The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019432	Pseudomonas sp. S49 chromosome, complete genome	6659551	838528	850869	6659551		uncultured_Caudovirales_phage(92.86%)	18	NA	NA
WP_160038137.1|838528_839701_-	DUF3800 domain-containing protein	NA	A0A2H4J132	uncultured_Caudovirales_phage	94.6	1.4e-205
WP_160038139.1|839762_840131_-	hypothetical protein	NA	A0A2H4J9F9	uncultured_Caudovirales_phage	94.3	1.1e-58
WP_160038141.1|840810_841194_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	94.5	2.7e-52
WP_160038143.1|841528_841864_-	hypothetical protein	NA	A0A2H4J9H6	uncultured_Caudovirales_phage	79.3	1.8e-36
WP_160038145.1|842338_842821_-	helix-turn-helix domain-containing protein	NA	A0A2H4J450	uncultured_Caudovirales_phage	99.4	4.5e-81
WP_160038147.1|843051_843444_+	hypothetical protein	NA	A0A2H4J161	uncultured_Caudovirales_phage	97.7	1.3e-70
WP_146477802.1|843486_843933_+	hypothetical protein	NA	A0A2H4J163	uncultured_Caudovirales_phage	98.0	7.1e-81
WP_160038149.1|844023_844407_+	hypothetical protein	NA	A0A2H4J8C3	uncultured_Caudovirales_phage	92.9	1.0e-64
WP_160038151.1|844519_845074_-	hypothetical protein	NA	Q6J1P3	Burkholderia_virus	45.3	3.0e-12
WP_160038153.1|845106_845805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_127649281.1|846039_846765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160038155.1|846848_847430_+	hypothetical protein	NA	A0A2H4J156	uncultured_Caudovirales_phage	93.5	4.1e-97
WP_160038157.1|847501_847978_-	hypothetical protein	NA	A0A2H4J9J0	uncultured_Caudovirales_phage	96.8	1.6e-86
WP_160038159.1|847974_848184_-	hypothetical protein	NA	A0A2H4J177	uncultured_Caudovirales_phage	94.2	4.2e-28
WP_057009840.1|848370_848619_+	CsbD family protein	NA	NA	NA	NA	NA
WP_160038161.1|848829_849510_-	hypothetical protein	NA	A0A2H4J456	uncultured_Caudovirales_phage	99.1	2.0e-135
WP_054091197.1|849679_849955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160038163.1|850461_850869_+	hypothetical protein	NA	A0A2H4J167	uncultured_Caudovirales_phage	86.7	5.0e-65
>prophage 2
NZ_CP019432	Pseudomonas sp. S49 chromosome, complete genome	6659551	1358214	1455406	6659551	protease,plate,holin,tRNA,tail,lysis	Pseudomonas_phage(58.49%)	105	NA	NA
WP_160038494.1|1358214_1359033_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.0	1.9e-07
WP_127925999.1|1359152_1359557_-	SufE family protein	NA	NA	NA	NA	NA
WP_160038496.1|1359553_1360759_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	35.6	2.9e-68
WP_160038498.1|1360866_1361901_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_003222107.1|1361934_1362297_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_150749447.1|1362591_1364223_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_160038500.1|1364215_1364923_-	peptidase M12	NA	NA	NA	NA	NA
WP_160038502.1|1365110_1366310_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_123594889.1|1366353_1369056_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_127926006.1|1369097_1369880_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003222119.1|1370253_1370991_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_150749445.1|1371181_1372045_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003222124.1|1372253_1372997_+	UMP kinase	NA	NA	NA	NA	NA
WP_007908855.1|1372993_1373551_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_127926008.1|1373565_1374321_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	38.1	5.0e-18
WP_160038504.1|1374320_1375127_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_127926010.1|1375123_1376314_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_127926011.1|1376368_1377721_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_127926012.1|1377795_1380171_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_007908849.1|1380216_1380720_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_127926013.1|1380723_1381779_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_003222142.1|1381885_1382326_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_038357910.1|1382322_1383099_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_150749443.1|1383101_1384232_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_160042470.1|1384243_1384870_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	8.3e-27
WP_127926016.1|1384946_1388468_+	DNA polymerase III subunit alpha	NA	A0A1C9LWZ5	Streptomyces_phage	36.7	5.6e-197
WP_127926017.1|1388607_1389555_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_160038506.1|1389687_1391016_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A7IXR9	Paramecium_bursaria_Chlorella_virus	24.7	9.1e-07
WP_034156321.1|1391290_1392922_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.9	4.5e-157
WP_160038508.1|1392927_1393773_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.0	1.8e-48
WP_160038510.1|1393930_1395220_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.4	1.8e-137
WP_007908838.1|1395391_1395670_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_127926019.1|1395666_1396374_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_127926020.1|1396518_1397415_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007908835.1|1397531_1398644_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	6.2e-33
WP_174245100.1|1398734_1399586_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_034149878.1|1399630_1400104_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_160038512.1|1400100_1401159_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_007908831.1|1401146_1401896_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	5.7e-67
WP_172828219.1|1401937_1402573_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.3	3.5e-41
WP_016985074.1|1402785_1403655_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	33.3	6.5e-06
WP_160038514.1|1403761_1404769_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
WP_007908827.1|1405278_1405602_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_174245101.1|1405765_1408336_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.6	6.2e-28
WP_160038518.1|1408588_1409338_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_160038520.1|1409304_1409796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150774123.1|1410357_1410738_+	DUF1090 family protein	NA	NA	NA	NA	NA
WP_158013173.1|1410730_1410976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007908821.1|1411040_1411775_+	helix-turn-helix transcriptional regulator	NA	B5TK58	Pseudomonas_phage	92.6	2.3e-129
WP_150749432.1|1412284_1412686_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_160038522.1|1412796_1413219_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_150749649.1|1413374_1413779_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_127926031.1|1413921_1414269_+|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	86.8	2.7e-51
WP_127926032.1|1414293_1414485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127926033.1|1414576_1415068_+|tail	phage tail protein	tail	H2BDC0	Pseudomonas_virus	63.4	1.3e-51
WP_127926034.1|1415076_1415427_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_127926035.1|1415456_1415711_+	hypothetical protein	NA	Q9MCA3	Pseudomonas_phage	50.6	3.8e-15
WP_127926036.1|1415767_1416994_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	31.9	5.7e-32
WP_127926037.1|1417031_1417370_+|tail	phage tail protein	tail	K7PHJ6	Enterobacteria_phage	57.1	7.8e-32
WP_127926038.1|1417436_1418120_+|tail	phage minor tail protein L	tail	A0A2I6PIA7	Pseudomonas_phage	66.1	1.9e-85
WP_127926039.1|1418122_1418926_+	C40 family peptidase	NA	A0A2I6PI52	Pseudomonas_phage	56.0	1.8e-87
WP_127926040.1|1418953_1419559_+|tail	tail assembly protein	tail	A0A2I6PI69	Pseudomonas_phage	57.1	5.9e-54
WP_127926041.1|1419589_1420195_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	50.5	1.5e-46
WP_160038524.1|1420263_1423836_+	DUF1983 domain-containing protein	NA	A4JX16	Burkholderia_virus	45.2	1.8e-283
WP_127926043.1|1423832_1424225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150749427.1|1424224_1424950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160038526.1|1426095_1426413_+	hypothetical protein	NA	A0A059VFX9	Pseudomonas_phage	56.6	7.9e-26
WP_150749425.1|1426409_1426766_+|tail	phage tail protein	tail	A0A059VFX9	Pseudomonas_phage	60.4	3.1e-23
WP_160038528.1|1426856_1427825_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	29.2	1.0e-23
WP_150749424.1|1427921_1428506_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	76.3	7.6e-83
WP_034154909.1|1428502_1428682_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	80.0	5.2e-19
WP_160038530.1|1428681_1430178_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	92.0	6.1e-262
WP_007908779.1|1430245_1430593_+|tail	phage tail tube protein	tail	B5TK68	Pseudomonas_phage	93.9	3.8e-58
WP_007908778.1|1430589_1430886_+|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	90.8	1.1e-40
WP_160038532.1|1431016_1433002_+	hypothetical protein	NA	B5TK70	Pseudomonas_phage	70.0	9.3e-24
WP_150749421.1|1432988_1434224_+	DNA circularization N-terminal domain-containing protein	NA	B5TK71	Pseudomonas_phage	63.8	2.4e-142
WP_127926052.1|1434227_1435271_+|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	78.8	1.0e-154
WP_127926053.1|1435412_1435922_+|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	84.6	3.2e-77
WP_127926054.1|1435918_1436317_+	phage GP46 family protein	NA	B5TK74	Pseudomonas_phage	93.9	4.7e-68
WP_127926055.1|1436306_1437350_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	82.9	3.4e-158
WP_095112473.1|1437337_1437937_+	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	91.0	1.1e-105
WP_160038534.1|1437951_1438683_+	hypothetical protein	NA	B5TK77	Pseudomonas_phage	50.0	2.7e-21
WP_127926058.1|1438684_1439110_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_127926059.1|1439167_1440262_+|tail	phage tail protein	tail	B5TK79	Pseudomonas_phage	74.7	1.0e-160
WP_160038536.1|1440270_1440837_+|tail	tail fiber assembly protein	tail	B5TK80	Pseudomonas_phage	67.0	1.7e-71
WP_127926061.1|1440859_1441786_+	hypothetical protein	NA	B5TK77	Pseudomonas_phage	75.8	9.1e-22
WP_127926062.1|1441785_1442253_+	hypothetical protein	NA	B5TK82	Pseudomonas_phage	45.6	2.3e-13
WP_127926063.1|1442293_1443214_+|tail	phage tail protein	tail	B5TK81	Pseudomonas_phage	39.8	3.4e-37
WP_160038538.1|1443216_1443657_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	47.4	2.0e-19
WP_160038540.1|1443666_1444827_+	hypothetical protein	NA	B5TK77	Pseudomonas_phage	47.8	4.0e-19
WP_160038542.1|1444826_1445081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160038544.1|1445118_1445685_+	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	82.6	2.4e-86
WP_160038546.1|1445663_1446182_+|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	71.8	4.8e-57
WP_127926069.1|1446249_1446750_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	89.2	2.9e-75
WP_160038548.1|1446833_1447889_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	58.2	7.7e-110
WP_095112456.1|1447897_1448368_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_150749413.1|1448423_1449542_-	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_034154934.1|1449893_1450088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008077172.1|1450088_1450514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160038550.1|1450703_1451450_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_160038552.1|1451673_1452324_+	response regulator	NA	NA	NA	NA	NA
WP_042557932.1|1452398_1452761_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_160038554.1|1452757_1453684_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007908723.1|1453817_1454597_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_174245045.1|1454707_1455406_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP019432	Pseudomonas sp. S49 chromosome, complete genome	6659551	2351370	2402511	6659551	terminase,protease,holin,tRNA,portal,tail,lysis,head,capsid,integrase	Pseudomonas_phage(53.06%)	73	2370979:2370998	2393367:2393386
WP_160039064.1|2351370_2353293_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.5	2.0e-124
WP_171057393.1|2353292_2353844_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	36.7	3.5e-13
WP_002553160.1|2353904_2354099_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_007913489.1|2354127_2354484_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003226365.1|2354593_2355610_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.3	1.1e-28
WP_150751552.1|2355636_2358015_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002553164.1|2358018_2358321_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.8e-11
WP_003179985.1|2358301_2358658_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095047631.1|2358913_2360026_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A0U4JIT5	Pseudomonas_phage	32.9	2.3e-32
WP_072392567.1|2360025_2360238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160039066.1|2360282_2360570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160039068.1|2360609_2360858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160039070.1|2360909_2361218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160039072.1|2361227_2361548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160039074.1|2361746_2362121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160039076.1|2362194_2362635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160039078.1|2362631_2362955_-	hypothetical protein	NA	A0A1B0VM42	Pseudomonas_phage	72.6	5.0e-44
WP_160039080.1|2363039_2363507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160039082.1|2363521_2364109_-	hypothetical protein	NA	I6NP82	Burkholderia_phage	33.2	1.8e-15
WP_160039084.1|2364105_2364747_-	hypothetical protein	NA	A0A2I7R6M5	Vibrio_phage	28.6	4.5e-12
WP_160039086.1|2364863_2365025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160039088.1|2365021_2365891_-	hypothetical protein	NA	A0A2H4J418	uncultured_Caudovirales_phage	55.9	1.4e-96
WP_160039090.1|2365988_2366405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160039092.1|2366433_2366796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160039094.1|2366877_2367189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160042486.1|2367185_2367470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160039096.1|2367878_2368040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160039098.1|2368162_2368393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160039100.1|2368999_2369308_+	DUF1654 domain-containing protein	NA	A0A2D1GND3	Pseudomonas_phage	59.6	5.8e-26
WP_160039102.1|2369359_2370187_-	helix-turn-helix domain-containing protein	NA	H2BD63	Pseudomonas_phage	44.9	5.2e-53
WP_160039104.1|2370275_2370485_+	hypothetical protein	NA	A0A1B0Z2M2	Pseudomonas_phage	63.3	3.5e-14
WP_160042488.1|2370551_2370974_+	Rha family transcriptional regulator	NA	A0A2D1GNM7	Pseudomonas_phage	90.7	1.6e-66
2370979:2370998	attL	CAGGCATAAAAAAACCGCCT	NA	NA	NA	NA
WP_174245109.1|2371080_2371746_+	phage antirepressor KilAC domain-containing protein	NA	A0A0U4J8Z7	Pseudomonas_phage	58.9	9.0e-64
WP_160039108.1|2371745_2372495_+	hypothetical protein	NA	A0A2D1GNQ6	Pseudomonas_phage	82.0	1.9e-110
WP_160039110.1|2372491_2373175_+	Replication protein P	NA	B5WZY0	Pseudomonas_phage	49.2	2.5e-45
WP_160039112.1|2373167_2373377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160039114.1|2373367_2373670_+	DUF1364 family protein	NA	A0A2K8HR56	Pseudomonas_phage	42.3	3.4e-18
WP_160039116.1|2373794_2374226_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	70.6	2.1e-50
WP_160039118.1|2374593_2375874_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GND4	Pseudomonas_phage	53.6	1.6e-122
WP_160039120.1|2375876_2376191_+	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	44.2	7.8e-18
WP_160039122.1|2376193_2376757_+	hypothetical protein	NA	A0A2H4J2J2	uncultured_Caudovirales_phage	59.6	1.5e-67
WP_071171686.1|2376931_2377306_+	hypothetical protein	NA	A0A2H4J7X6	uncultured_Caudovirales_phage	73.2	3.1e-45
WP_071171687.1|2377306_2377588_+|holin	phage holin family protein	holin	A0A2H4J0H1	uncultured_Caudovirales_phage	79.6	7.4e-36
WP_160039124.1|2377652_2377832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160039126.1|2377822_2378197_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	67.7	2.1e-46
WP_160039128.1|2378356_2378842_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	94.4	1.2e-81
WP_160039130.1|2378841_2380569_+|terminase	terminase large subunit	terminase	A0A2D1GNU5	Pseudomonas_phage	93.0	0.0e+00
WP_174245053.1|2380576_2380741_+	hypothetical protein	NA	Q9MCB1	Pseudomonas_phage	57.7	5.1e-05
WP_160042490.1|2380769_2382071_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	55.1	2.9e-127
WP_160039132.1|2382067_2382775_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	68.2	5.4e-75
WP_160039134.1|2382784_2384035_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	48.5	4.6e-93
WP_160039136.1|2384087_2384315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160039138.1|2384317_2384794_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_160039140.1|2384793_2385129_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	68.5	7.5e-35
WP_160039142.1|2385121_2385652_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	53.4	5.9e-42
WP_160039144.1|2385648_2386017_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	52.5	4.2e-31
WP_160039146.1|2386080_2386815_+|tail	phage tail protein	tail	H2BDC0	Pseudomonas_virus	49.4	3.1e-49
WP_160039148.1|2386824_2387250_+|tail	phage tail assembly chaperone family protein, TAC	tail	K7PJU9	Enterobacteria_phage	61.8	2.1e-34
WP_160039150.1|2387505_2390442_+|tail	phage tail tape measure protein	tail	A0A0U4JEA4	Pseudomonas_phage	58.5	4.0e-55
WP_160039152.1|2390431_2390770_+|tail	phage tail protein	tail	A0A1P8DTI9	Proteus_phage	49.1	7.1e-25
WP_160039154.1|2390779_2391529_+|tail	phage minor tail protein L	tail	A0A2H4J4Q5	uncultured_Caudovirales_phage	83.9	9.9e-128
WP_160039156.1|2391530_2392286_+	Mov34/MPN/PAD-1 family protein	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	82.1	1.3e-132
WP_160039158.1|2392319_2392718_+	hypothetical protein	NA	A0A1B0VMK5	Pseudomonas_phage	43.4	1.2e-18
WP_160042492.1|2392776_2393337_+|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	68.1	1.3e-63
WP_160039160.1|2393395_2396962_+	DUF1983 domain-containing protein	NA	A0A2H4J8Z6	uncultured_Caudovirales_phage	61.1	0.0e+00
2393367:2393386	attR	AGGCGGTTTTTTTATGCCTG	NA	NA	NA	NA
WP_160039162.1|2396965_2397322_+	hypothetical protein	NA	A0A059VJS9	Pseudomonas_phage	60.0	2.3e-34
WP_160039164.1|2397318_2397981_+	hypothetical protein	NA	A0A059VF40	Pseudomonas_phage	73.2	1.0e-96
WP_160039166.1|2398979_2399315_+	hypothetical protein	NA	A0A059VFX9	Pseudomonas_phage	56.1	5.0e-23
WP_160039168.1|2399311_2399677_+|tail	phage tail protein	tail	A0A059VFX9	Pseudomonas_phage	65.5	2.2e-35
WP_160039170.1|2399736_2400159_+	cell wall hydrolase	NA	A0A2D1GNI1	Pseudomonas_phage	75.2	1.2e-61
WP_160039172.1|2400158_2400665_+|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	70.7	2.0e-55
WP_160042494.1|2400646_2401069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160039174.1|2401953_2402511_-	DUF1768 domain-containing protein	NA	A0A2P1EJI8	Megavirus	45.1	6.9e-33
>prophage 4
NZ_CP019432	Pseudomonas sp. S49 chromosome, complete genome	6659551	2669843	2676465	6659551		uncultured_Caudovirales_phage(66.67%)	8	NA	NA
WP_160039405.1|2669843_2671505_-	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0S9M4	Catovirus	30.6	6.1e-53
WP_116031179.1|2671638_2672550_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160039407.1|2672584_2673037_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160042500.1|2673026_2673458_+	hypothetical protein	NA	V5UQY3	Oenococcus_phage	53.9	1.1e-30
WP_127926781.1|2673606_2673954_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.1	3.9e-34
WP_160039409.1|2673977_2675261_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	9.5e-171
WP_007910659.1|2675289_2675760_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	66.0	1.4e-55
WP_160039411.1|2675769_2676465_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	76.8	8.1e-100
>prophage 5
NZ_CP019432	Pseudomonas sp. S49 chromosome, complete genome	6659551	4215668	4221927	6659551	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
WP_150751082.1|4215668_4216061_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	75.2	5.1e-51
WP_160040954.1|4216062_4216419_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	65.0	5.0e-37
WP_160040956.1|4216418_4216712_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	65.7	7.5e-31
WP_150775033.1|4216708_4217044_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	77.5	8.0e-45
WP_160040958.1|4217040_4218042_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.5	2.8e-162
WP_127928923.1|4218133_4219135_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_127928925.1|4219251_4220646_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_160040960.1|4220646_4221927_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.9	4.8e-98
>prophage 6
NZ_CP019432	Pseudomonas sp. S49 chromosome, complete genome	6659551	4286619	4348647	6659551	coat,tRNA,transposase	Hokovirus(18.18%)	48	NA	NA
WP_160040984.1|4286619_4288002_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.0	4.3e-44
WP_122600546.1|4288017_4289715_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	62.1	1.5e-203
WP_095118204.1|4289965_4290472_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	33.3	7.4e-10
WP_034154735.1|4290468_4291215_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_127928968.1|4291395_4292925_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_008082123.1|4293061_4294264_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_160040986.1|4294279_4295749_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_077573642.1|4295738_4296221_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150774795.1|4296442_4297411_+	fimbrial protein	NA	NA	NA	NA	NA
WP_116030160.1|4297466_4300280_+	response regulator	NA	A0A1V0SGX0	Hokovirus	39.4	3.6e-37
WP_116030161.1|4300266_4301454_+	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_160040989.1|4301541_4304703_+	response regulator	NA	A0A1V0SGX0	Hokovirus	26.7	4.3e-39
WP_160040991.1|4304725_4305373_+	response regulator	NA	NA	NA	NA	NA
WP_116030164.1|4305479_4306067_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_116030165.1|4306141_4306888_+	molecular chaperone	NA	NA	NA	NA	NA
WP_116030166.1|4306973_4309466_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_160040993.1|4309596_4313271_-	translocation/assembly module TamB domain-containing protein	NA	NA	NA	NA	NA
WP_160040995.1|4313267_4314995_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_150652300.1|4315061_4315712_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008082104.1|4316015_4316828_+	exodeoxyribonuclease III	NA	A0A0N9QXX6	Chrysochromulina_ericina_virus	25.2	1.2e-12
WP_160040997.1|4317019_4318354_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_127928975.1|4318473_4319703_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_016986544.1|4319860_4320790_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042559912.1|4320994_4321393_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077573650.1|4321540_4322440_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	39.1	2.0e-42
WP_160040999.1|4323108_4324806_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	4.4e-30
WP_122590347.1|4325100_4326264_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_160041001.1|4326361_4327966_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	55.4	2.8e-18
WP_127928979.1|4327979_4328795_+	gamma-carboxygeranoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_160041003.1|4328794_4330744_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_160041005.1|4330784_4331444_-	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	34.7	7.4e-26
WP_093434137.1|4331574_4331913_+	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
WP_160041007.1|4332392_4333544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160041009.1|4333692_4334886_+	MFS transporter	NA	NA	NA	NA	NA
WP_160041011.1|4334882_4335428_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_150751121.1|4335424_4336531_-	catalase	NA	NA	NA	NA	NA
WP_160041013.1|4336688_4337195_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_150751122.1|4337191_4337947_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_110719340.1|4338070_4339042_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_150775911.1|4339038_4341396_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_127928990.1|4341475_4342264_-	molecular chaperone	NA	NA	NA	NA	NA
WP_122607800.1|4342298_4342799_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_127928991.1|4342803_4343340_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_160041015.1|4343360_4343894_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_160042560.1|4343996_4344500_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_150751126.1|4344804_4345935_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_160041017.1|4346151_4347465_+	protein kinase	NA	F2WL08	Lausannevirus	25.8	3.9e-10
WP_108227338.1|4347705_4348647_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP019432	Pseudomonas sp. S49 chromosome, complete genome	6659551	6116135	6160456	6659551	holin,protease,transposase	Tupanvirus(25.0%)	41	NA	NA
WP_095050277.1|6116135_6116639_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_150749700.1|6116896_6117784_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_095112740.1|6117785_6118343_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_150749701.1|6118493_6119129_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_160042118.1|6119125_6119800_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_034155015.1|6120054_6121254_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	28.9	1.9e-11
WP_160042120.1|6121458_6122316_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_160042122.1|6122527_6123160_-	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_160042124.1|6123292_6126310_-	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_016986286.1|6126306_6126636_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_034155011.1|6126650_6127901_-	sarcosine oxidase subunit beta	NA	NA	NA	NA	NA
WP_007913117.1|6127921_6129175_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.4	4.1e-102
WP_127930047.1|6129448_6130159_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_038363178.1|6130285_6131326_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_150749703.1|6131631_6132165_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_127930049.1|6132346_6133171_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007911227.1|6133499_6134600_-	glycine-betaine demethylase subunit GbcB	NA	NA	NA	NA	NA
WP_127930050.1|6134897_6136193_+	glycine-betaine demethylase subunit GbcA	NA	NA	NA	NA	NA
WP_127930051.1|6136452_6136659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127930052.1|6136944_6137511_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_127930053.1|6137564_6138335_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_160042126.1|6138344_6139565_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_160042128.1|6139564_6141514_-	dimethylglycine demethylation protein DgcB	NA	NA	NA	NA	NA
WP_160042130.1|6141667_6143728_-	dimethylglycine demethylation protein DgcA	NA	NA	NA	NA	NA
WP_005792152.1|6143743_6144274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095112751.1|6144380_6145358_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_160042132.1|6145592_6145994_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_093429897.1|6146095_6146419_+	helix-turn-helix domain-containing protein	NA	A0A1S5NNJ5	Burkholderia_phage	64.8	9.1e-30
WP_160042134.1|6146448_6146865_+	DUF3010 family protein	NA	NA	NA	NA	NA
WP_159814749.1|6146986_6147931_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160042136.1|6148137_6149082_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_016983621.1|6149191_6150079_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_160042138.1|6150220_6151186_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_160042140.1|6151523_6152000_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_160042142.1|6152024_6153188_+	gamma-butyrobetaine dioxygenase	NA	NA	NA	NA	NA
WP_016983943.1|6153573_6153837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007949927.1|6153962_6155066_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_160042144.1|6155607_6156984_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_095121425.1|6157421_6158369_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_095121426.1|6158435_6159281_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_160042146.1|6159277_6160456_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.6	1.5e-24
