114080571.1|3708563_3708773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080570.1|3709050_3709359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114081516.1|3709563_3710946_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_114080534.1|3711521_3711815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080533.1|3711999_3713670_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	6.0e-24
WP_114080532.1|3713747_3714692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114080531.1|3715874_3717320_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_114080530.1|3717622_3719482_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041565664.1|3719589_3719817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080536.1|3720610_3721669_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012411649.1|3721958_3722159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080529.1|3722290_3723712_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_012411651.1|3724069_3724579_+	allophycocyanin subunit beta	NA	NA	NA	NA	NA
WP_114080528.1|3724673_3724934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159402520.1|3725001_3726015_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP046703	Nostoc sp. ATCC 53789 chromosome, complete genome	7340101	6496978	6567177	7340101	transposase,protease,tRNA	Bacillus_phage(36.36%)	59	NA	NA
WP_114084573.1|6496978_6498370_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EJK5	Megavirus	38.8	1.4e-87
WP_114084574.1|6498495_6498756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114084575.1|6498787_6499252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114084576.1|6499652_6500285_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_114084577.1|6500336_6500768_-	glyoxalase	NA	NA	NA	NA	NA
WP_114084578.1|6501509_6502307_+	TIGR00297 family protein	NA	NA	NA	NA	NA
WP_114084579.1|6502721_6503504_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_114084580.1|6503452_6506152_+	type I secretion system permease/ATPase	NA	A0A1V0SJ29	Klosneuvirus	21.9	1.2e-16
WP_159402591.1|6508662_6509973_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_114085557.1|6510017_6511535_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	41.5	4.4e-42
WP_114085556.1|6511832_6513719_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	43.1	5.9e-44
WP_114085555.1|6513901_6515383_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_114085554.1|6515502_6516378_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_114085553.1|6516550_6516928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114085552.1|6517056_6517245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114085551.1|6517667_6518594_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_114085550.1|6518748_6519651_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_114085549.1|6519759_6520500_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_114085559.1|6520766_6521750_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_114085558.1|6521829_6523071_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_114085548.1|6523085_6524006_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_114085547.1|6524117_6525458_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.6	1.4e-135
WP_114085546.1|6525467_6526166_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	53.8	2.6e-53
WP_114085545.1|6526476_6527913_-	trigger factor	NA	NA	NA	NA	NA
WP_114085544.1|6528798_6529836_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_114085543.1|6529962_6530847_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_114085542.1|6531127_6532897_+	ribonuclease J	NA	NA	NA	NA	NA
WP_114085541.1|6533651_6534029_+	nitrogenase	NA	NA	NA	NA	NA
WP_114085540.1|6534159_6536040_-	peptidase C14	NA	NA	NA	NA	NA
WP_114085539.1|6536240_6536723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012407602.1|6536875_6537049_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_114085538.1|6537324_6537930_+	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
WP_114085537.1|6538005_6539388_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_114085536.1|6539582_6540722_-	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	38.8	3.8e-14
WP_114085535.1|6541257_6541566_+	NIL domain-containing protein	NA	NA	NA	NA	NA
WP_012407592.1|6541643_6542321_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.0	1.1e-19
WP_114085534.1|6542650_6543112_-	ferredoxin	NA	NA	NA	NA	NA
WP_012407590.1|6543477_6543789_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	48.9	2.2e-17
WP_012407589.1|6543890_6545525_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.6	9.3e-155
WP_159402613.1|6546546_6547768_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_114081113.1|6548148_6549864_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_114081112.1|6549873_6550416_-	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_114081111.1|6550418_6550724_-	urease subunit beta	NA	NA	NA	NA	NA
WP_114081110.1|6550745_6551048_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_114081109.1|6551087_6551927_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_159402448.1|6552531_6553440_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_114085165.1|6553535_6554600_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_114085164.1|6554668_6555418_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_114085163.1|6555431_6556076_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_114085162.1|6556399_6558316_-	sulfite reductase, ferredoxin dependent	NA	NA	NA	NA	NA
WP_114085161.1|6558580_6559120_-	porin family protein	NA	NA	NA	NA	NA
WP_114085160.1|6559513_6560455_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	35.3	8.3e-39
WP_147262571.1|6560526_6561525_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012407575.1|6561546_6562398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114085157.1|6562536_6563196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114085156.1|6563869_6564115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147262570.1|6564144_6564399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012407712.1|6565169_6565352_-	CsbD family protein	NA	NA	NA	NA	NA
WP_114085155.1|6566283_6567177_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP046703	Nostoc sp. ATCC 53789 chromosome, complete genome	7340101	6595657	6628147	7340101	transposase,plate,tail	Brazilian_cedratvirus(25.0%)	28	NA	NA
WP_159402613.1|6595657_6596880_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_114082355.1|6597062_6597728_+	fimbrial protein	NA	NA	NA	NA	NA
WP_114082354.1|6597752_6598526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082353.1|6598601_6599330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147262512.1|6599702_6599921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114082352.1|6600276_6602457_-	CHASE2 domain-containing protein	NA	A0A2R8FDX7	Brazilian_cedratvirus	29.4	2.8e-05
WP_114082351.1|6602615_6604604_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_114082360.1|6604746_6605130_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_114082350.1|6605288_6605636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041565926.1|6605647_6606142_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_114082349.1|6606164_6606620_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_114082348.1|6606843_6608505_-|tail	phage tail sheath family protein	tail	H6WFT7	Cyanophage	33.7	1.2e-19
WP_114082347.1|6608535_6609375_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_159402592.1|6609449_6609611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082346.1|6610062_6611184_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_114082345.1|6611207_6611888_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_114082344.1|6611931_6614070_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_114082343.1|6614041_6614689_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_167756026.1|6614864_6616151_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_114082342.1|6616700_6616940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082341.1|6616939_6617464_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_114082340.1|6617487_6620826_+	hypothetical protein	NA	A0A1L2BX61	Bacteriophage	34.3	4.4e-10
WP_114082339.1|6620864_6621422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082338.1|6621502_6623236_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_114082337.1|6623354_6623852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082336.1|6624209_6624623_+	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	43.2	3.3e-08
WP_114082335.1|6624844_6627043_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_114082334.1|6627118_6628147_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 1
NZ_CP046704	Nostoc sp. ATCC 53789 plasmid pNsp_a, complete sequence	337072	58875	113321	337072	transposase,protease	Thermus_phage(16.67%)	46	NA	NA
WP_114082162.1|58875_59924_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_114082163.1|60306_61635_+|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	31.2	4.6e-35
WP_114082196.1|61861_63088_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	52.1	1.1e-104
WP_114082164.1|63065_63281_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_114082165.1|63406_64033_+	DEAD/DEAH box helicase family protein	NA	A0A2H4UVG1	Bodo_saltans_virus	22.8	3.6e-06
WP_114082166.1|64013_66059_+	CRISPR-associated helicase Cas3'	NA	NA	NA	NA	NA
WP_114082167.1|66408_68244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082168.1|68236_69199_+	DevR family CRISPR-associated autoregulator	NA	NA	NA	NA	NA
WP_114082169.1|69179_69950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082170.1|69927_70953_+	CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6	NA	NA	NA	NA	NA
WP_114082171.1|70980_71580_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_114082172.1|71659_72637_+	type I-D CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_114082173.1|72666_72960_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_114082174.1|75214_76366_+	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_114082175.1|78936_79926_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159402624.1|80205_80346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114082176.1|81884_82586_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_114082177.1|82702_82918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159402625.1|83160_83565_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_114082179.1|83926_84388_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_114082197.1|84987_86073_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_114082198.1|86191_88087_+	DUF3370 family protein	NA	NA	NA	NA	NA
WP_114082180.1|88365_88605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082181.1|88601_89060_+	HNH endonuclease	NA	A0A1D8EUE9	Propionibacterium_phage	31.8	5.9e-06
WP_114082182.1|89243_90203_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_114082183.1|90375_90684_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_114082184.1|90821_91709_+	glycerol acyltransferase	NA	NA	NA	NA	NA
WP_114082185.1|92220_92727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082186.1|92747_92936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114082187.1|93310_93586_+	HU family DNA-binding protein	NA	A0A2H4PAM3	Aphanizomenon_phage	54.4	1.4e-18
WP_114082188.1|93779_94265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082199.1|94404_94971_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_114082189.1|95098_95431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114082190.1|95501_96518_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_114082191.1|96877_97981_+	GHMP kinase	NA	NA	NA	NA	NA
WP_114082192.1|97998_98676_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_147262503.1|98763_98967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159402626.1|100752_102372_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_114085911.1|106249_107002_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_114085912.1|107163_108123_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_114085913.1|108476_108725_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_114085914.1|108835_109354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114085915.1|109475_110111_+	deoxynucleoside kinase	NA	NA	NA	NA	NA
WP_114085916.1|110144_110978_+	radical SAM protein	NA	NA	NA	NA	NA
WP_114085917.1|111063_111711_+	AAA family ATPase	NA	E3T5S4	Cafeteria_roenbergensis_virus	27.6	3.2e-05
WP_114085918.1|111860_113321_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP046705	Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence	325114	70364	87092	325114	integrase,transposase	Bacillus_phage(100.0%)	14	68717:68731	89541:89555
68717:68731	attL	CACTGACAGGTTCTA	NA	NA	NA	NA
WP_114084686.1|70364_72146_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_114081710.1|72232_73170_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_114081264.1|73198_74257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114081263.1|74643_75546_-	TniQ family protein	NA	NA	NA	NA	NA
WP_147262468.1|75535_76018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114081250.1|76235_77075_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_114081251.1|77361_79008_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_114081249.1|78997_79969_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_167756037.1|80870_83645_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_114080969.1|84100_84520_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_114080970.1|84831_85245_+	fatty-acid oxidation protein subunit alpha	NA	NA	NA	NA	NA
WP_114080971.1|85232_85568_+	XisI protein	NA	NA	NA	NA	NA
WP_114080972.1|85702_86026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080973.1|86081_87092_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	27.1	2.4e-12
89541:89555	attR	TAGAACCTGTCAGTG	NA	NA	NA	NA
>prophage 2
NZ_CP046705	Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence	325114	112551	178095	325114	integrase,transposase	Bacillus_phage(33.33%)	49	109731:109748	134579:134596
109731:109748	attL	AAAGGTGTTGATGATTTC	NA	NA	NA	NA
WP_114085050.1|112551_113481_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_114085049.1|114111_116238_-	AAA family ATPase	NA	U5J9B0	Bacillus_phage	27.8	1.5e-48
WP_114085048.1|116707_117100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114085047.1|117602_117914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114085046.1|117971_118442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114085045.1|118444_118783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114085044.1|118776_121515_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_114085043.1|121511_122054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114085042.1|122031_122724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114085041.1|122754_123813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114085040.1|123809_124529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114085038.1|125979_126810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159402645.1|126806_126947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114085037.1|127335_128529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114085036.1|128525_130289_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_114081708.1|130656_131157_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_114081709.1|131147_131717_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159402646.1|139639_140746_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
134579:134596	attR	GAAATCATCAACACCTTT	NA	NA	NA	NA
WP_114086246.1|141343_141778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114086245.1|141904_142711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114086244.1|142623_143133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114086249.1|143550_144054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114086243.1|144128_148916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109012819.1|149212_149473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114086242.1|149739_150219_+	SocA family protein	NA	NA	NA	NA	NA
WP_109012817.1|150220_150823_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_114086248.1|151503_151794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114086241.1|151799_152759_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_114086240.1|153870_154971_-	hypothetical protein	NA	A0A7T5	Microcystis_virus	53.8	4.9e-99
WP_159402647.1|155276_155543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159402648.1|155634_155805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114086238.1|156092_156884_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	23.8	5.0e-05
WP_114086237.1|156886_158005_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_159402649.1|158186_160145_+	ATP-binding domain-containing protein	NA	U5J9B0	Bacillus_phage	30.2	3.1e-27
WP_114081388.1|160234_161185_+	RpoD/SigA family RNA polymerase sigma factor	NA	F4YCU2	Synechococcus_phage	34.6	4.6e-37
WP_114081709.1|161263_161833_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_114081708.1|161823_162324_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_114080956.1|162414_162921_-	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_114080955.1|163345_164002_+	DUF1877 family protein	NA	NA	NA	NA	NA
WP_147262459.1|165631_165925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147262458.1|165921_166215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114080952.1|166224_166803_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_114081802.1|169836_170565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114081105.1|171599_171845_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_109013342.1|172174_172414_+	helix-turn-helix transcriptional regulator	NA	A0A1L2BWW8	Bacteriophage	47.1	9.5e-08
WP_114081106.1|172565_173474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114081107.1|173559_175083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159402562.1|175215_176229_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159402646.1|176988_178095_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP046705	Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence	325114	186481	233000	325114	integrase,transposase	Brochothrix_phage(20.0%)	46	214613:214637	218618:218642
WP_114081709.1|186481_187051_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_114081708.1|187041_187542_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_114081269.1|188049_188211_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_114081268.1|188534_189137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114081267.1|189219_189729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159402613.1|189885_191108_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_147262446.1|191205_191847_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_114080591.1|192119_193349_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D9J0Y9	Brochothrix_phage	40.6	3.0e-73
WP_147262447.1|193456_193924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080593.1|194294_194591_+	HU family DNA-binding protein	NA	A0A2H4PAM3	Aphanizomenon_phage	50.5	1.4e-16
WP_114080594.1|194810_195503_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_159402650.1|195596_195761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080596.1|195996_196464_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_114080597.1|196935_197679_+	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_114080598.1|198491_199865_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_114081515.1|201576_202599_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_114081270.1|203056_204169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114081515.1|205779_206802_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_114080944.1|206972_207701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080945.1|207828_208431_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_114080946.1|208974_210297_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_114080947.1|210599_211124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080951.1|211251_211971_-	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_159402651.1|212006_212267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114080949.1|212684_213635_-	RpoD/SigA family RNA polymerase sigma factor	NA	F4YCU2	Synechococcus_phage	34.1	5.2e-41
WP_114080950.1|214028_214445_-	hypothetical protein	NA	NA	NA	NA	NA
214613:214637	attL	TTGGCTCACATTAATTGCAAATAAG	NA	NA	NA	NA
WP_114081249.1|214816_215788_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_114081251.1|215777_217424_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_114081250.1|217710_218550_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159402652.1|218771_218924_+	hypothetical protein	NA	NA	NA	NA	NA
218618:218642	attR	CTTATTTGCAATTAATGTGAGCCAA	NA	NA	NA	NA
WP_114081254.1|218966_219419_-	DUF1392 family protein	NA	NA	NA	NA	NA
WP_114081253.1|219582_220071_-	TIGR00725 family protein	NA	NA	NA	NA	NA
WP_084227073.1|220195_220471_-	UBP-type zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_114081252.1|220646_220838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159402653.1|220936_221077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114081255.1|221088_221574_+	bleomycin resistance protein	NA	NA	NA	NA	NA
WP_167756041.1|221880_223113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114080757.1|223196_223445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114080756.1|224034_224541_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	2.5e-10
WP_114080755.1|224793_224982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114080754.1|225002_225509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114080753.1|226583_228224_-	iron uptake porin	NA	NA	NA	NA	NA
WP_114080752.1|229022_229820_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	7.1e-23
WP_114080751.1|229864_230866_+	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_114080750.1|230941_231715_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_167756004.1|231959_233000_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
