The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP037928	Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 chromosome, complete genome	5389402	448674	482077	5389402	protease,tail,integrase,capsid,portal,terminase,tRNA,head	uncultured_Caudovirales_phage(73.33%)	33	466427:466444	482422:482439
WP_002919147.1|448674_449622_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|449636_450146_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|450274_451399_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|451370_451844_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|451869_452412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|452416_452989_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|452992_453811_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|453807_454065_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|454040_454595_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|460535_460757_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|461050_464161_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|464173_465313_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|465691_466342_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
466427:466444	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|466617_467844_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|467936_468878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|469059_469344_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|469354_470134_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|470585_470855_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|470847_471036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|471028_471343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|471339_471708_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|471704_472070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|472069_474205_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|474547_474883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|474931_475444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|475707_476874_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|476925_477486_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|477487_478729_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|478725_479061_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|479057_479357_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|479356_479800_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|480075_480432_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|480415_482077_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
482422:482439	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP037928	Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 chromosome, complete genome	5389402	1242050	1288285	5389402	plate,tail,integrase,capsid,portal,terminase,lysis,coat,tRNA,head	Salmonella_phage(83.33%)	59	1240344:1240390	1276911:1276957
1240344:1240390	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1242050_1243076_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1243078_1243708_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1243830_1244073_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1244105_1244615_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1244622_1244823_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1244786_1245125_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1245192_1245426_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1245425_1245653_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1245649_1246501_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1246497_1248882_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1249044_1249233_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1249244_1249478_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1249573_1250257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1250243_1251323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1251322_1252324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1252845_1253115_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1253171_1254215_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1254214_1255978_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1256118_1256952_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1256968_1258021_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1258024_1258678_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1258773_1259238_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1259237_1259441_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1259444_1259660_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1259640_1260150_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1260154_1260538_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1260534_1260963_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150997.1|1261058_1261481_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1261473_1261920_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1261942_1262809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1262903_1263476_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1263472_1263835_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1263821_1264730_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1264722_1265394_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1265395_1267345_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1267354_1268473_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1268524_1269598_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1269746_1270919_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1270928_1271444_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1271496_1271796_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1271810_1271930_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1271922_1274553_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1274549_1275035_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1275031_1276126_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1276192_1276411_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1276438_1276816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1277419_1277902_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1276911:1276957	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1278012_1278489_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1278478_1278769_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1278835_1279177_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1279324_1280986_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1281072_1281951_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1282075_1282666_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1282785_1284072_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1284091_1284883_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1285046_1286411_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1286670_1286919_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1286937_1287486_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1287517_1288285_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP037928	Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 chromosome, complete genome	5389402	1385300	1437711	5389402	integrase,holin,capsid,terminase,tRNA,tail	Salmonella_phage(45.65%)	63	1380554:1380570	1433235:1433251
1380554:1380570	attL	TAAATTTGTTGTTGGCG	NA	NA	NA	NA
WP_004149335.1|1385300_1386575_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913890.1|1386609_1387230_+	YfgM family protein	NA	NA	NA	NA	NA
WP_002913889.1|1387240_1388419_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_002913888.1|1388532_1390011_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_004151982.1|1390128_1391208_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004144303.1|1391257_1391476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151981.1|1391459_1392851_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
WP_004151980.1|1393009_1394476_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1394543_1396121_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004152549.1|1396313_1397564_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004152548.1|1397580_1397772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152547.1|1397768_1397951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152546.1|1397947_1398541_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152545.1|1398537_1398696_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004153052.1|1398688_1398982_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152543.1|1399091_1399340_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004152542.1|1399391_1400414_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152541.1|1400423_1401323_-	endonuclease	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004164029.1|1401319_1401619_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152539.1|1401985_1402567_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|1402720_1402954_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1403100_1403310_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1403309_1404077_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152535.1|1404073_1404859_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|1404978_1405326_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|1405518_1405929_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|1405912_1406104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|1406100_1406526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|1406522_1407266_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004141386.1|1407436_1407649_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|1407645_1408314_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|1408306_1408546_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|1408545_1408884_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152524.1|1408958_1409216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|1409293_1409878_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004164044.1|1409874_1411350_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.9	1.9e-279
WP_004152473.1|1411393_1411915_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004152472.1|1412620_1412824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152471.1|1412827_1414507_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152470.1|1414503_1414809_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|1415090_1415489_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004152467.1|1415501_1416509_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_004152466.1|1416518_1416911_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152465.1|1416903_1417182_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004153043.1|1417230_1417842_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152463.1|1417841_1420319_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004152462.1|1420320_1420791_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152461.1|1420783_1421281_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004152460.1|1421293_1424038_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
WP_004152459.1|1424037_1427427_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152458.1|1427436_1428051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|1428325_1428724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152456.1|1428728_1428911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152455.1|1429101_1429797_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_157833602.1|1429880_1430069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152454.1|1430177_1430375_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152453.1|1430378_1430636_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004221284.1|1431174_1433544_+|tail	phage tail fibers	tail	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
1433235:1433251	attR	CGCCAACAACAAATTTA	NA	NA	NA	NA
WP_004146394.1|1433828_1434233_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004146393.1|1434219_1434525_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004152706.1|1434514_1435144_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004152707.1|1435140_1435623_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152009.1|1435842_1437711_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP037928	Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 chromosome, complete genome	5389402	1766441	1773348	5389402	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1766441_1767305_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1767315_1768089_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_002912636.1|1768331_1769225_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1769470_1770832_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1771150_1771873_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1771869_1773348_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 5
NZ_CP037928	Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 chromosome, complete genome	5389402	1809915	1817540	5389402		Enterobacteria_phage(28.57%)	7	NA	NA
WP_004152488.1|1809915_1811322_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004152487.1|1811546_1812611_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152486.1|1812637_1813507_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152485.1|1813538_1814429_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152484.1|1814443_1814998_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152483.1|1815178_1816345_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152482.1|1816538_1817540_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 6
NZ_CP037928	Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 chromosome, complete genome	5389402	2059561	2116049	5389402	plate,transposase,protease	Staphylococcus_phage(16.67%)	52	NA	NA
WP_002910830.1|2059561_2060308_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_004199384.1|2060719_2061733_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|2061725_2062526_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|2062512_2062686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2063303_2064245_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2064338_2065328_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2065353_2066685_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|2066712_2067921_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|2067949_2070244_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004219578.1|2070674_2071790_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|2071899_2072814_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|2072823_2074101_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|2074097_2074973_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
WP_002910721.1|2074969_2075689_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2075694_2076588_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|2076871_2078515_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|2078564_2079041_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2079139_2080066_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2080369_2081665_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004152314.1|2081679_2082486_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152315.1|2082460_2083360_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2083469_2083952_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2084142_2084841_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|2084866_2085451_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2085520_2085850_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910647.1|2085936_2086182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910645.1|2086418_2087759_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2087755_2088409_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|2088412_2090110_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|2093073_2094429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|2094429_2094939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2094935_2095442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2095678_2096188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153456.1|2097838_2098762_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
WP_004199326.1|2098903_2099086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2099082_2099412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2099408_2099915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|2099960_2100191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227470.1|2100296_2101385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|2101431_2101737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2101758_2102652_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004152633.1|2102835_2103729_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910539.1|2103904_2104798_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|2104973_2105864_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2106200_2107181_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_029779706.1|2107304_2107541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227463.1|2107729_2107987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2108284_2108551_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2108554_2109712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2109695_2113106_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2113239_2115003_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002910494.1|2115002_2116049_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP037928	Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 chromosome, complete genome	5389402	2786515	2797402	5389402		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2786515_2789623_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2789677_2790943_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2790973_2792062_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2792148_2792409_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2792706_2793567_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2793587_2794349_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2794609_2795512_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2795523_2796789_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2796781_2797402_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
NZ_CP037928	Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 chromosome, complete genome	5389402	3026098	3164831	5389402	integrase,holin,terminase,tail,transposase	Klebsiella_phage(24.3%)	166	3018637:3018654	3173271:3173288
3018637:3018654	attL	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
WP_004152576.1|3026098_3026965_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3026964_3027738_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3027734_3028931_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3028930_3029284_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3029285_3029939_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3029992_3030559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|3030601_3030784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3030833_3031175_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3031174_3032197_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3032199_3032502_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3032502_3033102_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3033101_3035105_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3035094_3035247_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3035282_3035708_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|3036034_3037226_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|3037167_3037458_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|3037468_3038614_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3038617_3039058_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3039152_3039539_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3039538_3040045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3040041_3040461_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3040429_3040711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3040750_3041692_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_004227923.1|3041703_3042198_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.1	6.1e-49
WP_004199270.1|3042201_3043404_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3043455_3044004_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3044059_3045511_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3045748_3047149_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3047099_3047852_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3047953_3048274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3048508_3048898_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3048894_3049425_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3049427_3049676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3050081_3050864_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3050860_3051337_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3051333_3052296_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3052297_3053956_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3054532_3054754_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3054851_3055520_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3055690_3056005_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3055997_3056186_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3056355_3056721_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3056713_3056968_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3056939_3057158_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152156.1|3057154_3057580_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3057576_3057771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3057767_3058595_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3058699_3059218_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3059223_3059934_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3059923_3060148_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3060144_3060357_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3060353_3060833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3061011_3061254_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3061234_3062416_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3062612_3063161_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152145.1|3063359_3064892_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3065108_3065870_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152143.1|3065978_3066893_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176439.1|3067193_3067382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152142.1|3067452_3067761_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152141.1|3067928_3068798_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004218007.1|3068876_3070079_-	MFS transporter	NA	NA	NA	NA	NA
WP_004152139.1|3070151_3071288_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004152138.1|3071460_3072345_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152137.1|3072469_3073303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152136.1|3073533_3073920_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004152135.1|3074087_3075704_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152134.1|3075889_3076597_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_004152133.1|3076593_3077559_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_004152131.1|3077661_3078168_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_085666574.1|3078238_3079261_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901979.1|3079392_3080934_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_002901977.1|3081106_3082420_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_071531198.1|3082551_3083433_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029779648.1|3083522_3084584_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_002901917.1|3084580_3085978_-	YcjX family protein	NA	NA	NA	NA	NA
WP_002901915.1|3086080_3086299_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002901913.1|3086327_3086687_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002901911.1|3086686_3086911_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002901908.1|3086966_3087635_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_002901905.1|3087802_3088777_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002901901.1|3088767_3090159_-	MFS transporter	NA	NA	NA	NA	NA
WP_002901900.1|3090184_3091354_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004152126.1|3091525_3093835_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004171423.1|3093813_3094644_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152124.1|3094754_3095660_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002901817.1|3095993_3097637_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_002901816.1|3097633_3098599_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_002901815.1|3098803_3099475_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3099661_3100489_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3100564_3101830_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3101831_3102251_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3102330_3103815_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|3104712_3105135_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3105727_3106432_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|3106608_3107373_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004152787.1|3107756_3107897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|3107879_3108380_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3108507_3109347_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3109340_3109688_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3109851_3110643_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_015057121.1|3110788_3111748_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|3111638_3112343_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152703.1|3112591_3114535_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_004152702.1|3114776_3115376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|3115600_3116332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644627.1|3116335_3119290_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152652.1|3119366_3122435_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|3122431_3122812_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|3122821_3123304_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152649.1|3123484_3123949_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152648.1|3124263_3124599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3124789_3125770_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004226989.1|3125882_3128780_-|tail	phage tail length tape-measure protein 1	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_099119318.1|3129041_3129233_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217333.1|3129457_3129814_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|3129890_3130097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|3130234_3130717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|3130770_3131943_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|3131966_3132359_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|3132355_3132907_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|3132908_3133292_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|3133278_3133512_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|3133521_3133776_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|3133777_3134173_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_142689607.1|3134213_3134486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190653.1|3134494_3135448_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|3135458_3136244_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_019405022.1|3136774_3137887_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|3137870_3139271_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|3139270_3140578_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|3140555_3141560_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|3142422_3142668_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|3143626_3143902_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|3143898_3144243_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|3144239_3144779_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3144775_3145075_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|3145553_3146600_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3146825_3147515_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3147514_3147655_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3147651_3148290_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3148282_3148951_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3148947_3149115_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3149095_3149563_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3150083_3151112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3151319_3151565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3151620_3151923_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3151919_3152768_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3152764_3153625_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3153710_3153932_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3153972_3154200_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3154311_3155010_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3155032_3155152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3155297_3156374_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3156455_3156659_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3157087_3157282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3157370_3157655_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3157670_3158516_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3158512_3158800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3158801_3159482_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3159478_3159907_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3159903_3160566_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|3160773_3161961_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3162137_3163028_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|3163027_3164020_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3164021_3164831_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
3173271:3173288	attR	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
>prophage 9
NZ_CP037928	Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 chromosome, complete genome	5389402	3541115	3625357	5389402	protease,head,integrase,capsid,portal,terminase,lysis,tRNA,tail,transposase	Salmonella_phage(45.65%)	80	3596641:3596659	3625432:3625450
WP_002898139.1|3541115_3542408_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3542498_3543842_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3543850_3544462_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3544584_3548838_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3548973_3549468_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3549973_3550969_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3551083_3552850_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3552850_3554572_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.4	3.4e-14
WP_002898014.1|3554616_3555318_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3555671_3555890_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3556010_3558290_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3558320_3558638_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3558963_3559185_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3559261_3561202_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3561198_3562314_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3562460_3564119_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3564538_3565234_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3565349_3566249_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3566392_3568045_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3568055_3569024_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3569235_3569670_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3569821_3571540_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3571578_3572580_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3572590_3574033_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3574120_3575134_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3575130_3575961_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3575992_3577132_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3578009_3578525_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3578751_3579480_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3579500_3580232_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3580238_3580955_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3580954_3581623_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3581806_3582538_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3582580_3584053_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3584049_3584766_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3584844_3585972_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3586013_3586502_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3586559_3587405_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3587401_3588355_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3588365_3589499_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3589662_3590775_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3591123_3591603_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3591691_3592594_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3593415_3593703_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3593905_3594169_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3594175_3594559_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3594825_3596511_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3596641:3596659	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3596730_3596949_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3597040_3598141_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3598137_3598623_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3598619_3601247_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3601239_3601359_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3601373_3601673_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3601725_3602241_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3602250_3603423_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3603561_3604638_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3604667_3604871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3604867_3605599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019724930.1|3605602_3606337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3608490_3609471_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_048255583.1|3609584_3610253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3610249_3610696_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3610688_3611120_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3611215_3611644_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3611640_3612024_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3612028_3612538_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3612518_3612734_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3612737_3612941_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3612940_3613405_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3613500_3614151_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3614154_3615213_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3615229_3616063_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3616205_3617972_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3617971_3618997_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3619058_3620801_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3621076_3621754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3621868_3622102_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3622112_3622301_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004152765.1|3622401_3623886_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|3624304_3625357_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3625432:3625450	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 10
NZ_CP037928	Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 chromosome, complete genome	5389402	4276150	4287718	5389402	integrase	Enterobacteria_phage(70.0%)	13	4276600:4276614	4299571:4299585
WP_004144574.1|4276150_4277254_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4276600:4276614	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4277264_4278518_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4278870_4280061_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4280048_4280999_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4280998_4281424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4281992_4282559_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4282576_4282822_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4282818_4283556_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4284011_4284278_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4284274_4284832_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4284828_4285056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4285052_4285373_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4285384_4287718_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4299571:4299585	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 1
NZ_CP037930	Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence	102851	11258	69762	102851	integrase,lysis,transposase	Escherichia_phage(31.58%)	51	NA	NA
WP_004152342.1|11258_12527_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_004152341.1|12646_13120_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011977773.1|13211_13442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|14333_15116_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152339.1|15115_15448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|15454_15811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|15878_16208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|16235_16544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|16589_16796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|17448_17679_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|17675_18092_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004152334.1|18165_18876_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072093211.1|19607_19733_+	mercury transporter	NA	NA	NA	NA	NA
WP_001340589.1|19768_20191_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|20242_21937_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|21954_22317_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|22313_22550_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|22546_23254_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_159373915.1|23292_24009_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152391.1|24016_25732_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|25841_28871_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|28977_30003_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|29999_30779_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|31066_31948_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|32197_33517_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_000027057.1|35076_35937_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|37680_38385_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840280.1|38735_39290_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|39523_40081_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_001143775.1|40242_43248_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_000072676.1|43878_44142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001146176.1|44131_44431_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000312627.1|44492_44870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000165971.1|44938_45118_+	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
WP_004153058.1|45145_45676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152551.1|45682_46414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178196.1|46413_48378_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_004152552.1|49858_50008_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_004152553.1|50092_50350_-	cloacin	NA	NA	NA	NA	NA
WP_071790641.1|50359_52006_-	cloacin	NA	NA	NA	NA	NA
WP_004217321.1|52388_53093_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004152403.1|53165_56063_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_004152402.1|56151_56772_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152400.1|57937_58297_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152398.1|58800_59985_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152397.1|60261_61581_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|61830_62712_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|62999_63779_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|63775_64801_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|64907_67937_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|68046_69762_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
>prophage 1
NZ_CP037929	Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence	271781	1727	199851	271781	protease,transposase,integrase	Escherichia_phage(26.67%)	179	78265:78324	151686:151703
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|4961_5885_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|7416_8871_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|11193_13191_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14230_15438_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16866_17298_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17548_19024_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19016_19697_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19886_21272_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21300_21654_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21767_23060_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23070_26217_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26303_26744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26870_29318_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29358_29556_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29589_30327_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30615_31065_-	copper resistance protein	NA	NA	NA	NA	NA
WP_004152083.1|31298_33116_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33115_34012_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34051_34432_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34436_35366_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35420_36101_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36097_37498_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37714_38149_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38380_38560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40302_40812_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40861_41359_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41690_42017_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|42016_42727_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42735_43281_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43356_43719_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|45615_46152_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46184_46610_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46622_47912_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|47959_49711_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49728_50091_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50140_50491_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50848_51118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51105_51681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51711_52206_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52249_52618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52651_52855_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52903_53161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53236_53491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53666_53933_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53920_54403_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|54614_55961_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|57803_58766_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|58752_59502_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|59739_59937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|59936_62732_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|62846_63416_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|63450_63732_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|63975_64239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|64253_64517_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|65718_66699_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|67907_68777_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|68770_69781_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|69789_70617_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|70625_71489_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|71485_72313_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|73168_73873_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000427619.1|75207_76212_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_044503635.1|76503_77172_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.3e-130
WP_000018329.1|77361_78177_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
78265:78324	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|78327_79032_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
78265:78324	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_000219391.1|79153_80059_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|80055_81294_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|81293_81878_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|82370_83135_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|83361_83667_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|83677_84883_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|85038_85242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|85369_86209_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|86202_86550_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|86713_87505_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|87510_87801_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|87912_88410_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|88554_89568_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|89770_90121_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|90246_90807_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|90809_93776_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|93842_94220_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|94420_95080_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_016197752.1|95851_96082_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_004152560.1|96081_97470_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	1.1e-50
WP_000005560.1|97462_98575_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118217.1|98571_99207_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_020956879.1|99754_100141_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004152557.1|100137_100485_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_004118832.1|104307_106041_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|106048_106996_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|107040_108645_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|108657_109578_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152279.1|109577_110426_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|110422_111016_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|111012_112140_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|112424_112592_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118235.1|113694_114216_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004118237.1|114212_115166_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004152280.1|115251_117576_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118241.1|117620_118523_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|118519_119518_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004152281.1|119514_120471_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|120471_121239_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|121337_121631_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071527925.1|121961_122204_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427619.1|122501_123506_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004152284.1|123909_124920_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004152286.1|125380_126463_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_001067855.1|129006_129711_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|130904_131447_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|131459_132320_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|132426_133131_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|133219_133774_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
132364:133184	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCG	NA	NA	NA	NA
WP_001334766.1|133904_134735_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
132364:133184	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCG	NA	NA	NA	NA
WP_001067855.1|135366_136071_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509965.1|136672_137278_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_004152403.1|137372_140270_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_014386481.1|142677_143322_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_001067855.1|144194_144899_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|145444_146458_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|146613_147087_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|147307_147574_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|147716_148481_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|148741_149956_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|149989_151423_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001067855.1|151741_152446_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004186977.1|155190_155895_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
WP_001097412.1|157296_157860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348195.1|157883_158258_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001515734.1|158322_158886_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000046891.1|159128_159464_+	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
WP_001067855.1|160589_161294_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015065551.1|161381_162395_-	replication protein	NA	NA	NA	NA	NA
WP_022631532.1|162387_162939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386216.1|162931_163009_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_022631531.1|163220_163490_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_015065550.1|163625_164177_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	1.8e-17
WP_015065549.1|164280_164589_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.4	1.7e-17
WP_022631529.1|164585_165236_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_015065546.1|165291_165936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096030814.1|165985_166582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015065544.1|166748_167342_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_055316669.1|167497_168223_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.5	1.2e-05
WP_004153029.1|168302_173564_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_004152630.1|173563_175873_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_004152629.1|176232_176964_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_004153030.1|177153_177681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152627.1|177686_180536_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_004178055.1|180535_181906_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_004152689.1|181892_182321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152688.1|182313_182886_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_004152687.1|182857_183097_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_004152686.1|183107_183860_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_004152685.1|183880_184207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152683.1|184434_184671_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_004153093.1|184702_186658_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_004152682.1|186705_187344_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_004178057.1|187356_188349_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_004152590.1|188359_188986_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_004152591.1|188985_189375_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_004152592.1|189374_192014_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_004171485.1|192085_192478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152594.1|192779_193184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152595.1|193250_193568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004171484.1|193568_193787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152596.1|193810_194101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152597.1|194105_194516_-	lipase chaperone	NA	NA	NA	NA	NA
WP_004152598.1|194647_195217_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_004152599.1|195239_195836_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_004152600.1|195828_197253_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_004152601.1|197252_197993_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_004152602.1|197979_198546_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000019473.1|198870_199851_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 2
NZ_CP037929	Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence	271781	222586	271030	271781	holin,tail,terminase,integrase	Salmonella_phage(39.22%)	56	235603:235615	267829:267841
WP_004152765.1|222586_224071_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004178083.1|224476_224902_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004152715.1|224901_226173_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004152707.1|228041_228524_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152706.1|228520_229150_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004146393.1|229139_229445_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|229431_229836_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004152705.1|230120_231062_-	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	89.4	2.8e-164
WP_004152432.1|232643_232940_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_004152433.1|233254_233944_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_071531206.1|234029_234413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152434.1|234555_237321_-	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
235603:235615	attL	TTCATCCAGGGTC	NA	NA	NA	NA
WP_004152435.1|237320_239231_-	hypothetical protein	NA	Q858F9	Salmonella_phage	81.9	5.2e-290
WP_004152436.1|239230_242062_-	hypothetical protein	NA	Q858G0	Salmonella_phage	75.7	0.0e+00
WP_004152437.1|242072_242612_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_004152438.1|242611_243076_-	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_004152439.1|243075_245574_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
WP_004152440.1|245573_246179_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
WP_004152441.1|246178_246502_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_004152442.1|246552_246894_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_004152443.1|246904_247342_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
WP_004152444.1|247395_248382_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.6e-178
WP_004152445.1|248396_249077_-	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
WP_004152446.1|249079_249376_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_004152447.1|249372_251055_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
WP_004141368.1|251069_251276_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004152449.1|252077_252389_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
WP_004154331.1|252455_253931_-	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	3.8e-280
WP_004152523.1|253927_254512_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|254589_254847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|254921_255260_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|255259_255499_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|255491_256160_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|256156_256369_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152529.1|256539_257283_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|257279_257705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|257701_257893_-	hypothetical protein	NA	A0A1B1W2B6	Salmonella_phage	47.3	1.6e-05
WP_004152532.1|257876_258287_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|258479_258827_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152535.1|258946_259732_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004207253.1|259728_260496_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|260495_260705_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|260851_261085_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152539.1|261238_261820_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004164029.1|262186_262486_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152541.1|262482_263382_+	endonuclease	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004152542.1|263391_264414_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152543.1|264465_264714_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004153052.1|264823_265117_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152545.1|265109_265268_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004152546.1|265264_265858_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152547.1|265854_266037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152548.1|266033_266225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152549.1|266241_267492_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004152062.1|268892_269864_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
267829:267841	attR	TTCATCCAGGGTC	NA	NA	NA	NA
WP_000523813.1|269863_271030_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
