The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026939	Escherichia coli strain CFS3313 chromosome, complete genome	4936627	855534	930163	4936627	transposase,tRNA,integrase	Shigella_phage(33.33%)	58	903180:903195	936005:936020
WP_001305361.1|855534_856137_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	33.3	1.8e-07
WP_000998321.1|856441_858754_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001493615.1|858750_859686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032155386.1|860496_861672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000804439.1|863638_864241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001347898.1|864334_864541_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001367564.1|864924_865716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102384962.1|866300_867528_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_072146520.1|868119_868269_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000860849.1|868500_869100_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000270955.1|869471_869855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543792.1|869851_870277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553833.1|870523_870721_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000287902.1|870748_871315_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001347893.1|872709_873492_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|873795_874716_+	ribokinase	NA	NA	NA	NA	NA
WP_000998349.1|874743_876060_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107479.1|876071_877085_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000639468.1|877625_877991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000948757.1|878033_879398_-	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
WP_085960558.1|879796_881014_+	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
WP_000790444.1|881010_883020_+	two-component system sensor histidine kinase PgtB	NA	NA	NA	NA	NA
WP_001298249.1|883009_884257_+	two-component system response regulator PgtA	NA	NA	NA	NA	NA
WP_000523766.1|885917_886175_+	Major pilu subunit operon regulatory protein papB	NA	NA	NA	NA	NA
WP_000920486.1|886219_886726_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000946201.1|886811_887399_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000739801.1|887519_890030_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_001171049.1|890098_890830_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001077947.1|890866_891430_+	nuclease PIN	NA	NA	NA	NA	NA
WP_001223370.1|891513_892032_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001519250.1|892054_893047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000481334.1|893099_893882_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_085967267.1|893946_895057_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	24.8	1.4e-05
WP_021548590.1|895306_900817_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.9	2.3e-48
WP_000455181.1|900813_901857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122057.1|901868_903752_-	hypothetical protein	NA	NA	NA	NA	NA
903180:903195	attL	AATATGGTTATTTTTT	NA	NA	NA	NA
WP_021548591.1|903763_905410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000548583.1|905431_906646_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_102384962.1|907342_908571_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_001218797.1|911105_912368_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	9.0e-81
WP_000234514.1|912746_913454_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839812.1|913851_915987_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|916036_917293_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001298916.1|917494_918574_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|918638_918914_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298922.1|918941_919994_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|920154_920874_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|920873_921200_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|921383_922103_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394125.1|922278_923325_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745217.1|923441_924449_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239939.1|924603_925740_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174743.1|925732_926326_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|926333_926624_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|926620_927187_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|927204_927909_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001349546.1|927926_928907_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000399648.1|929182_930163_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
936005:936020	attR	AATATGGTTATTTTTT	NA	NA	NA	NA
>prophage 2
NZ_CP026939	Escherichia coli strain CFS3313 chromosome, complete genome	4936627	1166416	1173556	4936627		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1166416_1167055_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1167051_1168314_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1168310_1169219_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1169414_1170182_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|1170232_1170889_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272898.1|1170994_1173556_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 3
NZ_CP026939	Escherichia coli strain CFS3313 chromosome, complete genome	4936627	1675241	1737323	4936627	head,holin,terminase,protease,tail,capsid,lysis,portal	Enterobacteria_phage(38.46%)	75	NA	NA
WP_000849214.1|1675241_1675730_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_001296837.1|1675864_1676029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000686723.1|1676137_1676632_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557378.1|1676621_1676885_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778069.1|1676881_1679368_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091291.1|1679374_1680070_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013515.1|1680056_1680920_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835177.1|1680916_1681366_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000528376.1|1681375_1681978_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888560.1|1681996_1682614_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000971730.1|1682610_1683273_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001295447.1|1683314_1684052_+	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000186540.1|1684048_1684258_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001026418.1|1684254_1684734_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982426.1|1684730_1686674_+	cytochrome c-type biogenesis heme lyase CcmF	NA	NA	NA	NA	NA
WP_000824439.1|1686670_1687228_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001211588.1|1687224_1688277_+	cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH	NA	NA	NA	NA	NA
WP_001113637.1|1688311_1688959_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001136067.1|1692457_1693225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145023.1|1693214_1693598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183538.1|1694081_1695038_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_021548840.1|1695175_1696354_-	hypothetical protein	NA	A0A2D1GN00	Marinobacter_phage	30.6	2.1e-31
WP_001096409.1|1696356_1696566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021548839.1|1696627_1696843_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	92.1	3.7e-27
WP_001242718.1|1696839_1697202_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_021548838.1|1697192_1697729_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.3	5.3e-99
WP_000081280.1|1697856_1698681_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_021548837.1|1698745_1699108_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000559916.1|1699577_1700093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020634.1|1700412_1701105_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|1701202_1701463_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_021548836.1|1701455_1702007_+	protein YmfL	NA	S5FXP0	Shigella_phage	100.0	2.6e-101
WP_001250269.1|1702182_1702362_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_021528956.1|1702351_1703293_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	100.0	1.5e-144
WP_021548835.1|1703289_1703784_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	1.6e-86
WP_000210170.1|1703783_1704110_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|1704106_1704496_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_021548834.1|1704515_1705325_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.1	2.5e-148
WP_001571227.1|1705332_1706322_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	9.5e-195
WP_085949407.1|1706336_1706705_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_001208502.1|1706740_1707190_-	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_001446998.1|1707211_1708153_-	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_000917724.1|1708421_1708625_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_021548833.1|1708775_1709828_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.3	6.3e-205
WP_001120502.1|1709904_1710240_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_001197767.1|1710243_1710720_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.5	1.9e-84
WP_001446997.1|1710716_1711154_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	95.9	3.0e-68
WP_001139678.1|1711141_1711294_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|1711644_1712055_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001663509.1|1712111_1712345_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000453587.1|1712733_1713279_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027321.1|1713253_1715179_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|1715175_1715382_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_057077926.1|1715378_1716980_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.5e-309
WP_029395138.1|1716960_1718280_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.2e-232
WP_012304872.1|1718289_1718622_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
WP_029395141.1|1718677_1719703_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_001468354.1|1719744_1720140_+	DNA packaging FI family protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.1e-56
WP_029395143.1|1720151_1720505_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_001518407.1|1720516_1721095_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_021548556.1|1721091_1721487_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	5.0e-70
WP_021548555.1|1721494_1722235_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	94.3	7.8e-125
WP_021548554.1|1722250_1722673_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	5.9e-61
WP_000459458.1|1722654_1723089_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_021548553.1|1723081_1725661_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.7	0.0e+00
WP_000847379.1|1725657_1725987_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152640.1|1725986_1726685_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.5e-133
WP_000194783.1|1726690_1727434_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090895.1|1727370_1728003_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_000515714.1|1728063_1731561_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.3	0.0e+00
WP_032280044.1|1731630_1732230_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	9.7e-110
WP_096943340.1|1732294_1735753_+	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.5e-58
WP_000946030.1|1735824_1736064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000506742.1|1736063_1736381_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	6.2e-23
WP_021548831.1|1736738_1737323_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	4.6e-104
>prophage 4
NZ_CP026939	Escherichia coli strain CFS3313 chromosome, complete genome	4936627	2821124	2871236	4936627	head,holin,integrase,tRNA,protease,terminase,tail,capsid,lysis,portal	Escherichia_phage(53.33%)	57	2829415:2829429	2871338:2871352
WP_001297484.1|2821124_2822231_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2822266_2822908_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423719.1|2822911_2824282_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
WP_001265481.1|2824449_2825121_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2825120_2826581_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_021548698.1|2826656_2827778_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359463.1|2827923_2829153_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2829402_2830539_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2829415:2829429	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2830522_2831386_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_159373529.1|2831798_2835575_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	83.9	0.0e+00
WP_016238939.1|2835639_2836239_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.7e-106
WP_159373530.1|2836307_2839787_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_134360127.1|2839847_2840495_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.5	7.5e-108
WP_001367682.1|2840392_2841136_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	5.2e-145
WP_001152446.1|2841141_2841840_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.4	4.7e-132
WP_001330090.1|2841839_2842196_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224016.1|2842173_2845401_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.7	0.0e+00
WP_077250115.1|2845447_2845708_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	94.2	2.5e-38
WP_021543293.1|2845749_2846121_-	hypothetical protein	NA	A0A1B5FP91	Escherichia_phage	99.2	1.9e-63
WP_000097533.1|2846135_2846840_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_001209399.1|2846899_2847244_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_001312916.1|2847240_2847690_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	7.9e-64
WP_001147820.1|2847686_2848025_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000983037.1|2848033_2848339_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_000601355.1|2848350_2848539_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_021562582.1|2848590_2849796_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.3	2.7e-223
WP_001193631.1|2849810_2850461_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466247.1|2850438_2851680_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_000478567.1|2851679_2851862_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_001140902.1|2851873_2853631_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_001317918.1|2853630_2854113_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_001140099.1|2854261_2854612_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_032145233.1|2854716_2854899_-	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	75.4	1.4e-16
WP_001274714.1|2855115_2855649_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_000193273.1|2855704_2856019_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_000839572.1|2856023_2856239_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_001064896.1|2857051_2857741_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.8e-60
WP_000139992.1|2857737_2858103_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	7.1e-39
WP_024188444.1|2858103_2859159_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	7.5e-89
WP_024175747.1|2859160_2859439_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_000737636.1|2859666_2860059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|2860202_2860415_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_119188221.1|2860649_2861165_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	74.5	4.7e-36
WP_000753060.1|2861161_2861338_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001224662.1|2861330_2861513_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|2861606_2861963_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_099120785.1|2861940_2862456_-	hypothetical protein	NA	G9L661	Escherichia_phage	93.3	2.7e-84
WP_023142724.1|2862514_2862937_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.2	8.2e-63
WP_159373531.1|2862977_2864048_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	66.2	3.8e-64
WP_000693850.1|2864119_2864545_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000379589.1|2865775_2865931_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_032173275.1|2866090_2866309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|2866273_2866477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001365098.1|2867061_2867253_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_159373532.1|2867346_2869818_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|2869879_2870149_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|2870117_2871236_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2871338:2871352	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 5
NZ_CP026939	Escherichia coli strain CFS3313 chromosome, complete genome	4936627	3069393	3142502	4936627	head,integrase,transposase,tRNA,protease,capsid	Bacillus_phage(19.05%)	60	3075590:3075605	3145899:3145914
WP_000399648.1|3069393_3070374_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001109487.1|3070615_3071263_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3071289_3071838_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925997.1|3072018_3073866_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572668.1|3074126_3078587_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
3075590:3075605	attL	GCTCCGCTTCCGCCTG	NA	NA	NA	NA
WP_001295347.1|3078586_3079291_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|3079271_3080594_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001297198.1|3080590_3081376_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899591.1|3081511_3082291_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|3082267_3083161_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011590.1|3083314_3084061_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3084057_3084240_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056498.1|3084291_3085524_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570540.1|3085560_3086547_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3086543_3088292_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705706.1|3088328_3090593_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3090799_3091084_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3091243_3092917_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3093027_3093711_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|3093883_3094648_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445253.1|3094816_3096100_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057149.1|3096170_3097259_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|3097457_3098150_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001295344.1|3098279_3100040_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|3100445_3101303_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3101357_3103640_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|3103831_3104572_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_021548689.1|3104653_3105244_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242663.1|3105343_3106252_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918506.1|3106252_3107683_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109289.1|3107892_3109041_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165880.1|3109354_3109981_+	hydrolase	NA	NA	NA	NA	NA
WP_000534637.1|3110016_3110880_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|3110881_3111499_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850317.1|3111509_3113954_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.1e-220
WP_000886683.1|3114192_3115485_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3115575_3116919_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3116929_3117541_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077063.1|3117695_3121802_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3121936_3122431_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3122975_3123941_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_021548688.1|3124063_3125827_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|3125827_3127549_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3127590_3128295_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3128579_3128798_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3129482_3131759_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3131789_3132110_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_001710151.1|3132896_3133181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021548686.1|3133444_3133987_-	hypothetical protein	NA	O64316	Escherichia_phage	45.7	3.5e-34
WP_001179421.1|3134188_3134572_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190777.1|3134583_3134925_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228102.1|3134934_3135975_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.6	7.5e-65
WP_000126634.1|3136192_3136615_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125504.1|3136611_3136857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021548685.1|3137144_3138962_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	50.4	1.3e-128
WP_001261502.1|3138958_3139258_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_021548684.1|3139264_3139585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001396399.1|3139577_3140624_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001206975.1|3140634_3140844_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	71.4	1.5e-17
WP_000092883.1|3141263_3142502_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.5	4.0e-126
3145899:3145914	attR	GCTCCGCTTCCGCCTG	NA	NA	NA	NA
>prophage 6
NZ_CP026939	Escherichia coli strain CFS3313 chromosome, complete genome	4936627	3178051	3210970	4936627	head,integrase,terminase,tail,plate,capsid,lysis,portal	Salmonella_phage(83.33%)	45	3177961:3177974	3211045:3211058
3177961:3177974	attL	ATGGGTTTTTTGTT	NA	NA	NA	NA
WP_000972391.1|3178051_3178270_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_016237802.1|3178360_3179461_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.5	7.6e-177
WP_000980413.1|3179457_3179943_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_021548682.1|3179939_3183017_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|3183009_3183129_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3183143_3183446_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_021548681.1|3183500_3184016_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	3.7e-89
WP_021548680.1|3184025_3185198_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_021548679.1|3185349_3185907_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.7	3.1e-86
WP_021548678.1|3186355_3186790_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	51.7	8.0e-37
WP_021548677.1|3186770_3187193_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	52.6	1.9e-14
WP_021548676.1|3187194_3188538_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	79.6	7.9e-152
WP_001086798.1|3188534_3189140_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.9e-109
WP_000268290.1|3189132_3190041_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.0e-143
WP_000177590.1|3190027_3190387_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000993769.1|3190383_3190962_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.5	2.5e-94
WP_021548675.1|3191030_3191477_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_021548674.1|3191469_3191901_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	3.8e-71
WP_021548673.1|3191996_3192425_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.1e-46
WP_021548672.1|3192421_3192799_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	1.1e-15
WP_001069905.1|3192800_3193313_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|3193293_3193509_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3193512_3193716_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673500.1|3193715_3194180_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_001568687.1|3194275_3194926_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	9.6e-111
WP_021548671.1|3194929_3195988_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	1.1e-180
WP_021548670.1|3196004_3196838_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	8.2e-123
WP_021548669.1|3196980_3198747_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_021548668.1|3198746_3199781_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.6	2.4e-172
WP_159373533.1|3199825_3200371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3200683_3200917_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3200927_3201116_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_021548666.1|3201269_3203684_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.8	0.0e+00
WP_021548665.1|3203680_3204538_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	94.3	3.4e-156
WP_021548664.1|3204534_3204762_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_001244213.1|3204761_3204995_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.4e-32
WP_001747374.1|3205062_3205404_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_000956176.1|3205521_3205818_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460893.1|3205825_3206335_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3206367_3206589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009008398.1|3206734_3207634_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.1	2.5e-37
WP_000130914.1|3207634_3208417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021548663.1|3208419_3209490_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.5	4.2e-71
WP_000866326.1|3209467_3209839_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	54.8	5.6e-31
WP_000290937.1|3209917_3210970_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3211045:3211058	attR	ATGGGTTTTTTGTT	NA	NA	NA	NA
>prophage 7
NZ_CP026939	Escherichia coli strain CFS3313 chromosome, complete genome	4936627	3514812	3571828	4936627	head,integrase,transposase,protease,terminase,tail,capsid,lysis,portal	Enterobacteria_phage(60.0%)	68	3523293:3523339	3571842:3571888
WP_000420925.1|3514812_3515949_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001614159.1|3516217_3518455_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|3518441_3521414_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224567.1|3521414_3522305_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|3522487_3523249_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3523293:3523339	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|3523761_3524715_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|3524901_3526386_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|3526569_3526875_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239874.1|3526931_3527600_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|3527965_3528079_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3528147_3528381_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|3528697_3529288_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_021548649.1|3529385_3529961_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_021548648.1|3529960_3533359_-|tail	phage tail fiber assembly protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233090.1|3533423_3534023_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_042050056.1|3534093_3537591_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.7	0.0e+00
WP_000090891.1|3537650_3538283_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_042513214.1|3538219_3538963_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.2e-149
WP_001152634.1|3538968_3539667_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	2.1e-132
WP_023147605.1|3539666_3539996_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	6.2e-58
WP_159373534.1|3539992_3542572_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.2	0.0e+00
WP_000459458.1|3542564_3542999_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_021548554.1|3542980_3543403_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	5.9e-61
WP_021548555.1|3543418_3544159_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	94.3	7.8e-125
WP_021548556.1|3544166_3544562_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	5.0e-70
WP_001518407.1|3544558_3545137_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_029395143.1|3545148_3545502_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_001468354.1|3545513_3545909_-	DNA packaging FI family protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.1e-56
WP_029395141.1|3545950_3546976_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_012304872.1|3547031_3547364_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
WP_029395138.1|3547373_3548693_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.2e-232
WP_057077926.1|3548673_3550275_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.5e-309
WP_000198149.1|3550271_3550478_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027321.1|3550474_3552400_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|3552374_3552920_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001415975.1|3553308_3553503_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|3553865_3554159_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_077628513.1|3554249_3554432_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	2.5e-16
WP_001135277.1|3554648_3555146_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|3555145_3555361_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737266.1|3555949_3557047_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_001204780.1|3557236_3557620_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_001307651.1|3557705_3557846_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	8.5e-09
WP_001099716.1|3557842_3558205_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774488.1|3558201_3558492_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224915.1|3558484_3558655_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053009.1|3558654_3559110_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
WP_072114080.1|3559106_3559208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000151203.1|3559307_3559511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122138.1|3559785_3560397_-	NADAR family protein	NA	A0A1X7BZM3	Faustovirus	31.6	9.0e-10
WP_021548563.1|3560399_3561419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021548564.1|3561622_3562324_-	replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	97.9	2.1e-127
WP_032155462.1|3562320_3563250_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.0e-110
WP_001182882.1|3563336_3563876_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000184665.1|3563906_3564134_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|3564244_3564937_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000389051.1|3565059_3565809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|3565805_3566633_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|3567141_3567348_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_021548566.1|3567423_3567720_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000100847.1|3567725_3568511_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001297092.1|3568507_3569188_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.8	3.3e-130
WP_000149544.1|3569184_3569367_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|3569339_3569531_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|3569541_3569823_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763385.1|3569921_3570140_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3570187_3570466_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000051902.1|3570664_3571828_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
3571842:3571888	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 8
NZ_CP026939	Escherichia coli strain CFS3313 chromosome, complete genome	4936627	3891723	3953914	4936627	transposase,tRNA,plate,protease	Enterobacteria_phage(12.5%)	51	NA	NA
WP_000611742.1|3891723_3892137_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|3892140_3893991_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3893954_3895037_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113703.1|3895061_3896342_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3896338_3896863_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_021548577.1|3896865_3898197_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343293.1|3898201_3898963_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614334.1|3898971_3901731_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	4.7e-82
WP_000088859.1|3901727_3902471_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|3902475_3903888_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985538.1|3903996_3907431_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_021548578.1|3907441_3908794_+	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_001284199.1|3908817_3909300_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|3909343_3910258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|3910267_3910747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|3910883_3911669_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|3912208_3912940_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|3913004_3913472_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|3913468_3914191_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|3914224_3914980_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3915051_3916410_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211690.1|3916457_3917228_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3917305_3918106_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|3918346_3919261_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3919257_3920061_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140174.1|3925821_3926394_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3926581_3927613_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3927605_3928259_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|3928298_3929114_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202335.1|3929231_3929636_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3929632_3930340_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3930451_3932170_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399648.1|3933250_3934231_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|3934480_3935191_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|3935204_3935627_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3935623_3936169_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3936334_3936535_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3936521_3936782_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|3936830_3938129_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3938193_3938583_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3938639_3940781_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3940879_3941839_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3941851_3945334_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3945370_3945967_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|3945963_3947112_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3947111_3947900_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3947903_3948359_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139288.1|3948463_3949489_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3949492_3949978_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3950099_3952532_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|3952561_3953914_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 9
NZ_CP026939	Escherichia coli strain CFS3313 chromosome, complete genome	4936627	4296789	4342584	4936627	transposase,holin	Stx2-converting_phage(23.08%)	38	NA	NA
WP_001518966.1|4296789_4298331_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.3	2.4e-128
WP_001016257.1|4298345_4299092_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_021548605.1|4299315_4299684_-	antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|4299846_4300068_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186775.1|4300130_4300607_-	RadC family protein	NA	NA	NA	NA	NA
WP_001350782.1|4300622_4301096_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001234656.1|4301437_4302256_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	1.6e-46
WP_001323397.1|4302410_4302569_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001774924.1|4302639_4305759_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069760.1|4306130_4307003_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001297234.1|4308232_4309717_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000813451.1|4310038_4310641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001322501.1|4310735_4311014_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000221515.1|4312465_4313035_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270962.1|4313294_4313696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|4313683_4314118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|4314472_4314853_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|4314849_4315197_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|4315246_4316632_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823250.1|4316870_4318229_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|4318979_4319237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4320985_4321507_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4321503_4322457_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_021548604.1|4322543_4324868_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|4324912_4325815_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|4325811_4326810_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|4326806_4327763_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_021548603.1|4327763_4328531_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	1.1e-12
WP_000177057.1|4329087_4329345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947616.1|4330278_4331434_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001293436.1|4331588_4333586_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625671.1|4333648_4334062_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000227969.1|4334321_4335398_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000254999.1|4336851_4337109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594405.1|4337161_4337287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611568.1|4337329_4338448_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000179691.1|4338459_4339677_-	MFS transporter	NA	NA	NA	NA	NA
WP_102384962.1|4341355_4342584_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
>prophage 1
NZ_CP026940	Escherichia coli strain CFS3313 plasmid pCFS3313-1, complete sequence	155172	1262	72345	155172	protease,transposase,integrase	Enterobacteria_phage(18.18%)	59	NA	NA
WP_001514245.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001332052.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|2685_3594_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|3656_4766_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|5198_6152_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|7424_7583_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162842477.1|7766_8979_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	2.7e-167
WP_000928804.1|10433_11621_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733252.1|11617_13558_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	3.0e-35
WP_001312828.1|13561_14932_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|15728_16670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|18930_20124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088130945.1|21347_22576_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.0e-174
WP_000738422.1|23202_23496_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|26641_27757_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001442133.1|27896_31556_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.2e-45
WP_000933672.1|31659_32889_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271277.1|32973_33930_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|33974_36152_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_001190234.1|37006_38041_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	1.9e-73
WP_000377483.1|38600_38909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514250.1|39007_39190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324224.1|39186_39384_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_001332356.1|40098_41340_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001183604.1|41314_43429_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_001259758.1|43598_43910_-	colicin V	NA	NA	NA	NA	NA
WP_001323890.1|43887_44124_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_000379710.1|45063_45333_+	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_001017350.1|45329_45596_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000670963.1|45651_46104_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000343091.1|46396_46657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518980.1|46653_47244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142431.1|47263_47521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080729.1|47649_47985_+	colicin 1A immunity protein	NA	NA	NA	NA	NA
WP_001283335.1|48006_49887_-	colicin	NA	NA	NA	NA	NA
WP_001057989.1|50072_50921_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	2.0e-28
WP_000969996.1|50966_51248_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000079941.1|51244_51514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351729.1|53912_54305_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|54442_55327_+	EamA family transporter	NA	NA	NA	NA	NA
WP_112911087.1|55358_56558_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|56663_57314_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|57345_57588_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001138014.1|57645_60612_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|60615_61176_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323888.1|61164_61332_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_000454193.1|61351_61702_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|61904_62918_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001317507.1|63073_63547_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_001067855.1|63698_64403_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001403349.1|64379_64805_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.7e-53
WP_000027057.1|64987_65848_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|65997_66399_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|66445_67150_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001518958.1|67905_68808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043265.1|69064_69880_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|69940_70744_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|70743_71580_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|71640_72345_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
