The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	151874	193667	4209045	capsid,tail,integrase,protease,plate,tRNA,holin,terminase,head,portal	Bacillus_phage(64.71%)	54	155238:155297	190973:191039
WP_046664349.1|151874_152744_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.2e-11
WP_029317183.1|152740_153538_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_159376595.1|153547_154291_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003241966.1|154452_154890_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004399691.1|154910_155303_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
155238:155297	attL	ATGAAAGAACGTAAAAAATACGGTCTTAAAGGCGCTCGTCGTGCACCTCAGTTCTCAAAA	NA	NA	NA	NA
WP_017695832.1|155392_156520_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	34.4	8.7e-51
WP_159376596.1|156562_156985_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	63.8	7.0e-46
WP_017695834.1|156995_157424_-	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	58.9	3.4e-40
WP_048407361.1|157695_157881_+	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	70.5	4.0e-14
WP_017695836.1|157886_158156_+	hypothetical protein	NA	S5MC08	Brevibacillus_phage	51.7	3.4e-22
WP_017695837.1|158294_158450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017695838.1|158508_158751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159376597.1|158775_159117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017695840.1|159174_159756_+	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	42.7	9.1e-28
WP_017695841.1|159733_160009_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	49.4	3.9e-21
WP_017695843.1|160202_160757_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	95.1	5.9e-93
WP_017695844.1|160760_161693_+	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	91.1	5.3e-155
WP_159376598.1|161692_162133_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	89.7	1.0e-71
WP_159376599.1|162193_164626_+	DNA primase	NA	D6R422	Bacillus_phage	80.9	0.0e+00
WP_108029294.1|164850_165222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108029295.1|165199_165637_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.2	9.4e-62
WP_108029296.1|165633_166173_+	nuclease	NA	Q9ZXC2	Bacillus_phage	91.1	2.7e-90
WP_159376600.1|166169_166340_+	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	65.1	3.0e-08
WP_159376601.1|166342_166858_+	hypothetical protein	NA	D6R425	Bacillus_phage	93.0	7.9e-92
WP_046159992.1|167111_167525_+	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	97.0	2.1e-63
WP_042975081.1|167894_168110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159376602.1|168106_168475_+	HNH endonuclease	NA	A0A1B0T6C5	Bacillus_phage	53.5	3.2e-31
WP_052719999.1|168544_168958_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_159376603.1|168954_170709_+|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	56.2	2.4e-193
WP_159376604.1|170720_171899_+|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	54.7	4.6e-111
WP_159377190.1|171891_172482_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	59.0	5.4e-52
WP_159376605.1|172478_173762_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	51.4	2.9e-87
WP_116363017.1|173742_174036_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J3M5	uncultured_Caudovirales_phage	51.4	1.9e-13
WP_159376606.1|173998_174343_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_116363015.1|174326_174737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017695870.1|174741_175125_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_159376607.1|175121_175754_+	hypothetical protein	NA	A0A1J0MFV0	Staphylococcus_phage	31.5	4.0e-13
WP_159376608.1|175753_176137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017695873.1|176163_176322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159377191.1|177699_180633_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	46.8	1.6e-56
WP_159376609.1|180637_181468_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_159376610.1|181480_183367_+	autolysin	NA	M5AC19	Bacillus_phage	25.6	5.3e-45
WP_159376611.1|183372_185268_+	teichoic acid biosynthesis protein	NA	A0A185AMX0	Staphylococcus_phage	27.5	7.5e-39
WP_159376612.1|185279_187082_+|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	47.2	3.2e-55
WP_159376613.1|187093_187459_+	hypothetical protein	NA	O64053	Bacillus_phage	40.5	4.7e-14
WP_041850135.1|187459_187645_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	45.7	4.4e-05
WP_046663946.1|187705_188128_+|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
WP_159376614.1|188169_189111_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	70.8	6.0e-98
WP_019260180.1|189215_189395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159376615.1|189453_190308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159377192.1|190351_190540_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	53.3	1.1e-11
WP_072173580.1|191497_192265_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
190973:191039	attR	ATGAAAGAACGTAAAAAATACGGTCTTAAAGGCGCTCGTCGTGCACCTCAGTTCTCAAAACGTTAAT	NA	NA	NA	NA
WP_159376616.1|192450_192894_+	DUF2521 family protein	NA	NA	NA	NA	NA
WP_015252979.1|192953_193667_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	A0A0N6W8I1	Bacillus_phage	30.0	8.3e-15
>prophage 2
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	565258	573921	4209045	integrase	Streptococcus_phage(37.5%)	13	567026:567041	573336:573351
WP_087614333.1|565258_566557_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	70.8	4.6e-165
WP_087614335.1|566578_566998_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	65.7	3.1e-46
567026:567041	attL	TTTTTTGTGTTTGTCT	NA	NA	NA	NA
WP_087614336.1|567064_568171_-|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	34.5	5.7e-39
WP_087614338.1|568183_568696_-	metallopeptidase ImmA	NA	NA	NA	NA	NA
WP_032730566.1|568692_569076_-	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	38.5	2.4e-13
WP_032730569.1|569349_569544_+	ICEBs1 excisionase	NA	NA	NA	NA	NA
WP_087614340.1|569540_569801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087614342.1|569854_570115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144453637.1|570320_570425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087614343.1|570486_570867_+	helicase processivity factor HelP	NA	A0A1S5SF38	Streptococcus_phage	37.0	4.9e-06
WP_087614345.1|570902_572345_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	50.8	9.5e-119
WP_087614347.1|572337_573396_+	DNA relaxase NicK	NA	A0A1S5SEX3	Streptococcus_phage	41.6	2.2e-64
573336:573351	attR	AGACAAACACAAAAAA	NA	NA	NA	NA
WP_014478910.1|573669_573921_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	55.7	6.9e-17
>prophage 3
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	729012	737378	4209045		Synechococcus_phage(50.0%)	8	NA	NA
WP_159376672.1|729012_730308_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.4	1.3e-18
WP_041337795.1|730381_731107_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	7.0e-46
WP_003219409.1|731099_731354_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014663062.1|731350_732034_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_046160142.1|732017_734246_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	2.2e-159
WP_046160143.1|734221_735652_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.1	2.0e-52
WP_003233945.1|735753_736794_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	2.8e-64
WP_021481301.1|736790_737378_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.4	9.1e-28
>prophage 4
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	1296192	1330137	4209045	coat,tRNA	Bacillus_phage(66.67%)	38	NA	NA
WP_080478405.1|1296192_1296876_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_003244982.1|1296969_1297416_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_003239243.1|1297543_1298032_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_014479466.1|1298183_1298666_-|coat	spore coat protein X	coat	NA	NA	NA	NA
WP_014479467.1|1298750_1299071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479468.1|1299110_1299497_-|coat	spore coat protein V	coat	NA	NA	NA	NA
WP_014476457.1|1299656_1300013_+	sporulation protein YjcA	NA	NA	NA	NA	NA
WP_014479470.1|1300294_1300501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232872.1|1300582_1300732_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_014479471.1|1300864_1301119_+	sporulation-specific transcription regulator SopVIF	NA	NA	NA	NA	NA
WP_021479533.1|1301192_1303472_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.9	3.5e-91
WP_003232866.1|1303588_1303843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245407.1|1303915_1304338_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003232861.1|1304341_1304857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128753562.1|1304893_1305616_-	esterase family protein	NA	NA	NA	NA	NA
WP_003232857.1|1305971_1307093_+	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	3.7e-17
WP_014479474.1|1307085_1308258_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_014479475.1|1308290_1308836_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_159376765.1|1308905_1310096_-	DUF819 family protein	NA	NA	NA	NA	NA
WP_159376766.1|1310474_1310777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376767.1|1310830_1311139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232847.1|1311172_1311565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049140734.1|1311576_1313355_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	58.0	2.0e-126
WP_072176388.1|1313851_1314970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080375753.1|1314905_1315274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159376768.1|1315273_1315960_+	acetylglutamate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_072174183.1|1317203_1317602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232839.1|1319016_1319364_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_015252320.1|1319925_1321872_+	mannose transport/utilization transcriptional regulator ManR	NA	NA	NA	NA	NA
WP_015252319.1|1322020_1323973_+	PTS mannose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_003232833.1|1323987_1324935_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_015252318.1|1325104_1325587_+	YjdF family protein	NA	NA	NA	NA	NA
WP_015252317.1|1325632_1326139_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009967031.1|1326357_1326753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015252316.1|1326981_1327461_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_041344716.1|1327500_1327695_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_003232822.1|1327827_1328157_-	YjdJ family protein	NA	NA	NA	NA	NA
WP_003245601.1|1329888_1330137_-|coat	spore coat protein CotT	coat	NA	NA	NA	NA
>prophage 5
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	1363686	1396019	4209045	tail,plate,terminase,holin,portal	Bacillus_phage(30.3%)	45	NA	NA
WP_003232739.1|1363686_1364958_+	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
WP_015252291.1|1365101_1366238_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
WP_003245487.1|1366227_1366362_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_003232731.1|1366391_1366649_-	YciI family protein	NA	NA	NA	NA	NA
WP_159376776.1|1366769_1367723_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
WP_014479546.1|1367762_1368140_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	7.9e-17
WP_038828723.1|1368244_1368847_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.7	2.0e-46
WP_003245071.1|1368923_1369760_+	manganese catalase	NA	NA	NA	NA	NA
WP_003232721.1|1369816_1370413_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|1370575_1370917_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_021479481.1|1371095_1371275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021479480.1|1371261_1372098_+	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	27.8	3.9e-24
WP_015252287.1|1371997_1372798_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.1e-60
WP_003245588.1|1372797_1372965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021479479.1|1373049_1373400_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_021479478.1|1373396_1373603_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	7.1e-12
WP_021479477.1|1373718_1374228_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	8.5e-22
WP_049140762.1|1374345_1375143_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	50.2	4.7e-59
WP_003232697.1|1375139_1376441_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
WP_032725514.1|1376444_1377932_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_003245836.1|1377951_1378779_+	phage-like element PBSX protein XkdF	NA	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
WP_003232690.1|1378804_1379740_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_021479474.1|1379761_1380145_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	41.1	3.7e-14
WP_003232682.1|1380141_1380498_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_124048334.1|1380494_1380980_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.4	6.2e-38
WP_003232680.1|1380992_1381433_+	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
WP_003232679.1|1381436_1381655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124048335.1|1381651_1383052_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	39.3	1.4e-77
WP_003232677.1|1383053_1383497_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003232676.1|1383588_1384035_+	phage-like element PBSX protein XkdN	NA	A0A249XXA9	Clostridium_phage	33.6	7.5e-14
WP_003239113.1|1384064_1384214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159377201.1|1384215_1388094_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	43.8	3.3e-41
WP_029317672.1|1388086_1388746_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	34.2	3.7e-25
WP_003245730.1|1388761_1389739_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_046160310.1|1389738_1390005_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	35.2	3.8e-05
WP_014663657.1|1390062_1390488_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	37.3	6.6e-12
WP_124048337.1|1390480_1391527_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
WP_015483131.1|1391510_1392089_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	5.1e-15
WP_003232665.1|1392085_1392358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124048338.1|1392360_1393836_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	41.0	2.4e-40
WP_072174134.1|1393853_1394315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080375511.1|1394304_1394496_+|portal	phage portal protein	portal	A0A2H4JAA1	uncultured_Caudovirales_phage	61.3	8.9e-17
WP_072174140.1|1394567_1394837_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	68.2	6.7e-26
WP_003232653.1|1394849_1395113_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	4.7e-24
WP_021479459.1|1395125_1396019_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.7	1.8e-83
>prophage 6
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	1841195	1847754	4209045		Bacillus_phage(50.0%)	6	NA	NA
WP_159376809.1|1841195_1841588_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	3.2e-29
WP_014479842.1|1841547_1843650_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_072174042.1|1843667_1844657_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.1e-155
WP_159376810.1|1844706_1845327_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.8	1.9e-47
WP_032725747.1|1845390_1846158_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	7.0e-52
WP_159376811.1|1846785_1847754_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.8	1.4e-52
>prophage 7
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	2032251	2040278	4209045	holin	Bacillus_phage(85.71%)	9	NA	NA
WP_046160543.1|2032251_2032545_-	YolD-like family protein	NA	O64030	Bacillus_phage	97.9	9.7e-47
WP_033881859.1|2033039_2033399_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	98.3	2.2e-61
WP_072592542.1|2033658_2033742_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_046160484.1|2034600_2035179_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	91.1	1.5e-99
WP_046160485.1|2035234_2035693_-	SMI1 / KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	82.2	9.2e-68
WP_003231326.1|2035785_2036244_-	type II toxin-antitoxin system antitoxin YobK	NA	NA	NA	NA	NA
WP_014479999.1|2036253_2038056_-	type II toxin-antitoxin system toxin ribonuclease YobL	NA	A0A1P8CWI7	Bacillus_phage	87.0	1.3e-218
WP_046160544.1|2038156_2038714_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	93.5	8.5e-100
WP_125121259.1|2038841_2040278_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.3	1.5e-07
>prophage 8
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	2101257	2200338	4209045	integrase	Bacillus_phage(96.55%)	152	2112522:2112538	2208031:2208047
WP_003231154.1|2101257_2102010_+	hypothetical protein	NA	A0A1P8CX59	Bacillus_phage	97.2	1.3e-143
WP_003231152.1|2102250_2102838_-	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	95.9	4.9e-106
WP_026009816.1|2102912_2103155_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	97.5	2.1e-39
WP_080010581.1|2103156_2103342_-	hypothetical protein	NA	O64193	Bacillus_phage	91.8	4.3e-24
WP_159376844.1|2103392_2103560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064814932.1|2103556_2103730_-	hypothetical protein	NA	O64190	Bacillus_phage	91.2	1.2e-20
WP_159376845.1|2103733_2104279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159377204.1|2104259_2104592_-	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	57.7	6.1e-29
WP_159376846.1|2104671_2105079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033884584.1|2105071_2105224_-	hypothetical protein	NA	A0A1P8CX49	Bacillus_phage	97.8	1.0e-15
WP_009967449.1|2105260_2105392_-	rubrerythrin family protein	NA	A0A1P8CX61	Bacillus_phage	100.0	2.6e-20
WP_159376847.1|2105427_2105682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376848.1|2105727_2106057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967454.1|2106227_2106446_+	acid-soluble spore protein SspC	NA	Q77YX0	Bacillus_phage	100.0	5.6e-31
WP_159376849.1|2106773_2107298_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	52.5	7.4e-37
WP_159376850.1|2107436_2107790_-	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	63.2	4.8e-32
WP_003231132.1|2108278_2109118_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	95.0	2.7e-158
WP_003231129.1|2109193_2109799_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_080010577.1|2109807_2110149_-	hypothetical protein	NA	O64181	Bacillus_phage	99.1	1.9e-54
WP_003231127.1|2110295_2110586_-	hypothetical protein	NA	O64180	Bacillus_phage	95.8	1.5e-44
WP_003231126.1|2110590_2110758_-	hypothetical protein	NA	A0A1P8CX64	Bacillus_phage	83.6	4.4e-20
WP_159376851.1|2110912_2111527_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003231121.1|2111620_2112049_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	92.3	8.9e-73
WP_159376852.1|2112099_2112342_-	thioredoxin	NA	A0A1P8CX24	Bacillus_phage	92.5	2.4e-35
WP_159376853.1|2112338_2113343_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	80.7	8.0e-149
2112522:2112538	attL	GTTTAATGCTTTATTTG	NA	NA	NA	NA
WP_019712228.1|2113460_2113892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159376854.1|2113948_2117203_-	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	99.2	0.0e+00
WP_069322652.1|2117165_2117561_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	94.7	5.3e-64
WP_032721808.1|2117560_2117908_-	hypothetical protein	NA	A0A1P8CX44	Bacillus_phage	55.0	3.3e-25
WP_019712232.1|2117959_2118205_-	hypothetical protein	NA	O64168	Bacillus_phage	67.5	2.6e-08
WP_019712233.1|2118223_2118592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019712234.1|2118637_2119060_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	82.9	4.1e-62
WP_003231106.1|2119072_2119393_-	hypothetical protein	NA	A0A1P8CX20	Bacillus_phage	99.1	3.3e-56
WP_003231102.1|2119712_2119919_-	hypothetical protein	NA	A0A1P8CX41	Bacillus_phage	51.9	2.4e-07
WP_003231101.1|2119974_2120169_-	hypothetical protein	NA	O64162	Bacillus_phage	95.3	9.3e-30
WP_019712336.1|2120319_2120514_-	hypothetical protein	NA	O64162	Bacillus_phage	95.7	1.4e-17
WP_019712335.1|2120504_2121053_-	hypothetical protein	NA	A0A223LD99	Bacillus_phage	60.2	2.4e-54
WP_014664033.1|2121183_2121309_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_159376855.1|2121419_2121632_-	hypothetical protein	NA	O64159	Bacillus_phage	87.1	1.7e-29
WP_159376856.1|2121910_2122669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010331048.1|2122856_2123054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069322662.1|2123068_2123296_-	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	90.7	2.0e-31
WP_061891141.1|2123335_2123701_-	hypothetical protein	NA	O64156	Bacillus_phage	97.5	3.5e-62
WP_003231092.1|2123703_2123922_-	hypothetical protein	NA	A0A1P8CX26	Bacillus_phage	98.6	7.3e-31
WP_159376857.1|2123965_2124421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106294053.1|2124498_2124846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069322666.1|2124885_2125383_-	deoxynucleoside kinase	NA	A0A1P8CX28	Bacillus_phage	90.9	4.6e-81
WP_069322667.1|2125382_2125538_-	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	94.1	2.8e-21
WP_019712328.1|2125530_2125746_-	hypothetical protein	NA	O64150	Bacillus_phage	98.6	3.0e-37
WP_041336515.1|2125777_2125975_-	hypothetical protein	NA	O64149	Bacillus_phage	96.9	2.1e-29
WP_159376858.1|2125975_2126161_-	hypothetical protein	NA	O64148	Bacillus_phage	93.9	1.2e-18
WP_159377205.1|2126278_2127001_-	hypothetical protein	NA	O64147	Bacillus_phage	84.2	8.7e-105
WP_159376859.1|2127029_2130947_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	96.3	0.0e+00
WP_159376860.1|2130959_2132690_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	98.4	0.0e+00
WP_101502261.1|2132689_2133826_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	99.2	1.1e-223
WP_101502260.1|2133841_2135356_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	98.8	1.3e-283
WP_101502259.1|2135370_2135841_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	97.4	5.9e-86
WP_004399537.1|2135883_2136855_-	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	100.0	1.7e-180
WP_101502258.1|2136937_2137852_-	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	90.1	2.8e-156
WP_033885449.1|2137873_2138245_-	hypothetical protein	NA	O64139	Bacillus_phage	96.7	3.2e-63
WP_033885452.1|2138418_2138733_-	SPBc2 prophage-derived stress response protein SCP1	NA	NA	NA	NA	NA
WP_004399313.1|2138809_2139190_-	hypothetical protein	NA	O64137	Bacillus_phage	100.0	3.8e-67
WP_019712320.1|2139252_2139549_-	hypothetical protein	NA	O64136	Bacillus_phage	99.0	3.1e-48
WP_159376861.1|2139636_2141397_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	99.8	0.0e+00
WP_086343966.1|2141393_2142218_-	gamma-polyglutamate hydrolase PghZ	NA	O64134	Bacillus_phage	98.9	9.5e-148
WP_159376862.1|2143572_2143806_-	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	90.3	4.6e-31
WP_159376863.1|2143876_2144551_+	hypothetical protein	NA	A0A1P8CX02	Bacillus_phage	97.9	2.2e-78
WP_159376864.1|2144620_2145433_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	93.7	3.6e-147
WP_159376865.1|2145498_2145912_-	hypothetical protein	NA	A0A1P8CWZ8	Bacillus_phage	90.5	1.7e-68
WP_128740434.1|2146159_2146549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128740435.1|2146526_2147090_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	51.1	3.8e-39
WP_159376866.1|2147126_2147528_-	hypothetical protein	NA	K4JWE2	Caulobacter_phage	39.1	4.1e-19
WP_101502251.1|2147651_2148026_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	96.8	5.4e-58
WP_101502479.1|2148041_2148263_-	hypothetical protein	NA	O64123	Bacillus_phage	86.1	1.0e-27
WP_159376867.1|2148461_2148740_+	hypothetical protein	NA	O64122	Bacillus_phage	87.0	1.9e-39
WP_124058922.1|2148936_2149119_-	hypothetical protein	NA	O64120	Bacillus_phage	100.0	1.3e-28
WP_159376868.1|2149848_2150100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399295.1|2150134_2150392_-	hypothetical protein	NA	O64116	Bacillus_phage	100.0	3.0e-44
WP_019712303.1|2150436_2150640_-	hypothetical protein	NA	O64115	Bacillus_phage	98.5	2.9e-34
WP_019712302.1|2150648_2150813_-	hypothetical protein	NA	O64114	Bacillus_phage	98.1	2.2e-24
WP_019712301.1|2151059_2151434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159376869.1|2151541_2151778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376870.1|2152059_2152371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376871.1|2152367_2152796_-	hypothetical protein	NA	M4ZRL6	Bacillus_phage	51.7	3.9e-28
WP_159376872.1|2153373_2153568_-	hypothetical protein	NA	O64105	Bacillus_phage	96.9	9.7e-27
WP_010330351.1|2153685_2153883_-	hypothetical protein	NA	O64104	Bacillus_phage	96.9	1.2e-27
WP_041336980.1|2153955_2154174_-	hypothetical protein	NA	O64103	Bacillus_phage	97.2	3.3e-31
WP_004399410.1|2154356_2154581_+	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	100.0	1.9e-34
WP_003231032.1|2154769_2155747_-	hypothetical protein	NA	O64101	Bacillus_phage	99.7	4.0e-177
WP_159376873.1|2155770_2157153_-	hypothetical protein	NA	O64100	Bacillus_phage	98.7	4.5e-259
WP_019712297.1|2157259_2158336_-|integrase	site-specific integrase	integrase	O64099	Bacillus_phage	99.7	2.0e-198
WP_019712296.1|2158325_2158538_-	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	95.7	1.6e-27
WP_114168596.1|2158586_2158904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019712294.1|2158906_2159107_-	hypothetical protein	NA	O64096	Bacillus_phage	98.5	3.4e-27
WP_009967508.1|2159434_2159560_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_019712293.1|2159573_2160734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376874.1|2160875_2161208_-	hypothetical protein	NA	A0A1P8CWV8	Bacillus_phage	93.6	2.2e-50
WP_159376875.1|2161257_2161953_-	hypothetical protein	NA	A0A1P8CWW4	Bacillus_phage	87.4	3.3e-109
WP_159376876.1|2161957_2162653_-	hypothetical protein	NA	A0A1P8CWW3	Bacillus_phage	98.7	4.1e-128
WP_159377206.1|2162709_2162832_-	hypothetical protein	NA	O64090	Bacillus_phage	97.5	9.7e-17
WP_159376877.1|2162851_2163067_-	hypothetical protein	NA	O64089	Bacillus_phage	87.3	1.7e-27
WP_019712287.1|2163392_2163572_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	98.3	1.2e-28
WP_041906985.1|2163683_2163914_+	membrane protein	NA	NA	NA	NA	NA
WP_159376878.1|2163921_2164317_-	hypothetical protein	NA	O64087	Bacillus_phage	78.6	3.6e-44
WP_046160540.1|2164366_2164720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376840.1|2164838_2165480_-	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_046160477.1|2165971_2166409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160541.1|2166499_2166883_-	membrane protein	NA	O64087	Bacillus_phage	34.2	4.0e-08
WP_159376879.1|2166980_2167925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376880.1|2168281_2168446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376881.1|2168482_2168842_-	hypothetical protein	NA	F8WPK8	Bacillus_phage	67.9	2.4e-39
WP_159376882.1|2168888_2169143_-	hypothetical protein	NA	A0A088C4P6	Shewanella_sp._phage	44.2	4.1e-09
WP_159376883.1|2169185_2169407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376884.1|2169403_2169856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061891096.1|2170185_2171403_-	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	82.9	5.4e-200
WP_003230987.1|2172384_2172573_-	hypothetical protein	NA	O64081	Bacillus_phage	96.8	9.7e-24
WP_159376885.1|2172617_2172869_-	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	95.8	3.2e-30
WP_019712271.1|2172887_2173064_-	hypothetical protein	NA	O64080	Bacillus_phage	94.9	2.6e-10
WP_072692657.1|2174017_2174212_+	hypothetical protein	NA	O64077	Bacillus_phage	95.3	8.7e-28
WP_159376886.1|2174251_2176129_+	hypothetical protein	NA	A0A1P8CWS8	Bacillus_phage	97.8	0.0e+00
WP_061891092.1|2176310_2177213_+	GIY-YIG nuclease family protein	NA	G3MAX5	Bacillus_virus	35.5	1.8e-06
WP_159376887.1|2177433_2178060_+	hypothetical protein	NA	O64076	Bacillus_phage	97.1	1.5e-113
WP_004399274.1|2178304_2178583_+	HU-related DNA-binding protein HupN	NA	A0A1P8CWT5	Bacillus_phage	76.9	1.2e-30
WP_159376888.1|2179142_2179313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032721643.1|2179965_2180145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010328101.1|2180417_2180609_+	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	100.0	1.9e-27
WP_159376889.1|2180621_2181839_+	hypothetical protein	NA	A0A1P8CWS1	Bacillus_phage	99.8	5.0e-230
WP_004399334.1|2181872_2182283_-	hypothetical protein	NA	A0A1P8CWT0	Bacillus_phage	100.0	8.8e-70
WP_071580924.1|2182435_2182765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019712264.1|2182803_2183328_+	hypothetical protein	NA	U5J9P3	Bacillus_phage	38.4	5.7e-21
WP_019712263.1|2183430_2184351_+	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	99.7	2.1e-175
WP_159376890.1|2184337_2186107_+	hypothetical protein	NA	O64069	Bacillus_phage	99.7	0.0e+00
WP_159376891.1|2186124_2187645_+	hypothetical protein	NA	O64068	Bacillus_phage	97.8	4.8e-278
WP_159376892.1|2187675_2189112_+	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	90.0	4.5e-238
WP_010328108.1|2189136_2189673_+	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	99.4	1.4e-94
WP_159376893.1|2189711_2190728_+	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	99.4	1.1e-185
WP_019712890.1|2190763_2191234_+	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	99.4	1.1e-81
WP_041054460.1|2191248_2191644_+	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	97.7	1.8e-67
WP_159376894.1|2191640_2191895_+	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	97.6	1.9e-38
WP_144460152.1|2191878_2192529_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	99.5	1.6e-121
WP_072183387.1|2192525_2193032_+	hypothetical protein	NA	O64060	Bacillus_phage	99.4	1.3e-91
WP_003230954.1|2193028_2193739_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	100.0	1.8e-131
WP_068947508.1|2193781_2194579_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	99.6	1.3e-90
WP_159377207.1|2194596_2195208_+	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	83.3	6.3e-64
WP_009967521.1|2195207_2195435_+	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	100.0	6.4e-38
WP_128740486.1|2195498_2195855_+	hypothetical protein	NA	O64055	Bacillus_phage	88.1	5.0e-53
WP_128740487.1|2195854_2197273_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	60.0	6.7e-08
WP_101502382.1|2197279_2198005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376895.1|2198016_2198256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128740489.1|2198413_2198914_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	94.6	3.2e-82
WP_128740490.1|2198897_2199317_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	88.5	4.3e-64
WP_159376896.1|2199330_2200338_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H3V0P2	Geobacillus_virus	66.0	5.8e-123
2208031:2208047	attR	CAAATAAAGCATTAAAC	NA	NA	NA	NA
>prophage 9
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	2210358	2231315	4209045	holin	Bacillus_phage(100.0%)	24	NA	NA
WP_159376899.1|2210358_2213001_+	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	95.8	0.0e+00
WP_159377208.1|2213016_2213835_+	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	67.9	4.6e-102
WP_159376900.1|2215648_2216038_+	hypothetical protein	NA	O64053	Bacillus_phage	45.3	2.1e-20
WP_159376901.1|2216038_2216188_+	XkdX family protein	NA	NA	NA	NA	NA
WP_087961793.1|2216410_2217514_+	N-acetylmuramoyl-L-alanine amidase BlyA	NA	O64040	Bacillus_phage	95.4	1.2e-177
WP_159376902.1|2217629_2218022_+	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	97.7	4.2e-61
WP_159376903.1|2218042_2218294_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	96.4	6.0e-37
WP_159376904.1|2218448_2219564_+	response regulator aspartate phosphatase RapK	NA	D6R410	Bacillus_phage	49.5	2.3e-96
WP_004399440.1|2219560_2219683_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_159376905.1|2219737_2220988_-	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	96.9	1.7e-233
WP_069322722.1|2220980_2221313_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	95.5	4.6e-53
WP_159376906.1|2221486_2221822_+	hypothetical protein	NA	O64029	Bacillus_phage	99.1	8.0e-53
WP_019712874.1|2221864_2222221_-	hypothetical protein	NA	O64028	Bacillus_phage	98.3	7.2e-60
WP_159376907.1|2222226_2222694_-	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	98.1	3.3e-81
WP_009967548.1|2222924_2223041_+	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	100.0	9.8e-11
WP_004399156.1|2223318_2223852_-	GNAT family N-acetyltransferase	NA	O64026	Bacillus_phage	100.0	6.2e-100
WP_004399123.1|2223887_2224466_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	100.0	9.4e-110
WP_003246188.1|2224529_2225027_-	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	100.0	1.9e-95
WP_004398855.1|2225035_2226751_-	ribonuclease	NA	O64023	Bacillus_phage	99.8	1.4e-302
WP_159376908.1|2226891_2227425_-	SMI1/KNR4 family protein	NA	A0A1P8CWM2	Bacillus_phage	92.6	6.2e-07
WP_159376909.1|2227509_2227761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376910.1|2227941_2228832_+	endonuclease YokF	NA	O64020	Bacillus_phage	94.9	2.1e-108
WP_003230849.1|2228956_2229490_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	99.4	5.1e-94
WP_003230847.1|2229740_2231315_-	recombinase family protein	NA	A0A1P8CWN4	Bacillus_phage	97.5	9.9e-279
>prophage 10
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	2285834	2308585	4209045	coat,tail,transposase,portal	Bacillus_phage(57.14%)	19	NA	NA
WP_159376923.1|2285834_2292638_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	64.3	0.0e+00
WP_159376924.1|2292724_2293039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376925.1|2293048_2293357_-	hypothetical protein	NA	A0A0A7RTF6	Clostridium_phage	36.4	2.0e-05
WP_159376926.1|2293343_2293490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376927.1|2293548_2294379_-|coat	P22 coat protein - protein 5 domain protein	coat	E5DV53	Deep-sea_thermophilic_phage	42.4	2.2e-51
WP_159376928.1|2294407_2295007_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	47.6	5.1e-34
WP_159377209.1|2295119_2296436_-|portal	phage portal protein	portal	I1TJV4	Clostridium_phage	31.3	9.2e-44
WP_159377210.1|2296460_2298218_-	hypothetical protein	NA	A0A1V0DZW7	Clostridioides_phage	47.0	4.2e-145
WP_014417461.1|2298569_2299133_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	50.5	3.7e-42
WP_159376929.1|2299149_2299557_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159376930.1|2299575_2300022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376931.1|2300021_2300381_-	hypothetical protein	NA	A0A140HLR7	Bacillus_phage	77.6	8.3e-48
WP_159376932.1|2300373_2300868_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	43.2	1.1e-29
WP_159376933.1|2300882_2301020_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	71.4	3.4e-10
WP_159376934.1|2301020_2301302_-	hypothetical protein	NA	O64053	Bacillus_phage	51.6	6.3e-19
WP_159376935.1|2302919_2303702_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	52.9	6.2e-40
WP_159376936.1|2303730_2304441_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	41.5	9.6e-48
WP_017695715.1|2304709_2304895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159376937.1|2305678_2308585_-	hypothetical protein	NA	O64076	Bacillus_phage	46.7	1.3e-223
>prophage 11
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	2419559	2425655	4209045		Staphylococcus_phage(66.67%)	8	NA	NA
WP_014480158.1|2419559_2420153_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.6e-14
WP_014477220.1|2420142_2420898_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_032726064.1|2421178_2421703_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|2421716_2422091_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|2422203_2422668_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_038828558.1|2422700_2423897_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_014480161.1|2423911_2424559_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
WP_041849980.1|2424569_2425655_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	6.6e-56
>prophage 12
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	2756272	2809744	4209045	coat,tRNA,protease	uncultured_Mediterranean_phage(12.5%)	55	NA	NA
WP_003229725.1|2756272_2757418_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_003229723.1|2757444_2758473_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003222669.1|2758502_2758703_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003229718.1|2758695_2759700_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_003229717.1|2759710_2760316_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003229715.1|2760454_2760967_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_015483512.1|2761014_2762322_-	MFS transporter	NA	NA	NA	NA	NA
WP_124048044.1|2762392_2763418_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_024572252.1|2763655_2764303_+	serine/threonine protein kinase	NA	A0A2R3ZQF2	Marseillevirus	26.3	5.4e-05
WP_003229707.1|2764348_2764471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159377211.1|2764576_2765002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159376978.1|2765311_2766766_+	amino acid carrier protein	NA	NA	NA	NA	NA
WP_159377212.1|2766806_2767529_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038829633.1|2767631_2768228_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_124048042.1|2768375_2769539_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_032726311.1|2769655_2770762_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_072173584.1|2770748_2771618_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_103803777.1|2771571_2773167_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_070547604.1|2773269_2774457_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.6	1.3e-33
WP_004398582.1|2774416_2774959_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_004398512.1|2774982_2775840_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|2775856_2776300_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003229675.1|2776360_2777647_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_032726318.1|2777680_2778259_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_159376979.1|2778352_2778460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|2778580_2778865_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|2778877_2779216_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|2779218_2779527_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_004398649.1|2779673_2780540_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_085187393.1|2780532_2781327_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_004398624.1|2781475_2782282_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|2782283_2782964_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|2783016_2783535_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003222609.1|2783531_2784404_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|2784434_2785448_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_021480240.1|2785539_2786235_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004398496.1|2786271_2786841_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_021480241.1|2786993_2787992_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_159376980.1|2788125_2788872_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_043856952.1|2789013_2790306_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_159377213.1|2790365_2793008_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	6.3e-161
WP_003222590.1|2793455_2793647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159376981.1|2793665_2794691_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_032726324.1|2794723_2796451_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_015384279.1|2796581_2797874_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_015483525.1|2797903_2798878_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_032726325.1|2798874_2799663_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_021480247.1|2799652_2800597_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|2800629_2801460_-	protein HemX	NA	NA	NA	NA	NA
WP_004399038.1|2801467_2802835_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014477563.1|2803063_2803561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229621.1|2803582_2804170_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003229618.1|2804166_2806491_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	3.4e-182
WP_159376982.1|2806671_2808330_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|2808481_2809744_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 13
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	3060765	3161995	4209045	coat,capsid,integrase,plate,terminase,holin,portal	uncultured_Caudovirales_phage(52.73%)	112	3098876:3098893	3162156:3162173
WP_021480358.1|3060765_3061170_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003229083.1|3061335_3061773_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	1.3e-47
WP_010886599.1|3061865_3062042_+	YtzI protein	NA	NA	NA	NA	NA
WP_014477743.1|3062035_3062473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003219361.1|3062592_3063066_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003229076.1|3063194_3063422_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	2.8e-25
WP_014477744.1|3063418_3063982_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003219346.1|3064075_3064324_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003229073.1|3064529_3065861_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_038829939.1|3065903_3066944_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003229069.1|3066997_3067156_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_159377017.1|3067174_3068062_-	manganese ABC transporter permease MntD	NA	NA	NA	NA	NA
WP_159377018.1|3068051_3069359_-	manganese ABC transporter permease MntC	NA	NA	NA	NA	NA
WP_014480635.1|3069364_3070117_-	manganese ABC transporter ATP-binding protein MntB	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	5.1e-15
WP_159377019.1|3070135_3071056_-	manganese ABC transporter substrate-binding protein/adhesin MntA	NA	NA	NA	NA	NA
WP_038829936.1|3071335_3072451_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_159377020.1|3072447_3073908_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.7	1.1e-74
WP_003229054.1|3073998_3074814_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_159377021.1|3074848_3075673_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_015251379.1|3075660_3077403_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_128993311.1|3077399_3078815_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_003229046.1|3079104_3079824_+	yteA family sporulation protein	NA	NA	NA	NA	NA
WP_003229044.1|3079832_3080651_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	8.2e-51
WP_159377022.1|3080822_3082109_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	34.8	3.0e-71
WP_159377023.1|3082105_3083056_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.6	8.4e-31
WP_015714581.1|3083058_3084282_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_021480374.1|3084355_3084790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124047994.1|3084791_3085847_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_159377024.1|3085861_3086995_-|coat	spore coat protein CotSA	coat	NA	NA	NA	NA
WP_124047993.1|3087184_3088258_+|coat	spore coat kinase CotI	coat	NA	NA	NA	NA
WP_021480377.1|3088337_3088805_+	TspO/MBR family protein	NA	NA	NA	NA	NA
WP_032722378.1|3088835_3091232_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.5e-12
WP_021480379.1|3091218_3092673_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_021480380.1|3092669_3093701_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_038829923.1|3093724_3094867_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_038829922.1|3094863_3096747_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
3098876:3098893	attL	GCTCTCCCAGCTGAGCTA	NA	NA	NA	NA
WP_003228966.1|3104484_3105063_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_159377025.1|3105104_3105626_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_159377026.1|3105643_3107173_-	flotillin lipid rafts scaffold protein FloT	NA	A0A2I2L4B2	Orpheovirus	27.9	2.1e-07
WP_159377027.1|3107193_3107718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003242867.1|3107885_3108374_+	DinB family protein	NA	NA	NA	NA	NA
WP_014477775.1|3108379_3108958_-	molybdenum cofactor sulfurase	NA	NA	NA	NA	NA
WP_032727092.1|3109045_3110254_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_032726762.1|3110270_3111743_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015251366.1|3111941_3112484_+	transcriptional regulator GbsR	NA	NA	NA	NA	NA
WP_159377028.1|3112681_3113227_+	biofilm-surface layer protein BslA	NA	NA	NA	NA	NA
WP_049140582.1|3113592_3114261_+	potassium uptake protein KtrA	NA	NA	NA	NA	NA
WP_046340262.1|3114267_3115605_+	Ktr system potassium transporter KtrB	NA	NA	NA	NA	NA
WP_003222348.1|3115640_3115904_-	membrane protein	NA	NA	NA	NA	NA
WP_049140581.1|3116012_3116861_-	exo-glucosaminidase LytG	NA	A0A0K2CP65	Brevibacillus_phage	41.1	1.0e-24
WP_159377029.1|3117021_3118557_-	MFS transporter	NA	NA	NA	NA	NA
WP_159377030.1|3119057_3119543_+	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_159377031.1|3119982_3120321_+	YolD-like family protein	NA	O64030	Bacillus_phage	45.2	6.2e-13
WP_159377032.1|3120493_3121240_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_015382966.1|3121365_3121596_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_015715413.1|3122151_3122634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159377033.1|3122662_3123484_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	75.8	2.8e-67
WP_159377034.1|3123529_3123949_-|holin	holin	holin	D6R405	Bacillus_phage	84.2	9.0e-54
WP_159377035.1|3124009_3124204_-	XkdX family protein	NA	A0A2H4J2R9	uncultured_Caudovirales_phage	59.1	2.2e-07
WP_159377036.1|3124204_3124594_-	hypothetical protein	NA	O64053	Bacillus_phage	41.9	9.1e-16
WP_015715405.1|3126223_3126853_-	hypothetical protein	NA	A0A2H4J4S3	uncultured_Caudovirales_phage	82.3	8.1e-91
WP_041850226.1|3126849_3128025_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	72.7	2.7e-156
WP_015715403.1|3128017_3128374_-	hypothetical protein	NA	A0A2H4J4S8	uncultured_Caudovirales_phage	61.0	2.6e-33
WP_041339442.1|3128370_3128718_-	hypothetical protein	NA	A0A2H4JDQ2	uncultured_Caudovirales_phage	60.0	1.2e-30
WP_159377037.1|3128717_3129683_-	hypothetical protein	NA	A0A2H4J4T4	uncultured_Caudovirales_phage	59.8	1.7e-103
WP_041052512.1|3129669_3130026_-	hypothetical protein	NA	A0A2H4J6L1	uncultured_Caudovirales_phage	74.6	1.7e-45
WP_032722281.1|3130039_3130594_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	67.9	2.2e-63
WP_159377038.1|3130594_3135286_-	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	62.8	1.2e-122
WP_041351423.1|3135444_3135741_-	hypothetical protein	NA	A0A2D1GQ87	Lysinibacillus_phage	39.7	4.2e-05
WP_015715395.1|3135838_3136234_-	hypothetical protein	NA	A0A2H4J4R5	uncultured_Caudovirales_phage	64.3	1.7e-38
WP_159377039.1|3136248_3137283_-	DUF3383 family protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	65.4	2.3e-127
WP_064670954.1|3137288_3137759_-	hypothetical protein	NA	A0A2H4J4R9	uncultured_Caudovirales_phage	62.0	2.9e-53
WP_159377040.1|3137715_3138105_-	hypothetical protein	NA	A0A2H4JDP3	uncultured_Caudovirales_phage	56.1	1.0e-27
WP_153529823.1|3138104_3138608_-	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	57.1	4.0e-48
WP_159377041.1|3138612_3138948_-	hypothetical protein	NA	A0A2H4J6J9	uncultured_Caudovirales_phage	57.7	1.9e-30
WP_159377042.1|3138962_3139841_-	hypothetical protein	NA	A0A2H4JD21	uncultured_Caudovirales_phage	44.3	2.5e-53
WP_017696635.1|3140010_3140952_-|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	84.6	1.7e-145
WP_134983512.1|3140963_3141545_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	66.8	2.7e-64
WP_159377043.1|3141642_3141882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159377044.1|3141892_3143278_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	68.0	4.3e-177
WP_134975229.1|3143282_3144491_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	86.0	9.2e-208
WP_159377045.1|3144480_3145197_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	56.3	1.1e-62
WP_032722294.1|3145242_3145473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159377046.1|3145719_3145911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044445062.1|3146047_3146260_-	transcriptional regulator	NA	A0A1Z1LZP5	Bacillus_phage	46.7	8.4e-08
WP_159377047.1|3146773_3147289_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	42.0	1.4e-27
WP_159377048.1|3147551_3147740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069150175.1|3147753_3148032_-	hypothetical protein	NA	A0A1P8CWX5	Bacillus_phage	78.3	4.8e-35
WP_159377049.1|3148028_3148463_-	hypothetical protein	NA	M4ZRL6	Bacillus_phage	95.1	5.8e-80
WP_015715371.1|3148459_3148696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015715369.1|3148822_3149632_-	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	59.0	4.0e-90
WP_159377050.1|3149637_3149895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159377051.1|3149894_3150299_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	44.3	5.0e-25
WP_041345368.1|3150656_3150863_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	1.6e-19
WP_032722306.1|3151231_3151690_-	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	80.7	3.5e-59
WP_015715362.1|3151676_3151958_-	hypothetical protein	NA	A0A219UQK6	Bacillus_phage	41.2	1.8e-10
WP_159377214.1|3152187_3153003_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.5	1.0e-61
WP_159377052.1|3152923_3153613_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	40.5	8.8e-38
WP_033884309.1|3153777_3154620_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	85.8	1.6e-129
WP_159377053.1|3154622_3155573_-	hypothetical protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	70.8	1.9e-131
WP_159377054.1|3155572_3155761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159377055.1|3155861_3156056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128480744.1|3156185_3156443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159377056.1|3156439_3157009_-	helix-turn-helix domain-containing protein	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.9	2.7e-61
WP_072565179.1|3157173_3157941_-	phage antirepressor KilAC domain-containing protein	NA	A0A290FZK7	Caldibacillus_phage	71.7	1.6e-72
WP_010329848.1|3158005_3158197_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159377057.1|3158209_3158446_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_115997062.1|3158580_3158961_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	1.1e-21
WP_100276249.1|3159291_3159813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072565182.1|3159825_3160173_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	64.3	3.6e-16
WP_115997060.1|3160244_3160748_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	67.1	5.4e-61
WP_063334566.1|3160768_3161995_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	48.5	4.6e-106
3162156:3162173	attR	GCTCTCCCAGCTGAGCTA	NA	NA	NA	NA
>prophage 14
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	3426551	3434459	4209045		Thermus_phage(33.33%)	10	NA	NA
WP_122894710.1|3426551_3427322_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	29.6	2.9e-05
WP_003220031.1|3427361_3427595_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003220034.1|3427746_3428154_+	transcriptional repressor RghR	NA	S6C481	Thermus_phage	64.8	1.9e-16
WP_014480905.1|3428183_3428603_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
WP_003242888.1|3428694_3429021_+	catDE operon transcriptional regulator CatR	NA	NA	NA	NA	NA
WP_159377083.1|3429153_3430854_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	1.0e-23
WP_159377084.1|3430884_3432267_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_032726858.1|3432257_3432920_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.8	6.7e-27
WP_041850532.1|3432937_3433702_-	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_032726860.1|3433703_3434459_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	A0A2H4PQH2	Staphylococcus_phage	23.5	6.3e-13
>prophage 15
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	3442877	3450609	4209045	holin	Organic_Lake_phycodnavirus(50.0%)	9	NA	NA
WP_159377086.1|3442877_3443555_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_159377087.1|3443571_3444492_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228370.1|3444503_3445157_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_124047921.1|3445173_3446319_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
WP_014478002.1|3446602_3447136_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015714713.1|3447167_3447842_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_159377215.1|3447859_3448771_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228349.1|3448790_3449444_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_003243370.1|3449466_3450609_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
>prophage 16
NZ_CP023409	Bacillus subtilis strain 7PJ-16 chromosome, complete genome	4209045	3821332	3898253	4209045	bacteriocin,tRNA,coat,protease	Bacillus_phage(26.67%)	77	NA	NA
WP_041334658.1|3821332_3823003_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003243604.1|3822999_3823428_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|3823740_3823872_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|3823828_3823981_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_041334655.1|3824005_3825352_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_041334652.1|3825364_3825526_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_003227564.1|3825522_3826242_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	7.3e-19
WP_129138004.1|3826234_3827545_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_080015532.1|3827534_3828695_+	insulinase family protein	NA	NA	NA	NA	NA
WP_069964371.1|3828699_3829980_+	insulinase family protein	NA	NA	NA	NA	NA
WP_014481222.1|3829976_3830678_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_014481223.1|3830683_3832060_-	YncE family protein	NA	NA	NA	NA	NA
WP_049140945.1|3832098_3833454_-	YncE family protein	NA	NA	NA	NA	NA
WP_021480843.1|3833683_3834829_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
WP_159377121.1|3834812_3834932_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_003227545.1|3835533_3836406_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|3836466_3837297_-	spermidine synthase	NA	NA	NA	NA	NA
WP_015384942.1|3837498_3839574_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_014478299.1|3839601_3840036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244446.1|3840174_3840693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227536.1|3840706_3841366_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|3841474_3841663_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003242889.1|3841705_3842125_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159377122.1|3842244_3844161_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	42.5	1.4e-141
WP_046381405.1|3844994_3846404_-	MFS transporter	NA	NA	NA	NA	NA
WP_017696247.1|3846403_3846874_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|3846985_3847486_-	YwgA family protein	NA	NA	NA	NA	NA
WP_024571616.1|3847521_3848823_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|3848984_3849209_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_019712820.1|3849423_3850200_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_046160962.1|3850343_3851234_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014481232.1|3851402_3852248_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_014481233.1|3852296_3853196_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003235941.1|3853341_3854313_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003242896.1|3854582_3855347_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_042975433.1|3855479_3856259_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_014481235.1|3856273_3857473_-	transaminase BacF	NA	NA	NA	NA	NA
WP_014481236.1|3857473_3858658_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_076457451.1|3858654_3860073_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_003243359.1|3860091_3860853_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
WP_003244300.1|3860855_3861563_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|3861552_3862167_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_101169651.1|3862318_3863557_-	MFS transporter	NA	NA	NA	NA	NA
WP_021480909.1|3863766_3865179_-	amino acid permease	NA	NA	NA	NA	NA
WP_159377123.1|3865178_3866879_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_031315430.1|3866952_3868500_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015250966.1|3868726_3870001_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_014478326.1|3870177_3870642_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_032727110.1|3870966_3871422_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_141949275.1|3871418_3872267_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	3.7e-38
WP_021480913.1|3872280_3873228_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.5	2.8e-71
WP_159377124.1|3873227_3873968_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	42.0	5.9e-48
WP_159377125.1|3873992_3875012_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_032725144.1|3875014_3875737_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_159377126.1|3875729_3876851_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_101502530.1|3876850_3877720_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048654797.1|3877720_3878890_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	26.9	3.2e-16
WP_159377127.1|3878910_3880335_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_029946239.1|3880339_3881110_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_014481253.1|3881429_3881975_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|3882018_3882390_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_015384975.1|3882451_3883774_-	purine permease	NA	NA	NA	NA	NA
WP_014481255.1|3883793_3884111_-	YwdI family protein	NA	NA	NA	NA	NA
WP_159377128.1|3884278_3885649_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014478341.1|3885673_3886351_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	1.8e-48
WP_015250953.1|3886364_3887171_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_009968358.1|3887260_3887794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227434.1|3887841_3888477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227432.1|3888469_3888808_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014665830.1|3888951_3889767_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|3889856_3890105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159377129.1|3890198_3891638_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	27.3	7.0e-21
WP_029318665.1|3891634_3893020_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003243563.1|3893321_3894092_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_032725139.1|3894130_3894961_-	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003222155.1|3895000_3895303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032725138.1|3895832_3898253_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
