The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	91394	102357	5133966	integrase	Enterobacteria_phage(100.0%)	12	90894:90916	102518:102540
90894:90916	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_159375920.1|91394_93728_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_000856729.1|93742_94063_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459294.1|94198_94654_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|94646_94934_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980227.1|94926_95526_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001149160.1|95522_95789_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283020.1|96340_97075_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	2.0e-128
WP_000638628.1|97071_97572_+	transactivation protein	NA	NA	NA	NA	NA
WP_001685684.1|97645_98218_+	phage polarity suppression family protein	NA	Q7M2A1	Enterobacteria_phage	95.2	7.2e-94
WP_001697486.1|98422_99076_-	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
WP_001697485.1|99077_101174_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001697482.1|101166_102357_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	85.0	1.8e-195
102518:102540	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	124660	133619	5133966	integrase	Morganella_phage(50.0%)	13	117006:117018	133954:133966
117006:117018	attL	GGCGGTCCAGTTC	NA	NA	NA	NA
WP_159375924.1|124660_127102_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.3	1.6e-137
WP_001058739.1|127114_127717_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
WP_000181940.1|127709_127931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|127927_128191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|128187_128382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598361.1|128374_128593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159375925.1|128585_129482_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001244025.1|129468_129651_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_159375926.1|129643_130477_-	antA/AntB antirepressor family protein	NA	A0A0H5BBY8	Pseudomonas_phage	37.0	1.4e-18
WP_000412532.1|130489_130921_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.8e-28
WP_001090781.1|130920_131124_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001000004.1|131238_132204_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	51.2	3.9e-07
WP_077783654.1|132299_133619_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	79.6	5.2e-196
133954:133966	attR	GGCGGTCCAGTTC	NA	NA	NA	NA
>prophage 3
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	535149	588069	5133966	transposase,tRNA,protease	Stx2-converting_phage(30.0%)	46	NA	NA
WP_001219652.1|535149_536115_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_001145827.1|536443_537325_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_033811040.1|537336_538788_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_000381173.1|538777_539020_-	YhdT family protein	NA	NA	NA	NA	NA
WP_000884639.1|539128_540478_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000354622.1|540488_540959_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_001148481.1|541936_542911_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001241469.1|543062_545003_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_000913396.1|545307_546351_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_000802511.1|546416_547520_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000179409.1|547519_548008_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000203105.1|548016_548610_+	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000123197.1|548599_550069_+	ribonuclease G	NA	NA	NA	NA	NA
WP_001253618.1|550136_553937_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000055909.1|554366_555812_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_000440317.1|555945_556875_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000051841.1|557057_557261_+	AaeX family protein	NA	NA	NA	NA	NA
WP_000854021.1|557268_558201_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000510965.1|558206_560174_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_001029013.1|560265_560538_+	barnase inhibitor	NA	NA	NA	NA	NA
WP_000695690.1|560593_560857_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001257846.1|561221_561692_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_001295272.1|562126_563065_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_000497723.1|563127_564195_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|564284_565652_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_001295270.1|565805_566204_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001192332.1|566397_567525_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_000847559.1|567743_568172_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|568187_568580_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000257293.1|568974_569613_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000366129.1|569618_570116_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000467018.1|570158_571526_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000523845.1|571905_572697_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000224714.1|572819_573713_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000108459.1|573821_575312_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|575359_576049_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209011.1|576045_576921_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979882.1|576917_577382_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001066423.1|578471_580028_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.7	2.6e-162
WP_000631725.1|580047_580395_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|580391_581066_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001067008.1|581470_582187_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_000821351.1|582183_582729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|582896_584124_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_159376068.1|586463_587054_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000019444.1|587088_588069_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	3.0e-185
>prophage 4
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	870515	938107	5133966	integrase,transposase	Stx2-converting_phage(27.78%)	42	886467:886485	938284:938302
WP_000080195.1|870515_872129_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|872159_872510_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|872506_872932_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001189111.1|873672_875181_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_088895425.1|878108_879337_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_157903028.1|879642_880230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000755102.1|882282_883023_+	porin family protein	NA	NA	NA	NA	NA
WP_097409354.1|883182_884682_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001218862.1|885003_886269_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.7e-77
886467:886485	attL	TGGTGCCCGGACTCGGAAT	NA	NA	NA	NA
WP_000779483.1|886732_887059_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001143297.1|887055_887319_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001280433.1|887390_888257_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839291.1|888341_888539_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761676.1|888550_889039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854735.1|889035_889413_-	toxin	NA	NA	NA	NA	NA
WP_001285415.1|889459_889834_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692309.1|889913_890135_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001366855.1|890197_890674_-	RadC family protein	NA	NA	NA	NA	NA
WP_000844100.1|890689_891169_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001175148.1|891250_892069_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	2.5e-47
WP_001278287.1|892158_892392_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001097301.1|892397_893075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097333170.1|893222_893903_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000010402.1|894105_894990_-	GTPase	NA	NA	NA	NA	NA
WP_077462115.1|895174_896305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000573215.1|897519_897768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021547797.1|897872_898604_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_089558184.1|898931_899804_+	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_089558189.1|899872_900523_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	39.4	1.8e-16
WP_000624622.1|900522_900870_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_097293269.1|900889_902461_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	2.2e-169
WP_159375941.1|904213_907573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020219138.1|907572_913887_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.5	2.3e-36
WP_020219137.1|914110_916969_+	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	24.9	3.8e-42
WP_087902712.1|916971_921867_+	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	21.3	5.7e-30
WP_087902711.1|921866_928208_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.1	1.7e-58
WP_000218176.1|928204_930319_+	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	24.1	5.9e-08
WP_029396350.1|931301_932147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020219336.1|932580_933117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020219337.1|933161_934385_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_029396441.1|935415_936483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218741.1|936916_938107_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	5.8e-122
938284:938302	attR	TGGTGCCCGGACTCGGAAT	NA	NA	NA	NA
>prophage 5
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	1177237	1190420	5133966		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1177237_1177999_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1177992_1178619_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1178758_1179898_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1179960_1180953_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104459.1|1181046_1182411_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136925.1|1182499_1183276_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1183280_1183919_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1183915_1185178_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847979.1|1185174_1186083_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	3.0e-118
WP_001300386.1|1186278_1187046_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1187096_1187753_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272928.1|1187858_1190420_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 6
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	1270037	1360350	5133966	portal,terminase,integrase,plate,capsid,tail,head,tRNA,holin	Enterobacteria_phage(74.6%)	103	1287265:1287281	1363871:1363887
WP_159375947.1|1270037_1272371_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_000856729.1|1272385_1272706_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459294.1|1272841_1273297_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|1273289_1273577_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980227.1|1273569_1274169_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001149160.1|1274165_1274432_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283020.1|1274993_1275728_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	2.0e-128
WP_000638635.1|1275724_1276225_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446145.1|1276298_1276871_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.4e-94
WP_001183326.1|1277088_1279047_-	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	31.1	8.8e-67
WP_000124726.1|1279050_1280259_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	6.6e-105
WP_000162574.1|1281020_1281503_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600189.1|1281634_1282111_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1282100_1282391_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1282452_1282794_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1282942_1284604_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1284689_1285568_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1285690_1286284_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077260308.1|1286338_1287625_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
1287265:1287281	attL	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_089584676.1|1287645_1288437_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1288603_1289965_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1290213_1290462_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1290480_1291029_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1291059_1291827_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1291868_1292216_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589847.1|1292291_1292774_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|1292789_1294016_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1294005_1294524_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1294673_1295039_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168037.1|1295248_1296319_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225229.1|1296329_1297451_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200120.1|1297493_1298654_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010723158.1|1298752_1298800_-	phe operon leader peptide	NA	NA	NA	NA	NA
WP_000974887.1|1298967_1299957_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
WP_029392135.1|1300023_1300326_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	58.3	7.0e-24
WP_001001391.1|1300420_1300747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813365.1|1300765_1301107_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_000159462.1|1301117_1301396_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000514277.1|1301407_1301650_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021648.1|1301646_1301760_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	4.3e-11
WP_033550182.1|1301853_1302264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|1302287_1302491_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|1302487_1302754_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104303.1|1302750_1303050_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	8.2e-41
WP_024167378.1|1303061_1303682_+	antirepressor	NA	S5MQL6	Escherichia_phage	46.9	1.9e-07
WP_021549223.1|1303678_1304068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159375948.1|1304064_1306902_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	86.8	0.0e+00
WP_000686491.1|1306967_1307927_+	Plasmid segregation protein parM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.9e-179
WP_000211257.1|1307931_1308243_+	hypothetical protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	7.2e-48
WP_001163773.1|1308306_1308642_+	hypothetical protein	NA	A0A0A7NV51	Enterobacteria_phage	90.7	4.1e-49
WP_022631071.1|1308705_1309230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631072.1|1309226_1309751_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	52.0	8.4e-33
WP_000087823.1|1310254_1311301_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	9.7e-206
WP_000613753.1|1311300_1313052_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_001262654.1|1313206_1314043_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_058799258.1|1314065_1315118_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.4	7.5e-198
WP_000632335.1|1315163_1315964_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	2.3e-130
WP_000063103.1|1316065_1316560_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|1316559_1316760_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|1316762_1317086_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|1317082_1317475_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780549.1|1317471_1317879_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	4.6e-63
WP_000920594.1|1318016_1318484_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356339.1|1318476_1319112_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_159375949.1|1319108_1319690_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	4.7e-101
WP_000213447.1|1319686_1320037_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111955.1|1320040_1320937_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
WP_000071724.1|1320929_1321538_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_159375950.1|1321534_1323100_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	56.3	2.4e-139
WP_024187361.1|1323110_1323605_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	56.3	8.8e-40
WP_016239660.1|1323605_1324208_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	83.4	3.9e-90
WP_001174919.1|1324179_1324620_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_094258973.1|1325047_1325638_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.8	9.7e-86
WP_000979945.1|1325675_1326164_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_159375951.1|1326176_1328984_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.6	0.0e+00
WP_000333494.1|1328970_1329126_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_159375952.1|1329134_1329500_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	8.4e-56
WP_000290450.1|1329554_1330067_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005367.1|1330066_1331251_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	4.7e-225
WP_000132830.1|1331408_1332518_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488108.1|1332560_1332821_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|1333011_1333152_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001519189.1|1333287_1333584_+	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_001353016.1|1333773_1333971_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000215751.1|1333915_1334722_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.2e-65
WP_000178456.1|1334872_1335214_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1335484_1336222_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079100.1|1336356_1337337_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040169.1|1337333_1338065_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1338194_1340768_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|1346630_1347929_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_000464877.1|1347925_1348270_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1348294_1349650_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_061093326.1|1349763_1352424_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001300438.1|1352455_1353154_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1353222_1353642_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1353848_1354886_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|1354933_1355623_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|1355927_1356311_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|1356366_1356954_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001300638.1|1357056_1357938_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1358146_1359481_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001295363.1|1359612_1360350_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
1363871:1363887	attR	GGTACAGCGCGGCAATG	NA	NA	NA	NA
>prophage 7
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	1841257	1850699	5133966		Enterobacteria_phage(85.71%)	9	NA	NA
WP_000569315.1|1841257_1842184_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_001216963.1|1842900_1843008_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1843067_1843799_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1844020_1845706_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1845702_1846422_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_139502896.1|1846468_1846939_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_001373589.1|1846979_1847441_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001423058.1|1847565_1849566_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001333512.1|1849562_1850699_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 8
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	2170126	2216690	5133966	terminase,integrase,tail,capsid,holin	Escherichia_phage(34.62%)	63	2161431:2161445	2189832:2189846
2161431:2161445	attL	GTGCGTATTCGCCAG	NA	NA	NA	NA
WP_000916763.1|2170126_2170357_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|2170495_2170870_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879289.1|2170873_2171746_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976476.1|2171758_2172100_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189085.1|2172492_2173569_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	9.0e-98
WP_001311878.1|2173534_2173816_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_024165285.1|2173922_2174111_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	100.0	1.8e-17
WP_010989194.1|2174103_2174298_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	4.5e-32
WP_159375964.1|2174361_2175414_-	enterohemolysin	NA	A0A0U2S5Y9	Escherichia_phage	62.8	7.9e-115
WP_159375965.1|2175425_2178497_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	76.8	0.0e+00
WP_001417976.1|2178596_2178872_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	2.2e-40
WP_000245528.1|2178946_2179123_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_099368359.1|2179116_2179338_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.5	3.4e-36
WP_001419881.1|2179733_2179928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089553251.1|2179893_2180112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410105.1|2180412_2180832_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|2180928_2181171_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702025.1|2181167_2181590_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
WP_001435989.1|2181667_2182462_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.5	3.7e-40
WP_044805258.1|2182468_2183215_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.3	9.0e-113
WP_159375966.1|2183237_2183999_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.3	2.3e-119
WP_001204666.1|2185108_2185687_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156214.1|2185646_2186744_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	100.0	7.3e-212
WP_159375967.1|2187244_2187457_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	68.6	4.4e-17
WP_159375968.1|2187693_2187945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021572520.1|2188016_2188616_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	1.9e-105
WP_000228018.1|2188615_2188906_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_021572521.1|2188902_2189457_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	2.8e-71
WP_001208723.1|2190516_2191086_+	hypothetical protein	NA	NA	NA	NA	NA
2189832:2189846	attR	GTGCGTATTCGCCAG	NA	NA	NA	NA
WP_071779784.1|2191054_2191270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781775.1|2191433_2191775_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_001194115.1|2191778_2192255_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	1.0e-85
WP_159375969.1|2192238_2192631_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	84.5	3.0e-51
WP_000113283.1|2192774_2192960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159375970.1|2193097_2193553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072645189.1|2193575_2194127_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	7.2e-67
WP_159375971.1|2194129_2195752_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.2	3.0e-312
WP_000113487.1|2195751_2197218_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.6	8.7e-261
WP_159376071.1|2197108_2197843_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	88.0	3.6e-98
WP_042093526.1|2197857_2199078_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.8	3.6e-204
WP_001066731.1|2199081_2199588_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	1.7e-70
WP_159375972.1|2199599_2200541_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	1.2e-154
WP_032197767.1|2200770_2201178_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	1.3e-68
WP_021517253.1|2201174_2201729_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.7	2.6e-80
WP_001142484.1|2201715_2202105_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_001349562.1|2202079_2202643_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_159375973.1|2202646_2203792_+	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	4.0e-160
WP_000109249.1|2203802_2204243_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000393958.1|2204246_2204699_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.0	1.8e-55
WP_159375974.1|2204876_2206883_+	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	78.5	8.5e-158
WP_000346972.1|2206882_2207533_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	65.3	1.8e-61
WP_000648663.1|2207536_2207839_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	55.0	2.6e-26
WP_057781017.1|2207841_2208876_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.2	1.6e-99
WP_000755137.1|2208872_2209208_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	55.6	1.6e-24
WP_000466689.1|2209347_2209587_+	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	47.5	5.6e-08
WP_053877862.1|2209646_2210399_+	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	64.0	6.3e-90
WP_159375975.1|2210398_2210752_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	1.5e-54
WP_159375976.1|2210751_2211951_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	82.9	1.2e-183
WP_159375977.1|2211947_2212628_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.9	3.8e-102
WP_001355803.1|2212969_2213419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001089533.1|2213421_2213865_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_159375978.1|2215014_2215569_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	6.3e-87
WP_000812724.1|2216033_2216690_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
>prophage 9
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	2295723	2334624	5133966	transposase	Escherichia_phage(40.0%)	38	NA	NA
WP_012478345.1|2295723_2296698_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_000019448.1|2296859_2297840_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_167745258.1|2297897_2298791_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_000373021.1|2298907_2300251_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000085240.1|2300486_2300759_+	YnjH family protein	NA	NA	NA	NA	NA
WP_000781888.1|2300724_2301132_-	CTP pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001295484.1|2301218_2301839_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_001301291.1|2301847_2303155_-	thiosulfate sulfurtransferase YnjE	NA	NA	NA	NA	NA
WP_001300558.1|2303221_2303875_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-12
WP_159375980.1|2303874_2305410_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_001215339.1|2305382_2306549_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000524097.1|2306558_2307107_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000980098.1|2307106_2307814_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_000939212.1|2307828_2308506_-	protein YdjY	NA	NA	NA	NA	NA
WP_001300395.1|2308510_2309221_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_000673918.1|2309387_2310194_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_000081983.1|2310639_2311860_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
WP_000989419.1|2311856_2312891_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_000177206.1|2312887_2314366_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_061093339.1|2314362_2315706_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_000368506.1|2315698_2316667_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_000019448.1|2316735_2317716_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_001228984.1|2318196_2318682_+	ATP-independent periplasmic protein-refolding chaperone	NA	NA	NA	NA	NA
WP_001300480.1|2318884_2319460_+	environmental stress-induced protein Ves	NA	NA	NA	NA	NA
WP_000252397.1|2319419_2320307_-	excinuclease Cho	NA	NA	NA	NA	NA
WP_000175026.1|2320536_2321364_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
WP_001039044.1|2321565_2321904_+	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_000412169.1|2322202_2322523_+	PTS N,N'-diacetylchitobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_000073009.1|2322607_2323966_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000968919.1|2324016_2324367_+	PTS N,N'-diacetylchitobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_077769234.1|2324374_2325208_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_000019448.1|2325248_2326229_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_000078757.1|2326521_2327874_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_061093338.1|2327886_2328636_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_061093337.1|2328893_2331155_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	7.9e-144
WP_001241561.1|2331337_2331601_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_012478345.1|2331839_2332814_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_000019448.1|2333643_2334624_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
>prophage 10
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	2475181	2570241	5133966	transposase,protease,integrase,tail,lysis	Escherichia_phage(24.39%)	102	2485636:2485652	2581818:2581834
WP_001260865.1|2475181_2476003_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2476102_2476186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2476278_2476614_-	acid shock protein	NA	NA	NA	NA	NA
WP_097508600.1|2477010_2478264_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2478370_2479264_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2479398_2480619_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2480743_2481439_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2481391_2482684_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2482842_2483457_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|2483499_2484354_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2484355_2484973_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|2484983_2487407_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
2485636:2485652	attL	GTTTTCGCATGGAGATA	NA	NA	NA	NA
WP_000041675.1|2487467_2489894_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001300836.1|2490092_2490398_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2490505_2491216_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2491218_2491779_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2491813_2492155_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2492289_2492616_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2492821_2494036_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_012478345.1|2494689_2495664_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_032150768.1|2495683_2496139_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_001360138.1|2496196_2496307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876958.1|2496326_2497607_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_000005552.1|2497641_2497893_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_024248766.1|2497965_2499999_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	7.0e-59
WP_001310834.1|2500185_2500542_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_072096395.1|2501655_2501874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000955178.1|2501848_2502031_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589005.1|2502208_2503522_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|2503958_2504291_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2504493_2504799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2504823_2505063_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2505062_2505350_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2505421_2505577_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2505793_2506045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2506111_2506390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2506391_2507441_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_061093371.1|2507454_2508207_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.4	2.1e-133
WP_120795389.1|2508484_2508574_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2508628_2508841_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2509141_2509357_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2510110_2510326_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2510330_2510642_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2510638_2511172_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_159375984.1|2511168_2511651_+	DUF2514 family protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.8e-06
WP_012478345.1|2511655_2512630_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_000066495.1|2513100_2513313_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2513323_2513512_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2513514_2513580_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2513659_2513815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2513986_2514160_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2514311_2514722_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2514779_2515013_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000518085.1|2515651_2516917_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	99.5	4.4e-245
WP_071524888.1|2516883_2517192_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000885600.1|2517191_2517767_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	1.8e-105
WP_000086522.1|2517864_2518455_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|2518771_2519005_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2519073_2519187_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2519790_2521074_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527809.1|2521162_2522623_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000214712.1|2522657_2522861_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|2523037_2523724_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000636571.1|2523812_2524559_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000210373.1|2524695_2526741_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024746.1|2526784_2527303_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671737.1|2527578_2527971_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592814.1|2528225_2529116_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_000901367.1|2529334_2529430_-	protein MgtS	NA	NA	NA	NA	NA
WP_000019448.1|2529571_2530552_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_001054183.1|2530756_2531944_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087187.1|2532138_2533038_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803657.1|2533068_2533287_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2533318_2533702_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843414.1|2533721_2534156_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|2534367_2535033_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210799.1|2535057_2536248_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000258599.1|2536397_2537513_-	putative protein YneK	NA	NA	NA	NA	NA
WP_000366501.1|2537590_2538472_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000156615.1|2538572_2539961_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257409.1|2540024_2540951_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191027.1|2540950_2541310_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000854633.1|2542595_2544047_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_001313828.1|2544253_2545168_+	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
WP_001286597.1|2545171_2545930_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558527.1|2545986_2546277_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774165.1|2546300_2547176_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000172465.1|2547202_2548225_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_001222721.1|2548236_2549229_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911189.1|2549228_2550257_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194860.1|2550250_2551786_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	4.4e-21
WP_000154342.1|2552034_2552988_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113108.1|2553066_2554659_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_140429042.1|2559209_2560610_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
WP_001301023.1|2560832_2561099_+	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001125439.1|2561098_2562421_+	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_167745260.1|2563131_2564360_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	2.2e-169
WP_088895425.1|2565021_2566250_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000876763.1|2567107_2567638_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_061093470.1|2567650_2568154_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000520676.1|2568212_2569127_+	fimbrial protein	NA	NA	NA	NA	NA
WP_012478345.1|2569266_2570241_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
2581818:2581834	attR	GTTTTCGCATGGAGATA	NA	NA	NA	NA
>prophage 11
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	2581825	2621397	5133966	transposase,integrase,capsid,tail,plate	Burkholderia_virus(43.59%)	52	2607094:2607108	2622112:2622126
WP_001310815.1|2581825_2584621_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
WP_159375985.1|2584982_2586383_+	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_167745261.1|2586538_2587204_+	amino acid permease	NA	NA	NA	NA	NA
WP_006686032.1|2587173_2587755_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	71.5	7.6e-67
WP_159376073.1|2587804_2588284_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	36.1	9.5e-07
WP_159375986.1|2588286_2588730_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	51.7	3.3e-38
WP_072731484.1|2588701_2589304_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	3.6e-96
WP_159375987.1|2589303_2590302_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	52.5	4.8e-61
WP_006687313.1|2590304_2590883_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.3	7.5e-67
WP_106510402.1|2590875_2591979_-|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	53.3	3.5e-105
WP_000859115.1|2591969_2592317_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	7.8e-35
WP_006687308.1|2592371_2592884_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	37.4	8.0e-20
WP_006687307.1|2592883_2594053_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	48.9	4.6e-87
WP_006687305.1|2594040_2594256_-|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_006687304.1|2594252_2595137_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	2.6e-50
WP_006687302.1|2595136_2597602_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.5	2.4e-170
WP_000084225.1|2597797_2598112_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_021553505.1|2598210_2598492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164965982.1|2598494_2599019_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.8	8.1e-68
WP_032195640.1|2599015_2600443_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	78.2	2.8e-216
WP_031626631.1|2600432_2600687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006687295.1|2600683_2601148_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	52.3	3.3e-41
WP_006687293.1|2601147_2601594_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	6.1e-32
WP_006687291.1|2601595_2601952_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_159375988.1|2601962_2602916_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.0	4.4e-64
WP_032195641.1|2602929_2604027_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	50.1	5.4e-98
WP_000135510.1|2604241_2604700_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.0	3.8e-29
WP_006687285.1|2604702_2605524_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	62.3	6.9e-98
WP_006687283.1|2605504_2607001_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	61.5	2.8e-174
WP_000080258.1|2607000_2608524_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.2	1.7e-182
2607094:2607108	attL	CAGCGCCAGTGCGAT	NA	NA	NA	NA
WP_000124057.1|2608520_2609066_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	1.2e-58
WP_000227551.1|2609065_2609377_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	7.2e-32
WP_000175096.1|2609369_2609702_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_006687276.1|2609698_2610352_-	lipoprotein	NA	J9SVN7	Pseudomonas_phage	30.2	3.4e-07
WP_006687274.1|2610341_2611079_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.8	1.9e-62
WP_000793140.1|2611078_2611429_-	membrane protein	NA	A4JWP3	Burkholderia_virus	54.8	4.0e-23
WP_000664222.1|2611676_2612447_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.9	7.6e-99
WP_001569386.1|2612494_2613028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021544473.1|2613063_2613474_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001041677.1|2613562_2613787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042842.1|2613783_2614089_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	9.2e-24
WP_006687266.1|2614098_2615007_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.4	6.3e-76
WP_011410680.1|2615010_2616780_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	67.8	6.2e-229
WP_011410679.1|2616790_2617957_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	61.1	1.3e-121
WP_000835317.1|2617959_2618229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005725.1|2618246_2618858_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	7.2e-76
WP_001569384.1|2618936_2619125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001569383.1|2619408_2619705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135926.1|2619691_2620381_+	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	33.9	5.9e-26
WP_000967768.1|2620377_2620593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988476.1|2620582_2621011_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	48.1	1.1e-25
WP_001281697.1|2621007_2621397_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	53.4	3.8e-30
2622112:2622126	attR	ATCGCACTGGCGCTG	NA	NA	NA	NA
>prophage 12
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	3178148	3268438	5133966	portal,terminase,transposase,protease,integrase,plate,capsid,tail,head,tRNA,holin	Enterobacteria_phage(61.67%)	93	3211709:3211728	3249517:3249536
WP_001298300.1|3178148_3178934_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3179069_3179849_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|3179825_3180719_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011603.1|3180872_3181619_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3181615_3181798_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056538.1|3181849_3183082_-	winged helix DNA-binding protein YcaQ	NA	NA	NA	NA	NA
WP_000570539.1|3183118_3184105_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3184101_3185850_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705764.1|3185886_3188151_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3188358_3188643_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3188802_3190476_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3190586_3191270_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|3191442_3192207_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445231.1|3192375_3193659_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057138.1|3193729_3194818_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|3195016_3195709_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001295344.1|3195838_3197599_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|3198004_3198862_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3198916_3201199_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|3201390_3202131_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_159375999.1|3202212_3202803_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_159376000.1|3202902_3203226_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000055455.1|3203226_3203811_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918517.1|3203811_3205242_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109259.1|3205451_3206600_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165879.1|3206913_3207540_+	hydrolase	NA	NA	NA	NA	NA
WP_000534637.1|3207574_3208438_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|3208439_3209057_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|3209067_3211512_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
3211709:3211728	attL	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000023738.1|3211811_3212804_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.5	2.0e-104
WP_000247830.1|3212873_3213215_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	47.1	2.5e-17
WP_001204233.1|3213318_3213840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203251.1|3213850_3214057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001381918.1|3214176_3214527_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	8.9e-55
WP_000158961.1|3214537_3214816_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	6.2e-35
WP_000514283.1|3214827_3215070_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	5.2e-38
WP_000021656.1|3215066_3215180_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_001092663.1|3215272_3215689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985163.1|3215712_3215916_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	1.9e-25
WP_000153700.1|3215912_3216179_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104303.1|3216175_3216475_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	8.2e-41
WP_122985482.1|3216486_3217104_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000564228.1|3217100_3217490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525148.1|3217486_3220327_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.7	0.0e+00
WP_001525150.1|3220403_3221363_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	2.4e-179
WP_000211267.1|3221367_3221679_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_052948109.1|3222800_3223847_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	5.7e-206
WP_052948110.1|3223846_3225598_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_159376001.1|3225752_3226589_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.1e-119
WP_159376002.1|3226612_3227665_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	3.4e-198
WP_063808945.1|3227710_3228511_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	87.6	1.9e-124
WP_000063082.1|3228613_3229108_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|3229107_3229308_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|3229310_3229634_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|3229630_3230023_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|3230019_3230427_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920594.1|3230564_3231032_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356358.1|3231024_3231660_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_159375949.1|3231656_3232238_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	4.7e-101
WP_000213447.1|3232234_3232585_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111955.1|3232588_3233485_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
WP_000080195.1|3233523_3235137_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|3235167_3235518_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3235514_3235940_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_159376003.1|3235993_3236626_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	75.3	3.6e-86
WP_159375950.1|3236622_3238188_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	56.3	2.4e-139
WP_024187361.1|3238198_3238693_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	56.3	8.8e-40
WP_016239660.1|3238693_3239296_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	83.4	3.9e-90
WP_001174919.1|3239267_3239708_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_094258973.1|3240135_3240726_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.8	9.7e-86
WP_000979945.1|3240763_3241252_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_159376004.1|3241264_3244072_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.8	0.0e+00
WP_000333503.1|3244058_3244214_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_050901167.1|3244222_3244597_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.7	2.0e-36
WP_159376005.1|3244653_3245166_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.1e-90
WP_159376006.1|3245165_3246350_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	4.4e-223
WP_000132830.1|3246507_3247617_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488105.1|3247659_3247920_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_015675153.1|3248318_3248945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157344.1|3248944_3249325_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_012478345.1|3249551_3250526_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
3249517:3249536	attR	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000886683.1|3250630_3251923_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3252013_3253357_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3253367_3253979_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|3254137_3258127_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3258261_3258756_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3259300_3260266_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043598.1|3260388_3262155_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000543083.1|3262155_3263877_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001241678.1|3263918_3264623_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3264907_3265126_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3265810_3268087_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3268117_3268438_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 13
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	3753829	3891960	5133966	terminase,transposase,integrase,plate,capsid,tail,head,tRNA,holin	Burkholderia_virus(18.48%)	165	3807222:3807258	3877820:3877856
WP_000667319.1|3753829_3754957_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_001266503.1|3755012_3756083_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001009885.1|3756175_3756757_+	ACP phosphodiesterase	NA	NA	NA	NA	NA
WP_159376077.1|3756761_3758576_-	maltodextrin glucosidase	NA	NA	NA	NA	NA
WP_047668326.1|3758935_3759559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072025250.1|3759653_3759887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281698.1|3759904_3760291_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.2	1.0e-27
WP_047621131.1|3760262_3760712_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	44.4	6.1e-24
WP_089519532.1|3760713_3760920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047621126.1|3760909_3761317_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	56.8	2.7e-31
WP_159376016.1|3761309_3761999_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.9	5.9e-34
WP_047621123.1|3761995_3762211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299260.1|3762225_3762522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632574.1|3762531_3762804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140143.1|3763092_3763623_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	67.3	2.4e-59
WP_000843446.1|3763650_3763920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376017.1|3763922_3765089_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
WP_159376018.1|3765099_3766869_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.8	1.1e-228
WP_001095645.1|3766884_3767202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533817.1|3767201_3768122_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000047759.1|3768132_3768441_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|3768493_3768682_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|3768775_3769132_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|3769248_3770013_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|3770203_3770419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|3770417_3770822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194950.1|3770797_3771526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|3771656_3772007_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_159376019.1|3772009_3772750_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	3.2e-62
WP_001216263.1|3772733_3773384_+	hypothetical protein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_000175097.1|3773380_3773707_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227704.1|3773706_3774018_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_000533684.1|3774020_3774563_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
WP_000137894.1|3774559_3776083_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.7	6.2e-185
WP_000090680.1|3776082_3777576_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	60.1	2.3e-168
WP_000117550.1|3777556_3778378_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.5	6.9e-98
WP_000135514.1|3778380_3778839_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273068.1|3779053_3780169_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286910.1|3780183_3781137_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.2	6.8e-65
WP_000537460.1|3781146_3781485_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271671.1|3781486_3781933_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	53.0	2.9e-34
WP_001101808.1|3781932_3782397_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	52.3	9.7e-41
WP_032143918.1|3782393_3782648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001275725.1|3782637_3784065_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	77.1	3.7e-216
WP_162828734.1|3784061_3784586_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.2	4.7e-68
WP_000110115.1|3784588_3784870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084227.1|3784967_3785303_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|3785247_3785385_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000135572.1|3785477_3787943_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	1.6e-169
WP_000458382.1|3787942_3788827_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	46.6	3.4e-50
WP_010989167.1|3788823_3789039_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000807996.1|3789026_3790181_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.3	4.2e-85
WP_000148263.1|3790177_3790705_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
WP_000859112.1|3790761_3791109_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
WP_001219105.1|3791099_3792203_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	54.3	3.2e-106
WP_000852584.1|3792195_3792774_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
WP_159376020.1|3792776_3793763_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	52.1	2.4e-60
WP_089588565.1|3793763_3794366_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	82.4	6.6e-90
WP_089624569.1|3794337_3794778_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.3	5.2e-52
WP_023892613.1|3795205_3795778_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_001295329.1|3796027_3797401_-	proline-specific permease ProY	NA	NA	NA	NA	NA
WP_061093194.1|3797476_3798796_-	branched-chain amino acid transporter carrier protein BrnQ	NA	NA	NA	NA	NA
WP_000893623.1|3799202_3800498_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
WP_000113933.1|3800555_3801245_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|3801434_3802637_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698951.1|3802633_3805780_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001326926.1|3805905_3807090_+	MFS transporter AraJ	NA	NA	NA	NA	NA
3807222:3807258	attL	TGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACGG	NA	NA	NA	NA
WP_001219309.1|3807334_3808243_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|3808367_3809279_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_120795376.1|3809356_3809440_-	protein YkiD	NA	NA	NA	NA	NA
WP_000941942.1|3809925_3810210_-	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001276420.1|3810281_3810959_-	AroM family protein	NA	NA	NA	NA	NA
WP_001142439.1|3811216_3811408_-	protein YaiA	NA	NA	NA	NA	NA
WP_000193393.1|3811457_3811982_-	shikimate kinase AroL	NA	NA	NA	NA	NA
WP_000158159.1|3812164_3812623_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_001295331.1|3812742_3813552_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_000484048.1|3813568_3814684_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
WP_001295332.1|3814785_3815106_-	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_000814403.1|3815224_3816640_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_000792970.1|3816740_3817001_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_001300163.1|3817182_3817386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413677.1|3817463_3818558_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_001295334.1|3818581_3818794_-	DUF2754 domain-containing protein	NA	NA	NA	NA	NA
WP_000763151.1|3819053_3819362_+	DUF2755 family protein	NA	NA	NA	NA	NA
WP_000092067.1|3819420_3820515_-	surface-exposed outer membrane lipoprotein YaiW	NA	NA	NA	NA	NA
WP_001301663.1|3820527_3821748_-	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
WP_000830741.1|3822099_3823257_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
WP_139550546.1|3823257_3823881_-	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
WP_088895425.1|3826473_3827701_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001295337.1|3828734_3829709_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000004027.1|3829815_3830667_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114620.1|3830663_3831491_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000939375.1|3831487_3832255_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
WP_001018417.1|3832267_3833230_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000362029.1|3833845_3834517_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_000860444.1|3834526_3835723_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_159376078.1|3835700_3836282_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000596084.1|3836283_3837057_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_001141271.1|3837243_3837519_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842100.1|3837553_3838663_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
WP_000419083.1|3838756_3839590_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001096705.1|3839813_3840353_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_159376021.1|3841803_3842451_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000989761.1|3842619_3842856_+	DNA-binding protein	NA	M1PVU4	Vibrio_phage	57.4	1.8e-14
WP_060589422.1|3842855_3844898_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	48.8	2.5e-173
WP_060589421.1|3844916_3845810_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	57.3	6.8e-91
WP_000361028.1|3845824_3846049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159376022.1|3846061_3846277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060589420.1|3846306_3846951_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	69.3	1.7e-75
WP_060589419.1|3846952_3847186_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021564514.1|3847166_3847358_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	53.3	3.6e-10
WP_000117574.1|3847438_3847825_+	hypothetical protein	NA	U5PRY6	Bacillus_phage	47.9	1.1e-21
WP_113411027.1|3847888_3848617_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_000687524.1|3848830_3849061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060589416.1|3849050_3849341_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	61.7	2.6e-23
WP_113411026.1|3849337_3849646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060589414.1|3850007_3850418_+	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	70.6	8.3e-28
WP_060589413.1|3850572_3850851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060589412.1|3850822_3851221_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	62.8	6.0e-39
WP_000976762.1|3851217_3851694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032082855.1|3851794_3852262_+	mor transcription activator family protein	NA	A0A0M3LRS6	Mannheimia_phage	33.3	4.0e-18
WP_060589411.1|3852287_3852566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372993.1|3852748_3853141_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	55.7	1.6e-28
WP_021536556.1|3853130_3853427_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.5	6.2e-17
WP_060589410.1|3853410_3853956_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	86.2	4.9e-92
WP_159376023.1|3854188_3854374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312575.1|3854361_3854862_+	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.8	4.4e-39
WP_021536553.1|3854908_3855649_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	51.9	4.1e-65
WP_060589409.1|3855650_3857291_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	63.3	1.7e-193
WP_060589408.1|3857294_3858890_+	DUF935 domain-containing protein	NA	L7P7P3	Pseudomonas_phage	45.7	3.5e-122
WP_113411020.1|3858876_3860043_+|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	46.4	5.1e-62
WP_060589406.1|3860039_3860591_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	30.1	3.1e-09
WP_060589423.1|3860800_3861916_+	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	38.7	1.5e-50
WP_000375807.1|3861916_3862312_+	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	37.0	7.0e-16
WP_159376024.1|3862322_3863231_+|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	59.7	1.6e-100
WP_159376025.1|3863234_3863576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119400.1|3863579_3864011_+	DUF1320 family protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	27.4	7.0e-09
WP_071782311.1|3864007_3864646_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	38.3	1.4e-26
WP_000671672.1|3864659_3864860_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_047660067.1|3864852_3866274_+|tail	tail sheath protein	tail	B7SDP8	Haemophilus_phage	44.9	3.2e-95
WP_000053464.1|3866286_3866661_+	hypothetical protein	NA	F6MIK8	Haemophilus_phage	61.2	2.3e-32
WP_000152396.1|3866657_3867041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178828.1|3867055_3867214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159376026.1|3867203_3869477_+|tail	tail length tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	35.5	7.3e-81
WP_054410209.1|3869476_3870826_+	multidrug DMT transporter permease	NA	F6MIL2	Haemophilus_phage	26.8	2.2e-37
WP_029392783.1|3870809_3872021_+|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.8	3.4e-69
WP_001409439.1|3872017_3872671_+|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	48.2	6.1e-41
WP_021536538.1|3872724_3873075_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.8	3.6e-32
WP_159376027.1|3873074_3874154_+|tail	phage tail protein	tail	A0A0M3LQN4	Mannheimia_phage	44.6	1.2e-73
WP_001098747.1|3874157_3874730_+	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	39.8	2.3e-31
WP_130563127.1|3874999_3875518_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	58.1	2.3e-43
WP_159376028.1|3875518_3876121_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	81.3	2.8e-88
WP_044067066.1|3876092_3876536_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	63.1	6.6e-47
WP_167745256.1|3876535_3876910_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	48.1	1.4e-13
WP_001013499.1|3877903_3878917_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
3877820:3877856	attR	CCGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
WP_000044314.1|3878913_3879864_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_000160710.1|3879860_3880670_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_000121907.1|3880679_3881546_-	2-hydroxy-6-oxonona-2,4-dienedioate hydrolase	NA	NA	NA	NA	NA
WP_000543457.1|3881563_3882508_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_001007407.1|3882509_3884174_-	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_001310587.1|3884250_3885198_+	DNA-binding transcriptional activator MhpR	NA	NA	NA	NA	NA
WP_000805902.1|3885274_3886357_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177906.1|3886479_3889554_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
WP_000291549.1|3889605_3890859_+	lactose permease	NA	NA	NA	NA	NA
WP_000019445.1|3890979_3891960_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 14
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	3915426	3986742	5133966	transposase,holin	Pseudomonas_phage(21.43%)	51	NA	NA
WP_000131044.1|3915426_3917460_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3917588_3918176_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3918189_3919662_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3919675_3921346_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3921558_3922227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3922469_3923165_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3923157_3924585_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3924595_3925315_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3925841_3926696_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_073546662.1|3926921_3928247_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	1.4e-113
WP_000474084.1|3928355_3928592_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3928603_3929197_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_012478345.1|3931103_3932078_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_159376029.1|3937934_3938144_-	adhesin	NA	NA	NA	NA	NA
WP_000662258.1|3939258_3939360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3939723_3939987_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3939986_3940127_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3940161_3940389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3941212_3941755_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3941829_3942417_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3942474_3943143_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3943168_3945694_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3945683_3947327_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3947295_3948006_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3948318_3948648_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000019448.1|3948981_3949962_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_000070700.1|3950300_3950990_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3950986_3951943_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|3951939_3954138_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|3954147_3955104_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3955082_3955493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001094398.1|3955813_3956182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249034.1|3956202_3956508_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_021566097.1|3956611_3957256_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.0	3.0e-24
WP_000692345.1|3957274_3957496_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001424026.1|3957564_3958041_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855059.1|3958056_3958530_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_021566099.1|3958871_3959693_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	6.8e-45
WP_000581506.1|3960102_3960558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063714286.1|3960633_3963150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376030.1|3963270_3966117_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_097296745.1|3966488_3967361_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000282126.1|3967691_3967874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001385107.1|3969344_3972131_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	33.2	2.8e-119
WP_001060305.1|3972127_3974173_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_001065545.1|3974165_3975344_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_001189111.1|3976141_3977650_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001254932.1|3978757_3979909_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000823247.1|3981484_3982843_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000560765.1|3984911_3985304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159376031.1|3985579_3986742_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	5.2e-51
>prophage 15
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	4083696	4137354	5133966	terminase,transposase,portal,protease,capsid,tail,head,tRNA	uncultured_Caudovirales_phage(36.84%)	50	NA	NA
WP_000753946.1|4083696_4085121_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
WP_000057067.1|4085250_4086768_-	dGTPase	NA	NA	NA	NA	NA
WP_000689844.1|4086851_4087550_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_001129927.1|4087542_4088343_+	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_000964221.1|4088380_4089004_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_001295564.1|4089050_4089395_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
WP_120795373.1|4089387_4089453_-	protein YadW	NA	NA	NA	NA	NA
WP_000845394.1|4089476_4090898_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_000045315.1|4091122_4092403_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_000044072.1|4092560_4094543_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_001310529.1|4094539_4095430_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_001158931.1|4095429_4096227_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
WP_000124438.1|4096277_4098521_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
WP_153275050.1|4098740_4101266_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_001360098.1|4101461_4103891_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-38
WP_001294700.1|4103964_4104495_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|4104509_4105214_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|4105391_4105847_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937424.1|4105883_4106810_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|4106848_4108267_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000215139.1|4108263_4108743_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000019448.1|4109177_4110158_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_000465928.1|4110355_4111096_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000151605.1|4111130_4113728_+	Yad fimbria usher protein HtrE	NA	NA	NA	NA	NA
WP_000598300.1|4113744_4114314_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001310526.1|4114325_4114931_+	fimbrial-like protein YadL	NA	NA	NA	NA	NA
WP_000019444.1|4115444_4116425_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	3.0e-185
WP_000805497.1|4117229_4118024_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_000905383.1|4118035_4118887_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_000339954.1|4118960_4119863_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	7.4e-61
WP_000621515.1|4120136_4120517_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_000277917.1|4120520_4121750_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000901987.1|4121813_4122254_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000972203.1|4122358_4123129_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000150637.1|4123125_4124052_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|4124160_4124823_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000680691.1|4124863_4125400_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_012478345.1|4126125_4127100_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_024190288.1|4127768_4128053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376033.1|4128058_4129720_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.8	2.3e-278
WP_001353110.1|4129703_4130060_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_001251188.1|4130178_4130364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145897.1|4130347_4130788_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_001287546.1|4130787_4131090_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.4e-27
WP_016241840.1|4131082_4132297_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.6	3.4e-210
WP_000798770.1|4132298_4132859_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.4	9.8e-88
WP_016241839.1|4132907_4134053_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	68.5	1.2e-143
WP_016236863.1|4134326_4134575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016236862.1|4134593_4135019_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_016241838.1|4135230_4137354_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	51.2	1.6e-175
>prophage 16
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	4371001	4378573	5133966	integrase,transposase	uncultured_Caudovirales_phage(16.67%)	6	4367727:4367742	4388853:4388868
4367727:4367742	attL	TCAACAGCCTGCTGCA	NA	NA	NA	NA
WP_000684856.1|4371001_4371958_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175459.1|4371958_4372726_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	4.9e-13
WP_001310555.1|4373192_4374209_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_001218933.1|4374213_4375455_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.8	6.1e-82
WP_001575402.1|4375921_4376941_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	4.2e-44
WP_001376011.1|4377070_4378573_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
4388853:4388868	attR	TCAACAGCCTGCTGCA	NA	NA	NA	NA
>prophage 17
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	4457321	4518917	5133966	integrase,transposase,tRNA,protease	Vibrio_phage(15.38%)	60	4458600:4458614	4516360:4516374
WP_000811566.1|4457321_4457597_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001295190.1|4457713_4459339_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
4458600:4458614	attL	CCGTCAGGCAAAAAG	NA	NA	NA	NA
WP_000943964.1|4459422_4460586_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101685.1|4460588_4461227_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4461236_4461635_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012550.1|4461652_4462312_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|4462362_4463061_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4463079_4463481_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4463607_4464339_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076332.1|4464518_4466960_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
WP_001177639.1|4466998_4467424_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4467628_4468927_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4469030_4469228_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4469309_4470314_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4470316_4471576_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|4471661_4472942_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4473017_4473326_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|4473411_4474362_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122505.1|4474354_4476202_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990333.1|4476211_4477549_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4477567_4478029_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001295189.1|4478000_4479548_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|4479546_4480686_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4480668_4480722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4481464_4482010_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041964.1|4482104_4483157_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|4483253_4484222_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236847.1|4484243_4487567_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|4487595_4487910_-	YjeO family protein	NA	NA	NA	NA	NA
WP_159376042.1|4487906_4488221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001336293.1|4488272_4489775_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|4489993_4490971_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192973.1|4491295_4493104_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|4493096_4493831_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|4493841_4494237_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609663.1|4494247_4494607_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001336292.1|4494669_4495803_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|4495891_4496425_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|4496421_4496739_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|4496914_4497061_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|4497171_4497297_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|4497348_4497915_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940549.1|4497956_4498985_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_159376043.1|4499379_4500249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047597554.1|4500451_4500805_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|4500942_4502589_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4502632_4502926_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|4503201_4504458_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|4504473_4504950_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|4505286_4506723_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|4506840_4508142_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883407.1|4508257_4508596_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068922.1|4508571_4510269_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|4510305_4510881_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218802.1|4511260_4512523_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	1.2e-77
WP_021543393.1|4512787_4514290_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_021578734.1|4514471_4515200_-	porin family protein	NA	NA	NA	NA	NA
WP_001275820.1|4515417_4515786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074148265.1|4516077_4516248_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_000019445.1|4517936_4518917_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
4516360:4516374	attR	CCGTCAGGCAAAAAG	NA	NA	NA	NA
>prophage 18
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	4523192	4578133	5133966	integrase,transposase,tRNA	Stx2-converting_phage(70.59%)	40	4522290:4522349	4593398:4594165
4522290:4522349	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_157839822.1|4523192_4523615_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_024248572.1|4524204_4525416_+	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_159376044.1|4525408_4528270_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000080195.1|4528758_4530372_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|4530402_4530753_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|4530749_4531175_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_096145160.1|4531345_4532884_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	5.5e-298
WP_159376080.1|4533501_4533696_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.0	4.6e-21
WP_001066423.1|4533683_4535240_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.7	2.6e-162
WP_000631725.1|4535259_4535607_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|4535603_4536278_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_021578747.1|4537204_4537501_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_088895425.1|4539541_4540769_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_021578750.1|4543150_4543897_-	porin family protein	NA	NA	NA	NA	NA
WP_021578751.1|4544978_4545758_-	OmpA family protein	NA	NA	NA	NA	NA
WP_159376045.1|4545778_4549216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157925225.1|4551703_4552384_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_097707835.1|4552793_4553150_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016232891.1|4553134_4553773_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.7	7.3e-55
WP_097707836.1|4553757_4554987_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.8	2.7e-61
WP_097707837.1|4555230_4555965_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001315613.1|4556120_4556693_-	YfdX family protein	NA	NA	NA	NA	NA
WP_021572172.1|4557524_4559096_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.1e-168
WP_000624622.1|4559115_4559463_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001279435.1|4560333_4560525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376046.1|4560637_4561672_-	F17G fimbrial adhesin	NA	NA	NA	NA	NA
WP_137427054.1|4561673_4564142_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000680559.1|4564225_4564948_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_047664276.1|4565017_4565557_-	fimbrial protein	NA	NA	NA	NA	NA
WP_151074827.1|4566640_4568212_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	57.7	4.6e-167
WP_000624622.1|4568231_4568579_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_128457784.1|4568578_4569229_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	42.7	1.2e-15
WP_137427057.1|4569881_4571201_+	MFS transporter family glucose-6-phosphate receptor UhpC	NA	NA	NA	NA	NA
WP_159376047.1|4571871_4572852_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_097707938.1|4573156_4574182_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_167745257.1|4574255_4574426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096848713.1|4575671_4575956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096936272.1|4575999_4576296_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_001173343.1|4576323_4576497_+	type V toxin-antitoxin system toxin GhoT	NA	NA	NA	NA	NA
WP_137427006.1|4576615_4578133_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	1.2e-87
4593398:4594165	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCCTTTGCTTTTATCCAAATACCAATCCCTGCTAACATACCAGCCCCTCCCCCCACCTTTAAAGAATAAATAATATCCGCCATCCAATCAAAAAATAAAACTTGAGTTTTAGAAAAAACTATCAGTCTACCAAGAATCGTACCTAACATTGCCATAAAAAAGATGCAAGCTATGCAGCGCGTTATTAGTATGATAAGAGTGTAAAAGTTGACACTCTTATTTATTTTTAATGGATTTATCAGCTTCATCTAGTGTTCCTTTTGTTACATTCCCGATAGCTTCACCAGTAATTGATCCCCCAATATTACCAATAATATCAGATGTTCCCTCTTTGACAGTAGAGCCCATTGACCCCGAGATGACTTTCCCTATACCGCCACCAAATACTGAACCTAATCCTGTCCCAATAACTGAATTTGTCGGATCCTCGCCTTTAATACTACTACCAATTGCCGCGCCGCTCATGTTGATAGGGGTTGAAACTATAATTCCTTTTCCTGTTGTTGCTGCTGCCGTTACCCCTGCAATTATCGCATCCACATAACTGAAAGGATCTTTTCCAGCAAGCTGAGCAGCTGAGTTTACGCTGATACCAATTGCTGCATTAGTCGCCATACCTTTCACTGTTAACCCCAGTACGCTTCCTCCAAACAACAAAGGAGCATCACCAATACTTGCATTAGATTTATGATACCCCCAGGTATTCATAA	NA	NA	NA	NA
>prophage 19
NZ_CP026935	Escherichia coli strain CFS3292 chromosome, complete genome	5133966	4756940	4798133	5133966	portal,terminase,tRNA,integrase,protease,capsid,tail,lysis,head,plate,holin	Shigella_phage(37.04%)	59	4745032:4745047	4770876:4770891
4745032:4745047	attL	GGCGCTGCCGGAGCGG	NA	NA	NA	NA
WP_000543828.1|4756940_4757978_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001514812.1|4758066_4759164_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	1.4e-210
WP_001514811.1|4759225_4759474_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	98.8	3.1e-38
WP_001514810.1|4759822_4760518_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_089588565.1|4761666_4762269_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	82.4	6.6e-90
WP_089624569.1|4762240_4762681_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.3	5.2e-52
WP_052924723.1|4763331_4763916_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	1.8e-113
WP_103743316.1|4763906_4764965_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.4	1.1e-201
WP_000424732.1|4764951_4765377_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259084.1|4765376_4765925_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000999499.1|4765924_4767004_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_159376058.1|4767000_4768500_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	87.9	3.5e-233
WP_159376059.1|4768556_4769045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774665.1|4769109_4771011_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.5	0.0e+00
4770876:4770891	attR	CCGCTCCGGCAGCGCC	NA	NA	NA	NA
WP_000571713.1|4771095_4771419_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_000090998.1|4771415_4771772_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_016240456.1|4771771_4773265_-|tail	phage tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.4	1.3e-272
WP_000497749.1|4773251_4773419_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	96.3	8.6e-24
WP_000779294.1|4773427_4773988_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_000224835.1|4773984_4774491_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000702395.1|4774465_4774876_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924829.1|4774872_4775196_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	1.7e-52
WP_000766100.1|4775274_4776504_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4776514_4777117_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923135.1|4777109_4778336_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.8	3.4e-242
WP_024244491.1|4778325_4778487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122986947.1|4778483_4779980_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.6	3.1e-290
WP_000929175.1|4780213_4780708_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_001135096.1|4780833_4781184_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	4.0e-63
WP_000877024.1|4781499_4782030_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	95.5	3.4e-90
WP_000858463.1|4782232_4782694_-|lysis	lysis protein	lysis	K7P6Y5	Enterobacteria_phage	88.9	3.2e-68
WP_001075795.1|4782690_4783305_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	98.0	8.2e-112
WP_000422366.1|4783304_4783586_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|4783572_4783959_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001569330.1|4784038_4784296_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	95.3	5.6e-38
WP_159376060.1|4784446_4785199_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.6	8.1e-138
WP_001439745.1|4785212_4786202_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
WP_001061438.1|4786209_4787019_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767134.1|4787038_4787428_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	100.0	3.2e-69
WP_000210154.1|4787424_4787751_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000066917.1|4787747_4788401_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_021518078.1|4788495_4789437_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	98.7	1.8e-142
WP_001188051.1|4789426_4789606_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.7e-15
WP_039022224.1|4789781_4790366_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001231956.1|4790393_4790591_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000981537.1|4790686_4791340_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_039052440.1|4791797_4792160_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	4.9e-56
WP_023154065.1|4792225_4793050_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.3e-149
WP_001401560.1|4793178_4793715_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_024166531.1|4793705_4794068_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	8.0e-67
WP_000111289.1|4794064_4794268_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_000476211.1|4794260_4794500_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	98.7	2.2e-36
WP_159376061.1|4794496_4795183_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	58.8	2.0e-58
WP_159376062.1|4795184_4795394_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	98.6	1.2e-35
WP_159376063.1|4795390_4796170_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	44.5	6.6e-50
WP_001061345.1|4796169_4796742_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
WP_001093914.1|4796778_4797051_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	96.6	5.7e-41
WP_000900143.1|4797084_4797546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535325.1|4797551_4798133_-	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.6	8.8e-07
>prophage 1
NZ_CP026936	Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence	192448	117319	135241	192448	transposase,integrase	Salmonella_phage(20.0%)	17	116137:116151	136849:136863
116137:116151	attL	GTGCCGCGCGCGCTC	NA	NA	NA	NA
WP_000844627.1|117319_117562_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001138014.1|117619_120586_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|120589_121150_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000845048.1|121374_122388_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_012386611.1|122645_122732_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_010729924.1|122747_124667_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.1	0.0e+00
WP_047655494.1|124785_124953_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	66.0	4.7e-14
WP_000845048.1|125590_126604_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000777555.1|126760_127234_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_001206317.1|127326_128118_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|128281_128629_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|128622_129462_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|129589_130090_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|130265_131048_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|131037_132561_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000344784.1|132662_133523_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|133525_135241_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
136849:136863	attR	GAGCGCGCGCGGCAC	NA	NA	NA	NA
>prophage 2
NZ_CP026936	Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence	192448	165265	172068	192448	transposase	Stx2-converting_phage(28.57%)	9	NA	NA
WP_001251243.1|165265_165703_-	hypothetical protein	NA	A0A1V0E5M6	Salmonella_phage	48.0	3.6e-21
WP_000803859.1|165806_166331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000277497.1|166651_167416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167416.1|167496_168258_+	methyltransferase	NA	A0A2I7RNS1	Vibrio_phage	32.9	1.2e-19
WP_000149861.1|168351_168615_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	46.5	3.2e-09
WP_001572415.1|168635_169247_+	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	71.1	1.2e-09
WP_000422741.1|169651_170077_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|170073_170424_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|170454_172068_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 1
NZ_CP026937	Escherichia coli strain CFS3292 plasmid pCFS3292-2, complete sequence	131954	73690	119291	131954	transposase,integrase	Salmonella_phage(16.67%)	36	73014:73027	97161:97174
73014:73027	attL	ATTAATGCCCTGAA	NA	NA	NA	NA
WP_001066941.1|73690_74431_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_162841962.1|74551_74719_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001541953.1|76079_77069_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022631027.1|77084_77861_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001541951.1|79225_79747_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001541950.1|79743_80697_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_113975883.1|80783_83108_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879160.1|83152_84055_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|84051_85050_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000175457.1|86002_86770_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G9BWD6	Planktothrix_phage	31.3	8.9e-15
WP_000177057.1|87327_87585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227969.1|87992_89069_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001254932.1|89956_91108_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_025670887.1|92017_92326_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.6	8.8e-14
WP_000790483.1|92469_92901_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555737.1|93151_94627_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000697969.1|94619_95300_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000475512.1|95489_96875_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|96902_97256_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
97161:97174	attR	ATTAATGCCCTGAA	NA	NA	NA	NA
WP_001381488.1|97369_98662_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_020219104.1|98672_101819_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	2.1e-62
WP_000758229.1|101905_102346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001398208.1|102443_104921_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
WP_000843497.1|104961_105159_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_159376085.1|105192_105780_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.0e-10
WP_001138064.1|106889_109856_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_001133513.1|109858_110377_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	3.7e-49
WP_001067856.1|110435_111140_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_077167923.1|111149_111707_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.7	1.2e-29
WP_001254932.1|112081_113233_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_077635224.1|113329_113740_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.3	3.5e-10
WP_001189111.1|114346_115855_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001082319.1|116500_117304_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|117303_118140_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_072135329.1|118111_118339_-	hypothetical protein	NA	A0A1B0VFY5	Salmonella_phage	88.2	8.7e-11
WP_000018321.1|118475_119291_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
>prophage 1
NZ_CP026938	Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence	99787	0	98174	99787	integrase,terminase,portal,holin,transposase,tail	Escherichia_phage(60.92%)	91	1:60	61292:61874
1:60	attL	TGTCGATGCCAAGAGTGGCCTGACCCACAGCCTGGTCACCACCGCGGCCAACGAGCATGA	NA	NA	NA	NA
WP_159376086.1|549_750_+	hypothetical protein	NA	Q71TN7	Escherichia_phage	100.0	3.3e-22
WP_000523980.1|760_1372_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000926346.1|1386_2268_+	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.7	6.3e-174
WP_159376087.1|2349_5742_+	transglycosylase SLT domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	97.6	0.0e+00
WP_000002801.1|5741_6098_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	99.2	5.0e-61
WP_159376088.1|7526_8363_+|tail	phage tail protein	tail	A0A077SLH5	Escherichia_phage	98.6	1.7e-152
WP_001286326.1|8441_8876_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_001164123.1|12123_12651_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	96.0	1.4e-91
WP_000972192.1|12679_13213_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	96.6	8.7e-94
WP_167745266.1|13215_14511_-|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	87.1	3.1e-230
WP_000905118.1|14777_15338_-	recombinase family protein	NA	Q71TD8	Escherichia_phage	100.0	2.1e-98
WP_000332810.1|15465_15747_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	98.9	1.8e-45
WP_000887652.1|15814_16144_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|16140_16584_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000164724.1|16570_17173_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
WP_000434681.1|17174_19094_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	99.4	0.0e+00
WP_000175490.1|19090_19456_+	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	97.5	2.1e-46
WP_159376089.1|19468_22456_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.1	0.0e+00
WP_001165940.1|22445_22751_+	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	100.0	1.2e-52
WP_000724561.1|23490_24603_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	98.1	1.0e-200
WP_063099965.1|24836_25325_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	98.8	4.2e-87
WP_001345478.1|25494_26052_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_029396176.1|26343_27363_-	hypothetical protein	NA	Q71TR6	Escherichia_phage	99.4	2.7e-184
WP_159376090.1|27355_29065_-|portal	phage portal protein	portal	Q71TR7	Escherichia_phage	99.5	0.0e+00
WP_159376091.1|29141_35909_+	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.6	0.0e+00
WP_000224043.1|35942_36383_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|36379_36628_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_096216487.1|36674_37982_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_023156639.1|38038_38680_-	hypothetical protein	NA	A0A077SK30	Escherichia_phage	98.1	1.6e-113
WP_167745267.1|38868_39222_-	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	98.3	8.1e-64
WP_003465043.1|40426_40783_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|41037_41364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100853.1|41857_42229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|42222_42780_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_001749391.1|43222_43534_-	hypothetical protein	NA	Q5QBN5	Enterobacteria_phage	100.0	2.1e-47
WP_085326055.1|43584_44616_-|integrase	site-specific integrase	integrase	Q71TG5	Escherichia_phage	99.4	8.4e-194
WP_000542336.1|44623_44845_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_000874156.1|45449_45659_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611664.1|45769_46621_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
WP_061356644.1|46653_47766_-	antirepressor	NA	A0A077SLR9	Escherichia_phage	86.5	2.9e-176
WP_032163774.1|48343_49828_-	hypothetical protein	NA	Q71T61	Escherichia_phage	98.4	2.9e-288
WP_156838212.1|49827_51021_-|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	88.2	1.8e-179
WP_016231381.1|51106_51559_-	hypothetical protein	NA	Q71T63	Escherichia_phage	99.3	2.0e-78
WP_047649471.1|51647_52691_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.8	7.4e-206
WP_000113018.1|52718_52898_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_001216030.1|52902_53283_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	99.2	1.9e-63
WP_072649184.1|53282_53504_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	2.5e-31
WP_038997084.1|53686_55243_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.1e-104
WP_159195488.1|55239_56433_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	29.0	9.3e-11
WP_096216484.1|56554_59671_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	1.7e-27
WP_029401419.1|59935_60442_-	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.2	1.6e-92
WP_159376093.1|60514_60748_-	hypothetical protein	NA	Q71TI8	Escherichia_phage	100.0	2.7e-23
WP_000019448.1|60746_61727_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_000684869.1|63278_63980_-	hypothetical protein	NA	Q71TJ0	Escherichia_phage	97.0	4.3e-141
61292:61874	attR	TGTCGATGCCAAGAGTGGCCTGACCCACAGCCTGGTCACCACCGCGGCCAACGAGCATGACCTCAATCAGCTGGGTAATCTGCTTCATGGAGAGGAGCAATTTGTCTCAGCCGATGCCGGCTACCAAGGAGCGCCACAGCGCGAGGAGCTGGCCGAGGTGGATGTGGACTGGCTGATCGCCGAGCGTCCCGGCAAGGTAAAAACCTTGAAGCAGAATCCGCGCAAGAACAAAACGGCCATCAACATCGAATACATGAAAGCCAGCATCCGTGCCAGGGTGGAGCACCCGTTTCGCATCATCAAGCGGCAGTTCGGCTTCGTGAAAGCCAGATACAAGGGGCTGCTGAAAAACGATAACCAACTGGCGATGTTATTCACCCTGGCCAACCTGTTTCGGGTGGACCAAATGATACGTCAGTGGGAGAGATCTCAGTAAAAACCGGAAATAACGCCAGAAATGGTGGAAAAAATAGCCTAAATAGGCTGATTCGATGTGTTTGCGGGAAAAAAATCGGCCCAGATCCGCGAAATCTTAATCAGCGAGTCAGCTTGGGAAGAAATGACCTGCTTATTCGCACCTTCC	NA	NA	NA	NA
WP_042032526.1|63976_64654_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	98.7	1.4e-133
WP_042032528.1|64650_65277_-	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	99.5	2.8e-123
WP_001398240.1|65174_65837_-	hypothetical protein	NA	Q71T83	Escherichia_phage	99.5	2.9e-123
WP_000008815.1|65778_65934_-	hypothetical protein	NA	Q1MVH0	Enterobacteria_phage	96.1	2.7e-19
WP_000840931.1|66582_66828_-	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000235786.1|66974_67352_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141908.1|67361_68579_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000896801.1|68582_69311_+	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_000602717.1|69297_70083_+	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
WP_000212015.1|70084_71101_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	4.5e-192
WP_000535203.1|71093_71726_+	hypothetical protein	NA	A0A077SK50	Escherichia_phage	100.0	6.9e-90
WP_001198667.1|71772_72771_-	hypothetical protein	NA	A0A077SL52	Escherichia_phage	99.7	1.6e-194
WP_089518986.1|72770_74135_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	99.6	1.4e-252
WP_000146941.1|74601_74766_-	DUF3927 family protein	NA	Q1MVI2	Enterobacteria_phage	100.0	8.2e-19
WP_000467133.1|74765_75200_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	100.0	8.1e-74
WP_089540072.1|76956_79545_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	86.9	0.0e+00
WP_000472529.1|79541_80447_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_001177860.1|80439_80724_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_097740077.1|81186_81975_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	91.6	2.6e-110
WP_000007769.1|82014_82437_+	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_023156141.1|82614_83007_+	hypothetical protein	NA	A0A1B0VBK3	Salmonella_phage	97.7	9.9e-71
WP_001113742.1|83342_84227_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_159376094.1|84519_85329_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	99.3	2.2e-157
WP_001285362.1|85496_86693_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_029490196.1|86709_87711_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.1	2.8e-178
WP_000067708.1|87936_89643_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000085145.1|89703_91293_+	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	100.0	2.5e-306
WP_159376095.1|91302_92118_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.9	2.9e-112
WP_000035301.1|92153_92735_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_000509939.1|92746_93256_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_001313475.1|93372_93528_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_001426344.1|93709_93955_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_159376096.1|94005_94851_-	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	98.9	5.0e-152
WP_001187875.1|94880_95681_-	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_032219025.1|95845_96883_-	antirepressor	NA	Q71TN2	Escherichia_phage	93.7	6.7e-175
WP_000245710.1|96879_97101_-	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	100.0	5.6e-39
WP_000120524.1|97499_98174_+	hypothetical protein	NA	Q71TC4	Escherichia_phage	94.0	6.8e-19
