The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023862	Listeria monocytogenes strain ScottA chromosome, complete genome	3030813	90284	133410	3030813	integrase,terminase,portal,plate,holin,tail	Listeria_phage(95.38%)	69	91359:91403	133510:133554
WP_003734164.1|90284_91241_+	NAD(P)-binding domain-containing protein	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.6	1.6e-29
91359:91403	attL	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
WP_003734959.1|91507_92710_-|integrase	site-specific integrase	integrase	A0A0B5CTW8	Listeria_phage	99.0	8.5e-222
WP_003734960.1|92775_93516_-	hypothetical protein	NA	A0A059T7X3	Listeria_phage	100.0	4.5e-133
WP_003727738.1|93537_94260_-	hypothetical protein	NA	A0A059T7P9	Listeria_phage	100.0	1.3e-105
WP_003727739.1|94275_94494_-	zinc-ribbon domain-containing protein	NA	A0A059T6E3	Listeria_phage	100.0	5.4e-34
WP_003727740.1|94516_95008_-	hypothetical protein	NA	A0A059T5E8	Listeria_phage	100.0	3.4e-92
WP_003727741.1|95040_95346_-	helix-turn-helix transcriptional regulator	NA	A0A059T669	Listeria_phage	100.0	6.4e-49
WP_003727742.1|95471_95714_+	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	100.0	1.7e-36
WP_003727743.1|95717_95984_+	hypothetical protein	NA	A0A059T7Q1	Listeria_phage	100.0	2.5e-41
WP_003735007.1|96208_96403_+	hypothetical protein	NA	A0A059T6E5	Listeria_phage	100.0	1.3e-26
WP_003735006.1|96414_96699_+	hypothetical protein	NA	A0A0B5D168	Listeria_phage	100.0	1.1e-47
WP_003727747.1|96724_97006_+	hypothetical protein	NA	A0A0B5CTX3	Listeria_phage	100.0	1.0e-40
WP_003727749.1|97191_97434_-	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	100.0	1.8e-38
WP_003743352.1|97497_98277_+	phage antirepressor Ant	NA	A0A059T6E7	Listeria_phage	100.0	3.5e-144
WP_003743354.1|98398_98923_+	hypothetical protein	NA	A0A059T5F0	Listeria_phage	100.0	1.7e-89
WP_003731816.1|98929_99115_+	helix-turn-helix domain-containing protein	NA	A0A059T674	Listeria_phage	100.0	1.1e-27
WP_003735035.1|99130_99319_+	hypothetical protein	NA	A0A0B5CU43	Listeria_phage	96.8	6.5e-28
WP_003734953.1|99621_99816_+	hypothetical protein	NA	A0A059T6E8	Listeria_phage	100.0	1.6e-29
WP_003734952.1|99812_100289_+	siphovirus Gp157 family protein	NA	A8ASN2	Listeria_phage	94.3	1.3e-56
WP_003743358.1|100294_100954_+	ERF family protein	NA	A8ASN3	Listeria_phage	95.0	1.4e-93
WP_003743360.1|100970_101942_+	DnaD domain protein	NA	A8ASN4	Listeria_phage	92.6	1.5e-163
WP_020830759.1|101938_102193_+	hypothetical protein	NA	Q8W5X5	Listeria_phage	91.5	7.4e-35
WP_003743364.1|102210_103188_+	DNA cytosine methyltransferase	NA	D2IZY5	Enterococcus_phage	40.2	8.3e-50
WP_003735028.1|103184_103379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003743367.1|103405_104011_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	77.6	3.8e-85
WP_003735032.1|104007_104187_+	hypothetical protein	NA	A0A059T5G0	Listeria_phage	93.2	3.5e-23
WP_003743369.1|104365_104869_+	hypothetical protein	NA	A0A0B5CYR4	Listeria_phage	44.8	9.3e-29
WP_003743371.1|104868_105570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003735015.1|105582_105852_+	hypothetical protein	NA	A0A059T7S7	Listeria_phage	89.5	5.8e-38
WP_003735014.1|105848_106034_+	hypothetical protein	NA	A0A059T5G1	Listeria_phage	98.4	1.2e-26
WP_003735013.1|106030_106321_+	hypothetical protein	NA	Q8W5X0	Listeria_phage	90.6	5.0e-43
WP_003743374.1|106320_106506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003743375.1|106506_106734_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	96.0	1.9e-34
WP_003743377.1|106744_107146_+	hypothetical protein	NA	A8ATZ6	Listeria_phage	83.5	1.3e-54
WP_003743379.1|107145_107628_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	90.0	2.4e-74
WP_003743380.1|107646_107838_+	hypothetical protein	NA	A8ASP6	Listeria_phage	95.2	8.9e-25
WP_031541233.1|107782_108187_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	94.0	5.4e-64
WP_003743384.1|108190_108574_+	DUF2481 domain-containing protein	NA	A8ASP8	Listeria_phage	96.9	2.0e-63
WP_003727776.1|108702_108867_+	hypothetical protein	NA	A8ASQ0	Listeria_phage	92.6	2.5e-20
WP_003743388.1|108885_109320_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	98.6	9.6e-75
WP_003727778.1|109579_110119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003743392.1|110164_110707_+|terminase	terminase small subunit	terminase	A8ASJ1	Listeria_phage	98.3	1.2e-90
WP_020830818.1|110675_112007_+|terminase	PBSX family phage terminase large subunit	terminase	A0A059T5E2	Listeria_phage	99.5	1.3e-263
WP_003743397.1|112019_113519_+|portal	phage portal protein	portal	A0A059T657	Listeria_phage	100.0	1.0e-277
WP_003734943.1|113524_114664_+	hypothetical protein	NA	A0A059T7W2	Listeria_phage	100.0	1.7e-208
WP_003734944.1|114742_115333_+	scaffold protein	NA	A0A059T7N8	Listeria_phage	100.0	2.5e-86
WP_003734945.1|115332_116334_+	hypothetical protein	NA	A0A059T6D4	Listeria_phage	100.0	7.4e-187
WP_003734946.1|116352_116748_+	hypothetical protein	NA	A0A059T5E3	Listeria_phage	100.0	5.1e-67
WP_003743399.1|116747_117110_+	hypothetical protein	NA	A0A059T658	Listeria_phage	100.0	8.3e-64
WP_003743401.1|117109_117448_+	hypothetical protein	NA	A0A059T7W4	Listeria_phage	100.0	2.9e-58
WP_003743402.1|117447_117855_+	hypothetical protein	NA	A0A059T7P0	Listeria_phage	100.0	2.4e-67
WP_003735047.1|117857_118295_+	hypothetical protein	NA	A0A059T6D6	Listeria_phage	100.0	2.5e-78
WP_074384949.1|118224_118557_+	Ig domain-containing protein	NA	A0A059T5E4	Listeria_phage	100.0	1.7e-42
WP_003743404.1|118609_119032_+	hypothetical protein	NA	A8ASK4	Listeria_phage	100.0	3.1e-70
WP_003743406.1|119037_119643_+	hypothetical protein	NA	Q9T1A8	Listeria_phage	99.0	3.7e-109
WP_003743408.1|119653_125020_+	tape measure protein	NA	A8ASK6	Listeria_phage	94.6	0.0e+00
WP_003743410.1|125016_125844_+|tail	phage tail family protein	tail	A8ASK7	Listeria_phage	100.0	2.4e-159
WP_003743412.1|125843_126881_+	hypothetical protein	NA	A8ASK8	Listeria_phage	100.0	2.0e-195
WP_003743413.1|126881_127907_+	hypothetical protein	NA	A8ASK9	Listeria_phage	92.1	8.7e-175
WP_003743414.1|127903_128983_+|plate	BppU family phage baseplate upper protein	plate	A8ASL0	Listeria_phage	97.5	2.2e-83
WP_031541230.1|128979_129258_+	hypothetical protein	NA	A8ATB3	Listeria_phage	56.8	1.3e-16
WP_003743418.1|129262_129421_+	hypothetical protein	NA	Q9T1A1	Listeria_phage	80.8	1.1e-12
WP_003733957.1|129460_129766_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	100.0	1.8e-43
WP_010991150.1|129765_130047_+|holin	phage holin	holin	A0A059T664	Listeria_phage	100.0	3.0e-45
WP_003743420.1|130046_130997_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A059T7X1	Listeria_phage	98.1	4.7e-183
WP_003743422.1|131370_132291_+	hypothetical protein	NA	A0A0H4U080	Erysipelothrix_phage	27.9	3.7e-15
WP_003743424.1|132328_132538_-	hypothetical protein	NA	R4IBK5	Listeria_phage	97.1	6.1e-27
WP_020830825.1|132973_133207_+	hypothetical protein	NA	A0A059T6E1	Listeria_phage	96.1	1.2e-36
WP_003734973.1|133203_133410_+	hypothetical protein	NA	A0A059T5E7	Listeria_phage	100.0	1.8e-31
133510:133554	attR	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
>prophage 2
NZ_CP023862	Listeria monocytogenes strain ScottA chromosome, complete genome	3030813	172918	179445	3030813	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|172918_173371_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|173376_173712_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003724946.1|173928_174357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728213.1|174368_174785_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	3.2e-19
WP_003728212.1|175064_175454_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003721744.1|175466_175979_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|176026_176329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|176370_176775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731178.1|176761_178630_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_003734720.1|178626_179445_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 3
NZ_CP023862	Listeria monocytogenes strain ScottA chromosome, complete genome	3030813	1270712	1377800	3030813	head,integrase,capsid,terminase,portal,protease,tRNA,plate,holin,tail	Listeria_phage(76.81%)	116	1274955:1274971	1326131:1326147
WP_003721619.1|1270712_1271765_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	1.3e-29
WP_003730983.1|1271764_1274173_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003721621.1|1274333_1275035_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-33
1274955:1274971	attL	ATTATTGAAATTAATAA	NA	NA	NA	NA
WP_003730984.1|1275048_1278459_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003724750.1|1278556_1279009_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003734678.1|1279024_1282225_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_003724752.1|1282328_1283003_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	3.4e-50
WP_012681263.1|1283040_1283967_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003740576.1|1284120_1284384_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003726937.1|1284383_1284926_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003734677.1|1285017_1286730_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.5	1.9e-17
WP_003734676.1|1286752_1289110_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723853.1|1289190_1289502_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
WP_003726544.1|1289577_1291389_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003734675.1|1291569_1292784_+	aspartate kinase	NA	NA	NA	NA	NA
WP_012681265.1|1292839_1293334_-	YslB family protein	NA	NA	NA	NA	NA
WP_003723856.1|1293481_1294282_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003726032.1|1294294_1295041_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_003726033.1|1295044_1295656_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_003726034.1|1295692_1296217_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003734674.1|1296502_1297657_-|integrase	site-specific integrase	integrase	Q8W5Y3	Listeria_phage	100.0	2.9e-219
WP_003734673.1|1297790_1298222_-	hypothetical protein	NA	Q8W5Y2	Listeria_phage	100.0	2.9e-71
WP_003734672.1|1298272_1298725_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	94.0	3.2e-81
WP_003734671.1|1298741_1299062_-	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	100.0	1.8e-54
WP_003734670.1|1299328_1299535_+	helix-turn-helix transcriptional regulator	NA	Q8W5X9	Listeria_phage	100.0	6.4e-29
WP_003734669.1|1299537_1299780_+	hypothetical protein	NA	Q8W5X8	Listeria_phage	100.0	8.3e-44
WP_003734668.1|1299782_1299968_+	hypothetical protein	NA	Q8W5X7	Listeria_phage	100.0	3.7e-28
WP_015970830.1|1300662_1300914_+	hypothetical protein	NA	Q8W5X5	Listeria_phage	100.0	1.1e-38
WP_015970831.1|1300932_1301223_+	hypothetical protein	NA	Q8W5X4	Listeria_phage	100.0	2.7e-49
WP_003743913.1|1301219_1302032_+	DNA adenine methylase	NA	Q8W5X3	Listeria_phage	100.0	7.6e-158
WP_003743915.1|1302028_1302634_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	100.0	9.2e-116
WP_003743918.1|1302793_1303162_+	hypothetical protein	NA	Q8W5X1	Listeria_phage	100.0	2.4e-66
WP_106482525.1|1303275_1303707_+	hypothetical protein	NA	Q8W5X0	Listeria_phage	100.0	6.4e-79
WP_015970832.1|1303703_1303997_+	hypothetical protein	NA	Q8W5W9	Listeria_phage	100.0	1.9e-50
WP_003743925.1|1304185_1304620_+	hypothetical protein	NA	Q8W5W7	Listeria_phage	100.0	4.8e-74
WP_015970833.1|1304616_1304892_+	hypothetical protein	NA	Q8W5W6	Listeria_phage	100.0	8.6e-45
WP_003743929.1|1304879_1305266_+	hypothetical protein	NA	Q8W5W5	Listeria_phage	100.0	2.3e-64
WP_009918381.1|1305266_1305689_+	hypothetical protein	NA	Q8W5W4	Listeria_phage	100.0	5.1e-73
WP_003743931.1|1305855_1306239_+	hypothetical protein	NA	Q8W5W2	Listeria_phage	100.0	1.5e-66
WP_003743933.1|1306240_1306720_+	siphovirus Gp157 family protein	NA	Q8W5W1	Listeria_phage	100.0	5.4e-79
WP_003743935.1|1306732_1307422_+	AAA family ATPase	NA	A0A059T7T3	Listeria_phage	100.0	2.6e-130
WP_015970834.1|1307485_1308742_+	DEAD/DEAH box helicase	NA	Q8W5V9	Listeria_phage	100.0	7.0e-243
WP_003743938.1|1308766_1309252_+	DUF669 domain-containing protein	NA	Q8W5V8	Listeria_phage	100.0	6.5e-88
WP_031541393.1|1309274_1311548_+	DNA primase	NA	Q8W5V7	Listeria_phage	99.9	0.0e+00
WP_003743942.1|1311835_1312156_+	VRR-NUC domain-containing protein	NA	Q8W5V6	Listeria_phage	100.0	1.8e-54
WP_003743944.1|1312425_1313067_+	DUF3310 domain-containing protein	NA	Q8W5V5	Listeria_phage	100.0	5.7e-124
WP_003743945.1|1313067_1313493_+	DUF722 domain-containing protein	NA	Q8W5V4	Listeria_phage	100.0	2.3e-73
WP_003734881.1|1314072_1314384_+	HNH endonuclease	NA	Q8W5V3	Listeria_phage	100.0	5.5e-56
WP_003734882.1|1314389_1314662_+	hypothetical protein	NA	Q8W5V2	Listeria_phage	100.0	2.1e-43
WP_003734883.1|1314766_1315126_+	hypothetical protein	NA	Q8W608	Listeria_phage	100.0	7.7e-62
WP_015970821.1|1315109_1316762_+|terminase	terminase large subunit	terminase	Q8W607	Listeria_phage	100.0	0.0e+00
WP_003743952.1|1316775_1317963_+|portal	phage portal protein	portal	Q8W606	Listeria_phage	100.0	7.6e-223
WP_003734886.1|1317940_1318687_+|protease	Clp protease ClpP	protease	Q8W605	Listeria_phage	100.0	2.7e-133
WP_003734887.1|1318683_1319856_+|capsid	phage major capsid protein	capsid	Q8W604	Listeria_phage	100.0	3.0e-187
WP_077411753.1|1319878_1319998_+	hypothetical protein	NA	Q858X0	Listeria_phage	100.0	1.7e-13
WP_003734888.1|1319984_1320278_+	hypothetical protein	NA	Q8W603	Listeria_phage	100.0	8.8e-48
WP_003734889.1|1320264_1320603_+|head	phage head closure protein	head	Q8W602	Listeria_phage	100.0	4.4e-59
WP_003734890.1|1320595_1321006_+	hypothetical protein	NA	Q8W601	Listeria_phage	100.0	2.3e-70
WP_003734891.1|1320995_1321418_+	hypothetical protein	NA	Q8W600	Listeria_phage	100.0	2.3e-73
WP_003734892.1|1321419_1321998_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	100.0	1.0e-103
WP_003734893.1|1322118_1322481_+	hypothetical protein	NA	Q8W5Z8	Listeria_phage	100.0	9.5e-60
WP_003743961.1|1322663_1325744_+|tail	tail tape measure protein	tail	Q8W5Z7	Listeria_phage	100.0	0.0e+00
WP_003734895.1|1325740_1326448_+	hypothetical protein	NA	Q8W5Z6	Listeria_phage	100.0	2.5e-136
1326131:1326147	attR	ATTATTGAAATTAATAA	NA	NA	NA	NA
WP_003743964.1|1326447_1328574_+	hypothetical protein	NA	Q8W5Z5	Listeria_phage	100.0	0.0e+00
WP_003743966.1|1328570_1329692_+|plate	BppU family phage baseplate upper protein	plate	Q8W5Z4	Listeria_phage	100.0	1.4e-181
WP_003743967.1|1329688_1330021_+	hypothetical protein	NA	Q8W5Z3	Listeria_phage	100.0	1.3e-55
WP_003743969.1|1330020_1330167_+	XkdX family protein	NA	Q8W5Z2	Listeria_phage	100.0	1.1e-19
WP_003743972.1|1330203_1330647_+	hypothetical protein	NA	Q8W5Z1	Listeria_phage	100.0	8.0e-77
WP_015970824.1|1330625_1331030_+	hypothetical protein	NA	Q8W5Z0	Listeria_phage	100.0	9.6e-53
WP_012582419.1|1331050_1331311_+|holin	phage holin	holin	Q8W5Y9	Listeria_phage	100.0	1.6e-40
WP_015970825.1|1331303_1332248_+	Ply protein	NA	Q8W5Y8	Listeria_phage	100.0	2.6e-181
WP_003743979.1|1332392_1333094_+	DUF3800 domain-containing protein	NA	A0A059T7P7	Listeria_phage	100.0	1.2e-130
WP_015970827.1|1333504_1333738_+	hypothetical protein	NA	Q8W5Y5	Listeria_phage	100.0	4.3e-37
WP_003726037.1|1334618_1335092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726038.1|1335197_1335560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014929056.1|1336227_1340358_+	LapB repeat-containing protein	NA	NA	NA	NA	NA
WP_003727539.1|1340480_1341839_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_003734528.1|1341881_1342475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726044.1|1342611_1343019_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_003734527.1|1343183_1343783_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	1.3e-29
WP_003726046.1|1343814_1344075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726047.1|1344198_1345611_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	4.9e-51
WP_003726048.1|1345635_1345899_+	DUF3116 domain-containing protein	NA	NA	NA	NA	NA
WP_003726049.1|1346066_1346543_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003726050.1|1346580_1346826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726051.1|1346822_1348028_-	MFS transporter	NA	NA	NA	NA	NA
WP_003726052.1|1348232_1348892_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003726053.1|1348931_1349126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726054.1|1349192_1350041_-	YitT family protein	NA	NA	NA	NA	NA
WP_003726055.1|1350659_1351373_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_003726056.1|1351403_1353050_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003727531.1|1353068_1354553_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003726723.1|1354670_1355132_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|1355170_1355635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003734526.1|1355823_1356738_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003734525.1|1356763_1358011_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.0	2.7e-106
WP_003734524.1|1357994_1358825_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.6e-46
WP_003734523.1|1358971_1360111_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1360190_1360586_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1360736_1360952_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|1361075_1361609_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003731300.1|1361624_1362290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727521.1|1362551_1363490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1363604_1364888_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1365072_1366332_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003726393.1|1366450_1367017_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003726394.1|1367051_1367621_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003727520.1|1367722_1368265_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003726396.1|1368274_1369138_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003727519.1|1369134_1369920_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.6	6.7e-26
WP_003727518.1|1370053_1370914_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003727517.1|1371186_1373265_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	5.4e-107
WP_003727516.1|1373327_1374632_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003731303.1|1374914_1375817_+	tyrosine recombinase XerC	NA	A0A142K7N4	Mycobacterium_phage	29.5	1.8e-14
WP_003724001.1|1375837_1376377_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003742062.1|1376390_1377800_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	1.3e-43
>prophage 4
NZ_CP023862	Listeria monocytogenes strain ScottA chromosome, complete genome	3030813	1908772	1917058	3030813		Synechococcus_phage(33.33%)	8	NA	NA
WP_003726209.1|1908772_1909339_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
WP_003726210.1|1909335_1910385_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003722245.1|1910403_1911831_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_003731570.1|1911815_1914035_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
WP_003734638.1|1914027_1914711_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1914714_1914960_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003734637.1|1914971_1915685_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	6.7e-41
WP_003726215.1|1915765_1917058_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 5
NZ_CP023862	Listeria monocytogenes strain ScottA chromosome, complete genome	3030813	2640791	2648636	3030813		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|2640791_2641763_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003734495.1|2641770_2642739_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|2642740_2643616_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003734494.1|2643723_2645454_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.3	5.6e-174
WP_003741152.1|2645495_2646557_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_003725411.1|2646573_2647557_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.1	4.0e-52
WP_003722610.1|2647676_2648636_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
