The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026929	Escherichia coli strain CFS3246 chromosome, complete genome	4803456	1144389	1157572	4803456		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1144389_1145151_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1145144_1145771_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1145910_1147050_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1147112_1148105_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1148198_1149563_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1149651_1150428_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1150432_1151071_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1151067_1152330_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1152326_1153235_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1153430_1154198_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1154248_1154905_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272928.1|1155010_1157572_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP026929	Escherichia coli strain CFS3246 chromosome, complete genome	4803456	2021638	2063635	4803456	holin,capsid,lysis,integrase	Salmonella_phage(32.79%)	66	2023594:2023614	2067634:2067654
WP_000019590.1|2021638_2022382_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000252980.1|2022422_2022818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050582975.1|2022870_2023650_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
2023594:2023614	attL	CACGCAGTTAAAGTGGCGGGC	NA	NA	NA	NA
WP_029487533.1|2023646_2024906_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	90.2	1.3e-225
WP_016244760.1|2024948_2025194_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_089508025.1|2025353_2025689_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	60.2	3.0e-23
WP_089508023.1|2025690_2026098_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.2e-68
WP_000118152.1|2026099_2026399_-	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
WP_001214453.1|2026395_2026563_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
WP_000753560.1|2026579_2026894_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	2.7e-50
WP_089508021.1|2026905_2027388_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	95.6	2.3e-77
WP_000065840.1|2027371_2028283_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.3	1.1e-168
WP_000604110.1|2028279_2028588_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
WP_001243355.1|2028672_2028825_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|2028809_2028944_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000597940.1|2029027_2029276_-	hypothetical protein	NA	K7P6N6	Enterobacteria_phage	100.0	1.6e-37
WP_089508019.1|2029450_2030074_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	97.1	1.6e-107
WP_077780276.1|2030085_2030448_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	99.1	1.5e-52
WP_001507092.1|2030825_2031863_-	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	100.0	1.9e-190
WP_106120888.1|2031885_2032581_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	2.0e-130
WP_000067728.1|2032656_2032872_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	98.6	8.2e-35
WP_000251069.1|2032991_2033285_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_001244621.1|2033307_2033580_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_159373740.1|2033642_2034530_+	replication protein	NA	A5VW95	Enterobacteria_phage	99.0	6.2e-145
WP_159373741.1|2034526_2035903_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.6e-253
WP_157894881.1|2035975_2036182_+	hypothetical protein	NA	G9L683	Escherichia_phage	94.1	8.7e-26
WP_021557665.1|2036199_2036520_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	73.6	5.0e-36
WP_001277269.1|2036522_2036687_+	hypothetical protein	NA	A0A1R3Y6Z7	Salmonella_virus	90.7	2.1e-19
WP_122985696.1|2036667_2037108_+	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	99.3	1.7e-79
WP_000153280.1|2037104_2037632_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254255.1|2037628_2037805_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924594.1|2037807_2038209_+	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	98.5	4.6e-71
WP_001543885.1|2038168_2038378_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001108028.1|2038370_2038982_+	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.0	5.1e-98
WP_089508170.1|2038978_2039650_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	98.2	3.9e-131
WP_000512802.1|2039640_2040129_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	98.1	2.2e-88
WP_000783734.1|2040618_2040942_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229394.1|2040925_2041402_+	glycoside hydrolase family protein	NA	K7PKI0	Enterobacteria_phage	100.0	1.3e-88
WP_159373742.1|2041398_2041866_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.7	4.2e-68
WP_050008831.1|2041924_2042164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089507959.1|2042836_2043472_+	hypothetical protein	NA	I6S676	Salmonella_phage	82.5	2.5e-103
WP_001515074.1|2043503_2043977_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	72.8	4.7e-51
WP_089507962.1|2043979_2045602_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	6.0e-312
WP_089507964.1|2045601_2047068_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.7	1.1e-268
WP_089507967.1|2046955_2047693_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.5	2.3e-108
WP_029487547.1|2047707_2048928_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	91.7	1.3e-206
WP_089507969.1|2048932_2049436_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	84.4	3.2e-74
WP_029487549.1|2049447_2050389_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	96.2	1.0e-174
WP_006120171.1|2050430_2050820_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	58.1	2.9e-30
WP_089507971.1|2050785_2051193_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_089507973.1|2051189_2051744_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.2	6.1e-82
WP_001142484.1|2051730_2052120_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_089507975.1|2052094_2052658_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.1	8.4e-79
WP_089507977.1|2052661_2053807_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	4.0e-160
WP_000109255.1|2053817_2054258_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	1.6e-56
WP_089507979.1|2054261_2054714_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	73.3	1.6e-56
WP_001420197.1|2056878_2057466_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_047672422.1|2057465_2057768_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	89.0	1.6e-47
WP_089507983.1|2057770_2058835_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	2.4e-159
WP_126927342.1|2058837_2059302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089507986.1|2059527_2060100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089507988.1|2060101_2060518_+	toxin YafO, type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
WP_089507990.1|2060560_2061316_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	84.9	6.5e-111
WP_001270634.1|2061315_2061669_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
WP_057077886.1|2061668_2062865_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	73.4	1.1e-157
WP_050008888.1|2062861_2063635_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.1	2.8e-77
2067634:2067654	attR	CACGCAGTTAAAGTGGCGGGC	NA	NA	NA	NA
>prophage 3
NZ_CP026929	Escherichia coli strain CFS3246 chromosome, complete genome	4803456	2346410	2420887	4803456	terminase,capsid,portal,transposase,tail,lysis,integrase,head,protease	Enterobacteria_phage(40.0%)	93	2340761:2340776	2376754:2376769
2340761:2340776	attL	TTCATAAAAATAATCC	NA	NA	NA	NA
WP_001260865.1|2346410_2347232_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2347331_2347415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2347507_2347843_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2348239_2349493_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2349599_2350493_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2350627_2351848_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2351972_2352668_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2352620_2353913_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2354071_2354686_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|2354728_2355583_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2355584_2356202_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|2356212_2358636_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041675.1|2358696_2361123_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001300836.1|2361321_2361627_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2361734_2362445_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2362447_2363008_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2363042_2363384_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2363518_2363845_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_159373745.1|2364050_2365265_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.1e-46
WP_000836066.1|2365276_2366296_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_088895425.1|2366407_2367636_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_167738956.1|2367728_2367800_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000876958.1|2367819_2369100_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_000005552.1|2369134_2369386_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048342.1|2369458_2371930_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083297.1|2372022_2372214_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2372210_2372399_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001329848.1|2372798_2372963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2372966_2373185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2373344_2373500_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2373666_2374074_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2374157_2374388_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705358.1|2374371_2374893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054512.1|2374873_2375839_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_001151262.1|2375879_2376302_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001310834.1|2376298_2376655_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001333339.1|2377174_2378710_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
2376754:2376769	attR	GGATTATTTTTATGAA	NA	NA	NA	NA
WP_000612626.1|2378758_2379106_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2379102_2379507_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_072096395.1|2380231_2380450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000955178.1|2380424_2380607_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589005.1|2380784_2382098_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|2382534_2382867_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2383069_2383375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2383399_2383639_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2383638_2383926_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2383997_2384153_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2384369_2384621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2384687_2384966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265199.1|2384967_2386017_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_001047135.1|2386030_2386783_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2387060_2387150_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2387204_2387417_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2387717_2387933_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2388686_2388902_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2388906_2389218_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2389214_2389748_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2389744_2390242_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2390604_2390817_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2390827_2391016_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2391018_2391084_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2391163_2391319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2391490_2391664_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2391815_2392226_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2392283_2392517_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453611.1|2392905_2393451_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027259.1|2393425_2395351_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|2395347_2395554_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001349919.1|2395550_2397152_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
WP_000123218.1|2397132_2398452_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	9.6e-235
WP_001295978.1|2398461_2398794_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063277.1|2398850_2399876_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_089508102.1|2399878_2400244_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.1	2.0e-49
WP_000753007.1|2400255_2400609_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000975070.1|2400620_2401199_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|2401195_2401591_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|2401598_2402339_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479142.1|2402354_2402777_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_000459465.1|2402758_2403193_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_000840342.1|2403185_2405747_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.7	0.0e+00
WP_000847379.1|2405743_2406073_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152640.1|2406072_2406771_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.5e-133
WP_000194783.1|2406776_2407520_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090895.1|2407456_2408089_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_000515714.1|2408149_2411647_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.3	0.0e+00
WP_001230375.1|2411716_2412316_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_000279080.1|2412380_2415455_+	hypothetical protein	NA	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_000885611.1|2415454_2416030_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|2416127_2416718_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2417034_2417268_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2417336_2417450_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2418054_2419338_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527809.1|2419426_2420887_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
>prophage 4
NZ_CP026929	Escherichia coli strain CFS3246 chromosome, complete genome	4803456	3025207	3121489	4803456	terminase,plate,capsid,portal,holin,tail,lysis,tRNA,head,integrase,protease	Escherichia_phage(38.6%)	89	3047285:3047302	3116178:3116195
WP_000117881.1|3025207_3026608_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|3027210_3028299_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|3028483_3029674_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109486.1|3029895_3030543_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3030569_3031118_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925985.1|3031298_3033146_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572633.1|3033406_3037867_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|3037866_3038571_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|3038551_3039874_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001298300.1|3039870_3040656_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3040791_3041571_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436932.1|3041547_3042441_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011620.1|3042594_3043341_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3043337_3043520_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056538.1|3043571_3044804_-	winged helix DNA-binding protein YcaQ	NA	NA	NA	NA	NA
WP_000570539.1|3044840_3045827_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3045823_3047572_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
3047285:3047302	attL	CACCTTTCCTGATACCCA	NA	NA	NA	NA
WP_000705764.1|3047608_3049873_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3050080_3050365_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3050524_3052198_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3052308_3052992_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|3053164_3053929_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445231.1|3054097_3055381_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057138.1|3055451_3056540_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|3056738_3057431_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001295344.1|3057560_3059321_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|3059726_3060584_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3060638_3062921_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|3063239_3063458_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_061091564.1|3063539_3064703_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	8.6e-203
WP_061091565.1|3064702_3065182_-|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	99.4	9.6e-84
WP_089507904.1|3065196_3067644_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	98.2	0.0e+00
WP_000785970.1|3067636_3067756_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|3067788_3068064_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|3068120_3068639_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|3068651_3069842_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_157232626.1|3070105_3070201_+	hypothetical protein	NA	M1SNQ2	Escherichia_phage	77.4	2.7e-06
WP_089507902.1|3070172_3070583_-|tail	phage tail protein	tail	U5P0S4	Shigella_phage	78.9	1.6e-23
WP_159373749.1|3070582_3072394_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	83.0	1.3e-80
WP_001285309.1|3072390_3073002_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	96.6	1.3e-114
WP_021570153.1|3072994_3073903_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	5.7e-162
WP_000127163.1|3073907_3074255_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_021512561.1|3074251_3074887_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	5.5e-111
WP_001001786.1|3074953_3075406_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_021530423.1|3075398_3075866_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	1.1e-81
WP_089507898.1|3075955_3076399_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	4.9e-66
WP_021538486.1|3076386_3076812_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	96.5	1.2e-58
WP_001144101.1|3076826_3077324_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|3077323_3077605_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846409.1|3077608_3077812_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|3077811_3078321_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_024262840.1|3078420_3079164_-|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	98.8	6.2e-122
WP_001248555.1|3079167_3080241_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.2	3.3e-201
WP_001085954.1|3080299_3081154_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
WP_000156840.1|3081327_3083100_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_000038162.1|3083099_3084128_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
WP_001350078.1|3084186_3084759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000744812.1|3084751_3086185_-	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
WP_001572877.1|3087349_3089626_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.2	0.0e+00
WP_000027667.1|3089615_3089891_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113264.1|3089887_3090112_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_089507896.1|3090111_3090414_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	97.0	1.1e-45
WP_089507894.1|3090413_3090638_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	95.9	3.4e-31
WP_000217670.1|3090701_3091202_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001005162.1|3091198_3091369_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001389237.1|3091379_3091736_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001389238.1|3091844_3092144_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_000023390.1|3092237_3093233_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000067979.1|3093264_3094062_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_001190363.1|3094143_3094734_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242684.1|3094833_3095742_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918506.1|3095742_3097173_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109259.1|3097382_3098531_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165879.1|3098844_3099471_+	hydrolase	NA	NA	NA	NA	NA
WP_000534637.1|3099505_3100369_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|3100370_3100988_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|3100998_3103443_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|3103681_3104974_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3105064_3106408_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3106418_3107030_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|3107188_3111178_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3111312_3111807_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3112351_3113317_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043592.1|3113439_3115206_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
WP_001202175.1|3115206_3116928_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
3116178:3116195	attR	CACCTTTCCTGATACCCA	NA	NA	NA	NA
WP_001241678.1|3116969_3117674_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3117958_3118177_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3118861_3121138_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3121168_3121489_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 5
NZ_CP026929	Escherichia coli strain CFS3246 chromosome, complete genome	4803456	3742554	3802023	4803456	protease,transposase,plate,integrase	Enterobacteria_phage(25.0%)	48	3745852:3745868	3813726:3813742
WP_001193074.1|3742554_3744639_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_001180895.1|3744649_3747247_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
3745852:3745868	attL	GCTTCACCACCTCATTG	NA	NA	NA	NA
WP_001095587.1|3747423_3751029_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_001019648.1|3751074_3754716_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_000566901.1|3754727_3755330_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_085962535.1|3755326_3755929_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_001375319.1|3756343_3756682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001702943.1|3756651_3757206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920174.1|3758499_3759588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132879.1|3759565_3761272_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001375306.1|3761264_3762473_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000772656.1|3762714_3763923_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
WP_000893278.1|3764276_3765530_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|3765541_3766645_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749867.1|3766932_3767988_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
WP_000174677.1|3768026_3768428_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|3768485_3769730_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3769821_3770280_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|3770540_3771998_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001352051.1|3772054_3772612_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|3772523_3772790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|3773095_3773548_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|3773557_3773956_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|3773958_3774252_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3774303_3775359_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207552.1|3775429_3776215_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|3776159_3777899_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3778122_3778620_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|3778795_3779545_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|3779754_3780015_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001037613.1|3780869_3781073_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_001225679.1|3781228_3781969_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3781939_3782707_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3782912_3783491_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3783730_3786175_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3786217_3786691_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|3786844_3787615_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|3787655_3788792_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000008098.1|3789222_3789399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101841.1|3789395_3789614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508724.1|3789591_3793824_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_000103354.1|3793899_3796041_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3796250_3796769_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3797463_3797964_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3797998_3798223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3798273_3799749_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|3799755_3800169_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|3800172_3802023_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
3813726:3813742	attR	CAATGAGGTGGTGAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP026929	Escherichia coli strain CFS3246 chromosome, complete genome	4803456	4193722	4231857	4803456	holin,transposase,integrase	Staphylococcus_phage(22.22%)	28	4220440:4220456	4240538:4240554
WP_001254928.1|4193722_4194874_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_001293435.1|4195930_4197928_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_001375347.1|4197990_4199268_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145475.1|4199515_4200172_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001390362.1|4200229_4200334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296706.1|4200352_4200481_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001390361.1|4200571_4200853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295538.1|4201679_4202462_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|4202767_4203688_+	ribokinase	NA	NA	NA	NA	NA
WP_000998347.1|4203715_4205032_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107480.1|4205043_4206057_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_115205477.1|4206246_4207474_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.5e-176
WP_001446914.1|4207860_4208100_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.0	1.5e-13
WP_000345346.1|4208310_4209567_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000705931.1|4209579_4209867_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000916805.1|4209882_4210326_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000416153.1|4210596_4211628_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_001375333.1|4212978_4213413_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001352291.1|4214321_4214648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000228394.1|4214857_4215202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000981734.1|4215556_4216906_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102863.1|4216926_4217844_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_001041752.1|4217855_4219052_-	CoA transferase	NA	NA	NA	NA	NA
WP_000018562.1|4219288_4221202_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
4220440:4220456	attL	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
WP_000255944.1|4222235_4223258_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|4223257_4224037_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001254928.1|4225227_4226379_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_000772679.1|4230591_4231857_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.5	4.8e-74
4240538:4240554	attR	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
>prophage 1
NZ_CP026930	Escherichia coli strain CFS3246 plasmid pCFS3246-1, complete sequence	129225	1256	62590	129225	transposase,integrase,tRNA	Stx2-converting_phage(20.0%)	52	NA	NA
WP_001066937.1|1256_1997_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.6	3.5e-24
WP_063074630.1|2117_2279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032215349.1|2331_2682_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	63.2	1.3e-24
WP_000879139.1|2919_3795_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	30.2	7.5e-26
WP_000470771.1|4294_4537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000662184.1|4604_4880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032215364.1|6135_6372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032235482.1|6528_7062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000348879.1|9126_9657_-	GNAT family N-acetyltransferase	NA	A0A0M3ULL7	Bacillus_phage	26.1	8.9e-06
WP_000114669.1|9660_9930_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000592915.1|10779_11307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000737845.1|11299_11824_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000792596.1|11823_12825_-	protein FanF	NA	NA	NA	NA	NA
WP_001031857.1|12824_13511_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_001375165.1|13503_15888_-	PefC/AfrB family outer membrane usher protein	NA	NA	NA	NA	NA
WP_089508147.1|15921_16467_-	fimbrial protein	NA	NA	NA	NA	NA
WP_032215356.1|16609_16870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001375145.1|16982_17264_-	K99 fimbria transcriptional regulator FanA	NA	NA	NA	NA	NA
WP_000612552.1|19507_19855_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	97.4	3.1e-60
WP_159373759.1|20786_21938_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001189111.1|23099_24608_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032235557.1|26203_27001_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.6	7.3e-145
WP_001353651.1|28522_28741_-	heat-stable enterotoxin ST-I group a	NA	NA	NA	NA	NA
WP_001257942.1|30663_31422_+	solute-binding protein	NA	NA	NA	NA	NA
WP_000130970.1|32300_33158_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001375168.1|33150_33225_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083838.1|33470_33719_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001367749.1|34002_34152_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000504693.1|34515_34758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|35758_36436_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|36435_36783_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|36802_38374_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001375146.1|39181_39385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139319.1|39539_40097_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000868986.1|40199_41060_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000205750.1|41118_41865_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	5.1e-07
WP_001138082.1|46523_49409_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_001067845.1|50049_50754_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_001235713.1|51204_51762_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067845.1|51868_52573_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_000142451.1|52665_53013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080730.1|53141_53477_+	colicin 1A immunity protein	NA	NA	NA	NA	NA
WP_085452786.1|53498_53858_-	colicin	NA	NA	NA	NA	NA
WP_000421257.1|54678_54954_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001178089.1|54953_55238_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000027057.1|56180_57041_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067845.1|57240_57945_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_085959879.1|58232_59361_+|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_001082319.1|59468_60272_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|60271_61108_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000450532.1|61964_62192_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911314.1|62191_62590_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP026930	Escherichia coli strain CFS3246 plasmid pCFS3246-1, complete sequence	129225	73600	120527	129225	transposase,integrase,bacteriocin	Stx2-converting_phage(23.08%)	59	82806:82820	115193:115207
WP_088895425.1|73600_74829_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000821828.1|75020_76829_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000777698.1|76825_77464_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_000830183.1|77472_78465_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_001203720.1|78461_79094_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000099690.1|79090_79477_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001064244.1|79473_82101_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_001278689.1|82260_82482_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
WP_000809906.1|82616_83132_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
82806:82820	attL	CCGGGCAGCGGTAAA	NA	NA	NA	NA
WP_001038342.1|83128_83380_-	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_001352845.1|83391_83622_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_000002790.1|83575_84166_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_000146689.1|84155_85583_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_001230813.1|85582_86311_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399790.1|86297_86864_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012106.1|86885_87197_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000340282.1|87211_87577_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001352842.1|87619_87835_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000332520.1|87970_88618_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_001063020.1|88808_89192_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_165835419.1|89543_90134_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001234469.1|90430_91252_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000107535.1|91370_91658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077756203.1|91654_91858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|92235_92394_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001299721.1|92473_92662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276232.1|92673_93393_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845953.1|93389_93824_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001775124.1|93878_95837_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.1	3.5e-23
WP_000005990.1|95902_96136_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290841.1|96198_96738_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_032149780.1|96971_97160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046952204.1|97380_97572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046952203.1|97597_98161_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
WP_046952202.1|98207_99569_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|99620_99851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071556315.1|100364_100613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027519.1|100885_101077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271751.1|101073_101496_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_077632858.1|101542_101845_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274437.1|103211_103646_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|103659_103881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001775017.1|103881_104565_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	38.3	2.5e-29
WP_063074623.1|104641_104935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959884.1|105081_106044_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_000361384.1|106046_106397_+	protein stbB	NA	NA	NA	NA	NA
WP_001027529.1|106547_107060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282376.1|107500_109036_+|bacteriocin	pore-forming bacteriocin colicin B	bacteriocin	NA	NA	NA	NA
WP_000203268.1|109053_109581_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_000449473.1|109823_110639_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|110688_111042_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001164199.1|111214_111997_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_167738958.1|111998_112241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167738957.1|112162_112411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299364.1|113350_114028_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|114027_114375_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|114394_115966_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
115193:115207	attR	CCGGGCAGCGGTAAA	NA	NA	NA	NA
WP_089508174.1|116230_118285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|119298_120527_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
