The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046572	Rhodococcus sp. WAY2 chromosome, complete genome	6622033	2412081	2480659	6622033	protease	Vibrio_phage(14.29%)	59	NA	NA
WP_159921250.1|2412081_2412420_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_109328756.1|2412474_2413062_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_159921252.1|2413058_2414129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109334996.1|2414187_2414640_+	M67 family metallopeptidase	NA	NA	NA	NA	NA
WP_109328760.1|2414700_2414973_+	MoaD family protein	NA	NA	NA	NA	NA
WP_159921254.1|2414982_2415945_+	cysteine synthase	NA	A0A1X9I5K7	Streptococcus_phage	39.4	4.2e-54
WP_159921256.1|2415964_2416597_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_159921258.1|2416811_2417579_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_159921260.1|2417624_2418410_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_159921262.1|2418414_2419029_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	28.4	2.5e-07
WP_109328772.1|2419187_2419553_-	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_159921264.1|2419549_2419951_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_159921266.1|2420170_2420653_-	HNH endonuclease	NA	A0A2R2YAX6	Pseudomonas_phage	54.5	2.1e-30
WP_159921268.1|2420649_2421309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159921270.1|2421765_2431107_+	DUF1729 domain-containing protein	NA	NA	NA	NA	NA
WP_109328781.1|2431118_2431511_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_109328783.1|2431577_2432279_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159921272.1|2432556_2433030_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_109334997.1|2433191_2433413_+	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_159927078.1|2433903_2435133_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_109334998.1|2435352_2435952_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	39.6	9.0e-23
WP_159921274.1|2437833_2438637_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159921276.1|2438656_2440681_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159921278.1|2440692_2441226_-	PadR family transcriptional regulator	NA	H9EB19	Vibrio_phage	36.1	4.0e-06
WP_159921280.1|2441345_2442671_+	MFS transporter	NA	NA	NA	NA	NA
WP_159921282.1|2442702_2443554_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_159921284.1|2443577_2444318_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159921286.1|2444450_2445560_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_159921288.1|2445591_2446764_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_109328805.1|2446776_2446989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159921290.1|2447051_2448395_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_159921292.1|2448490_2448982_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_159921294.1|2449077_2449794_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159921296.1|2450287_2450662_-	DUF4345 domain-containing protein	NA	NA	NA	NA	NA
WP_159921298.1|2450763_2452794_+	copper resistance protein CopD	NA	NA	NA	NA	NA
WP_159921300.1|2452961_2453426_+	single-stranded DNA-binding protein	NA	A0A1J0MC80	Streptomyces_phage	40.5	7.8e-14
WP_109328817.1|2453541_2455221_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.4	1.7e-47
WP_109328819.1|2455222_2455648_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_159921302.1|2455755_2460654_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_159921304.1|2460650_2461076_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_159921306.1|2461068_2461755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159921308.1|2461744_2462671_-	EamA family transporter	NA	NA	NA	NA	NA
WP_159921310.1|2462658_2464257_-	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_159921312.1|2464324_2464720_-	globin	NA	NA	NA	NA	NA
WP_109328830.1|2464997_2465579_+	HNH endonuclease	NA	H6WG01	Cyanophage	35.5	1.4e-17
WP_159921314.1|2465655_2465916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109328834.1|2465902_2466382_+	DUF5130 domain-containing protein	NA	NA	NA	NA	NA
WP_159921316.1|2466531_2467758_+	DNA polymerase IV	NA	A0A218MNF2	uncultured_virus	25.8	3.4e-16
WP_159921318.1|2467860_2470440_-	aminopeptidase N	NA	A0A2K9L1R3	Tupanvirus	32.6	8.6e-46
WP_159921320.1|2470513_2471752_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159921322.1|2471899_2472529_+	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
WP_159921324.1|2472536_2473514_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_159921326.1|2473582_2474056_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_159921328.1|2474069_2474867_+	Fpg/Nei family DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	27.9	3.4e-09
WP_159921330.1|2474912_2475713_-	DUF1542 domain-containing protein	NA	NA	NA	NA	NA
WP_159921332.1|2476277_2477654_+	trigger factor	NA	NA	NA	NA	NA
WP_109328849.1|2477838_2478426_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	50.3	9.1e-44
WP_109328851.1|2478473_2479136_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	44.8	1.2e-36
WP_109328853.1|2479378_2480659_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.6	7.1e-142
>prophage 2
NZ_CP046572	Rhodococcus sp. WAY2 chromosome, complete genome	6622033	3443130	3451415	6622033		Mycobacterium_phage(33.33%)	8	NA	NA
WP_109335128.1|3443130_3444762_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	26.2	1.2e-37
WP_159922615.1|3444889_3445678_+	glucose 1-dehydrogenase	NA	A0A0M4JSW6	Mollivirus	35.5	2.4e-07
WP_159922617.1|3446294_3447443_+	lycopene cyclase family protein	NA	NA	NA	NA	NA
WP_159922619.1|3447474_3448371_+	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	43.4	2.5e-53
WP_159922621.1|3448438_3448852_-	DUF59 domain-containing protein	NA	NA	NA	NA	NA
WP_159922623.1|3448848_3449346_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0K1LSF9	Mycobacterium_phage	47.4	1.7e-22
WP_159922625.1|3449342_3450602_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.5	1.7e-100
WP_159922627.1|3450608_3451415_-	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	26.7	1.2e-06
>prophage 3
NZ_CP046572	Rhodococcus sp. WAY2 chromosome, complete genome	6622033	6058628	6065196	6622033		Lactobacillus_phage(16.67%)	7	NA	NA
WP_159926025.1|6058628_6059192_+	FMN reductase	NA	A0A2P0ZL77	Lactobacillus_phage	27.7	1.4e-09
WP_159926027.1|6059214_6060048_-	SIP domain-containing protein	NA	NA	NA	NA	NA
WP_109335193.1|6060597_6060831_+	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	63.6	8.6e-22
WP_159926029.1|6060919_6061396_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A217ER62	Bacillus_phage	30.9	1.2e-09
WP_109335192.1|6061377_6063537_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.0	3.0e-209
WP_015890191.1|6063614_6064580_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	88.7	1.8e-161
WP_159926031.1|6064722_6065196_-	NUDIX domain-containing protein	NA	D0R7J3	Paenibacillus_phage	30.1	2.5e-15
>prophage 1
NZ_CP046573	Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence	991117	412952	483798	991117	transposase,integrase	Mycobacterium_phage(44.44%)	60	451580:451596	485680:485696
WP_109336454.1|412952_413252_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159928254.1|413248_414889_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q9ZX60	Mycobacterium_phage	44.6	9.4e-30
WP_159928256.1|414899_415478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928258.1|415532_417341_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_159928260.1|417393_418146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928262.1|418237_418675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928264.1|418775_418973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928266.1|418980_419787_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_159928268.1|419798_420020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928270.1|420018_423084_+	DEAD/DEAH box helicase family protein	NA	A0A2H4UTW8	Bodo_saltans_virus	21.2	1.3e-16
WP_159928272.1|423208_427906_-	relaxase domain-containing protein	NA	A0A2I6UFQ6	Klebsiella_phage	31.3	7.9e-05
WP_159928274.1|428294_428777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928276.1|429539_429719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928278.1|429897_430899_-	DUF4192 family protein	NA	NA	NA	NA	NA
WP_159928280.1|431434_431962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928282.1|432539_432965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928284.1|433238_433742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928286.1|433750_434476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928288.1|434625_434862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929101.1|435006_436329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928290.1|436583_436988_-	Lsr2 family protein	NA	NA	NA	NA	NA
WP_159928292.1|437442_437775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928294.1|437914_438217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928296.1|438206_438365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928298.1|438492_438681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928300.1|438677_439232_-	DNA helicase	NA	NA	NA	NA	NA
WP_159929103.1|439289_439523_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	57.9	8.3e-17
WP_159928302.1|440014_440467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159927971.1|440651_441254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159927973.1|441250_443887_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159929043.1|443868_445050_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159928304.1|445231_445708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928306.1|447734_448796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928308.1|448798_450898_+	hypothetical protein	NA	NA	NA	NA	NA
451580:451596	attL	CGGGGCCACCACCGAAC	NA	NA	NA	NA
WP_159928310.1|451914_452358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928312.1|453959_454526_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	53.7	1.6e-45
WP_159928314.1|454765_455131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928316.1|455150_455396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928318.1|455349_455850_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_159928320.1|456541_456727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928322.1|457291_460009_+	N-6 DNA methylase	NA	Q6NE04	Leptospira_phage	34.9	7.7e-138
WP_159928324.1|460005_461991_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_159928326.1|461987_463181_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_159928328.1|464970_466029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928330.1|466553_466850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928332.1|466935_467088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928334.1|467138_467327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928336.1|467323_467878_-	DNA helicase	NA	NA	NA	NA	NA
WP_159928338.1|468557_470162_-	ParB N-terminal domain-containing protein	NA	A0A2P1N496	Mycobacterium_phage	34.9	2.8e-55
WP_159928340.1|470250_470688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928342.1|470722_470944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928344.1|471727_472384_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159928346.1|472486_472840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159923567.1|473543_474857_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	82.8	3.5e-205
WP_159928348.1|476115_476433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928350.1|476860_477691_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_159928352.1|478113_479310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928354.1|479972_480308_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159929104.1|480304_480802_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159928356.1|480786_483798_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	32.2	1.9e-132
485680:485696	attR	GTTCGGTGGTGGCCCCG	NA	NA	NA	NA
>prophage 2
NZ_CP046573	Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence	991117	490190	537567	991117	transposase,integrase	Enterobacteria_phage(33.33%)	39	486277:486293	540516:540532
486277:486293	attL	CGGCGCTCGCCGCGGTG	NA	NA	NA	NA
WP_159928360.1|490190_491147_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159928362.1|491164_491995_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_159928364.1|492199_492970_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_159928366.1|492966_495036_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_159928368.1|495026_496070_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_159928370.1|496120_496945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928372.1|497605_497941_-	Lsr2 family protein	NA	A0A160DF84	Gordonia_phage	50.0	3.6e-21
WP_054806356.1|498782_499073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928374.1|499401_500628_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_159928376.1|501209_502709_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_159928378.1|502705_503494_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.3	2.2e-32
WP_050993454.1|503993_504848_-	alpha/beta fold hydrolase	NA	W0LK50	Mycobacterium_phage	27.6	1.1e-08
WP_159928380.1|504888_506121_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_037216443.1|506208_506505_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_159928382.1|506573_506963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019288893.1|507003_507297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054713360.1|507296_507824_-	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_019288891.1|507867_509217_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_054805881.1|509681_510569_-	glyoxalase	NA	NA	NA	NA	NA
WP_019288888.1|510598_511414_-	3-(cis-5,6-dihydroxycyclohexa-1, 3-dien-1-yl)propanoate dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	34.5	5.7e-12
WP_054805882.1|512305_512686_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159928384.1|513541_513940_+	peptidase C56	NA	NA	NA	NA	NA
WP_159928386.1|514358_517385_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	38.4	1.0e-175
WP_159929105.1|517402_518035_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159928388.1|518465_518891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928390.1|519210_522186_-	DEAD/DEAH box helicase family protein	NA	A0A2H4UTW8	Bodo_saltans_virus	20.3	9.4e-28
WP_159928392.1|522805_523294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928394.1|523416_524085_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_159928396.1|525017_526160_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1U9WS15	Gordonia_phage	26.7	8.0e-12
WP_159928397.1|526156_528619_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159928399.1|528611_529259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928401.1|529318_530296_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.6	4.9e-34
WP_159928403.1|530693_531278_+	helix-turn-helix domain-containing protein	NA	A0A219YB42	Aeromonas_phage	41.0	6.3e-05
WP_159928405.1|531313_531607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928407.1|532501_532948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928409.1|533008_533488_-	AsnC family protein	NA	NA	NA	NA	NA
WP_159928411.1|534063_535485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159928413.1|535489_535645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159928415.1|536454_537567_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
540516:540532	attR	CACCGCGGCGAGCGCCG	NA	NA	NA	NA
>prophage 1
NZ_CP046574	Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence	461378	66501	209816	461378	integrase,transposase	Mycobacterium_phage(18.18%)	110	144972:145007	148230:148265
WP_054246136.1|66501_67272_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_159929475.1|67304_69362_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159929195.1|70240_70381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246139.1|70387_71731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246140.1|72002_72629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246141.1|72640_73228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246142.1|73524_74196_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054246143.1|74192_75587_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	48.7	1.3e-128
WP_054246144.1|75602_76838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063786592.1|76834_77317_-	hypothetical protein	NA	V5UP92	Mycobacterium_phage	40.3	1.9e-23
WP_159929197.1|77427_77850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929199.1|77846_78524_-	hypothetical protein	NA	A0A142K8T1	Gordonia_phage	51.5	1.3e-06
WP_082359725.1|78783_78933_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082359726.1|79101_79410_-	helix-turn-helix transcriptional regulator	NA	V5UPP6	Mycobacterium_phage	36.6	5.5e-08
WP_054246179.1|79753_80230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246149.1|80226_80751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246150.1|80747_81053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246151.1|81287_81545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082359728.1|83585_84173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246153.1|84464_85700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246154.1|86989_87772_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_054246155.1|87768_88140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246180.1|88295_89576_+	DUF2637 domain-containing protein	NA	NA	NA	NA	NA
WP_082359729.1|90823_91048_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122975572.1|91071_92216_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	32.7	4.4e-34
WP_054246158.1|92304_93321_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	29.2	2.0e-22
WP_054246159.1|93629_95057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054246160.1|95391_96756_-	cytochrome P450	NA	I6XF76	Cotesia_sesamiae_Mombasa_bracovirus	23.9	1.4e-15
WP_054246161.1|96994_97339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246162.1|97335_97689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122975573.1|97985_98957_-	DNA ligase	NA	A0A2H4JD86	uncultured_Caudovirales_phage	25.1	7.3e-14
WP_054246164.1|99121_99469_+	Lsr2 family protein	NA	A0A160DF84	Gordonia_phage	48.2	7.1e-20
WP_054246165.1|99849_100161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082359730.1|100323_100641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246166.1|100720_101551_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_054246167.1|102018_102426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054246171.1|103866_104811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054246172.1|105020_105209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246173.1|105446_105791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929201.1|105787_107872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929203.1|107871_108669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054246181.1|108916_109165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054246182.1|109241_109601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054246176.1|109971_110991_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_054246177.1|111099_111306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054246178.1|111928_112741_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.1	2.5e-23
WP_082359731.1|112737_114432_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_054248224.1|114978_115671_-	GAF and ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_082359860.1|116227_116905_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_054248216.1|118015_119794_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	39.9	7.2e-92
WP_054248219.1|121863_122211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122975633.1|124269_125469_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.7	3.1e-30
WP_082359863.1|125365_126274_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_054248223.1|126984_128244_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	29.9	1.1e-30
WP_159929205.1|133502_133814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054248832.1|134856_135252_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063786658.1|137084_137498_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159929477.1|137494_138496_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_159929479.1|139078_143857_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_054248763.1|143853_144483_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_159929207.1|144714_144936_+	hypothetical protein	NA	NA	NA	NA	NA
144972:145007	attL	CCCCTCTCTAATGAGTGTTAGCGGGTCGGCTTTCTG	NA	NA	NA	NA
WP_159929481.1|146838_147840_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054248953.1|148757_150029_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
148230:148265	attR	CAGAAAGCCGACCCGCTAACACTCATTAGAGAGGGG	NA	NA	NA	NA
WP_054248952.1|150061_150874_+	3-(cis-5,6-dihydroxycyclohexa-1, 3-dien-1-yl)propanoate dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	32.1	3.0e-13
WP_054249008.1|150936_152001_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159929209.1|152045_153140_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054248892.1|153233_154607_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_122975660.1|156110_157481_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_054248802.1|157503_158052_+	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_054248801.1|158071_158989_+	biphenyl-2,3-diol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_054248800.1|159111_159969_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_054248799.1|160019_160823_+	2-oxo-hepta-3-ene-1,7-dioic acid hydratase	NA	NA	NA	NA	NA
WP_054248798.1|160834_161605_+	4-hydroxy-2-oxovalerate aldolase	NA	NA	NA	NA	NA
WP_159929211.1|162954_164253_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_159929213.1|164331_164493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929215.1|167941_169312_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_054248802.1|169334_169883_+	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_063786650.1|169912_170278_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_082359919.1|170515_171250_+	alpha/beta fold hydrolase	NA	G9VYU4	Mycobacterium_phage	34.0	5.5e-06
WP_159929217.1|171227_172394_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054248916.1|172536_174072_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	26.0	7.0e-19
WP_054248917.1|175289_175877_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_054248918.1|175880_176420_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_054248996.1|176860_178081_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_082359922.1|178154_180386_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054248951.1|180746_181322_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159929219.1|181433_182627_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_054248190.1|182692_183880_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_054248825.1|183914_184658_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.2	8.6e-07
WP_054247964.1|184959_186249_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.2	1.1e-46
WP_054247965.1|186248_187889_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.5	3.7e-10
WP_122975638.1|187885_188878_+	NADPH:quinone oxidoreductase family protein	NA	NA	NA	NA	NA
WP_054248348.1|189748_190015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054248349.1|190068_190287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929221.1|190629_190770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054248350.1|191037_191802_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054248351.1|191954_192785_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_054248352.1|192790_193771_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.0	1.2e-35
WP_054248353.1|193767_194787_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	32.3	1.6e-40
WP_054248354.1|195052_195505_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054248357.1|197250_198132_-	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_054248358.1|198139_198619_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_054248359.1|198629_199394_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_054248360.1|199390_200887_-	pyoverdine biosynthesis protein PvcC	NA	NA	NA	NA	NA
WP_054248361.1|200883_201744_-	alpha/beta fold hydrolase	NA	A0A1M7XTX4	Cedratvirus	29.2	1.8e-08
WP_054248871.1|202320_202956_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159929483.1|203398_203911_+	flavin reductase	NA	NA	NA	NA	NA
WP_159929223.1|203966_204962_+	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_159929225.1|207059_208166_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_159929227.1|208721_209816_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP046574	Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence	461378	225590	379231	461378	integrase,transposase	Mycobacterium_phage(13.04%)	103	224447:224463	374058:374076
224447:224463	attL	GGCGAACGCGGCGGCCG	NA	NA	NA	NA
WP_159929249.1|225590_226739_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	28.1	4.3e-05
224447:224463	attL	GGCGAACGCGGCGGCCG	NA	NA	NA	NA
WP_159929487.1|228469_229265_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.9	2.6e-25
WP_159929250.1|229306_229639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929489.1|229800_230916_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159929251.1|232315_233050_-	hypothetical protein	NA	A0A2P1JR43	Mycobacterium_phage	54.5	4.4e-11
WP_159929253.1|233694_234141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929255.1|234309_234618_-	EthD family reductase	NA	NA	NA	NA	NA
WP_159929257.1|234903_236439_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	27.2	4.8e-20
WP_159929491.1|237016_238111_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_159929493.1|238082_238661_-	response regulator	NA	NA	NA	NA	NA
WP_159929259.1|238904_240443_+	monooxygenase	NA	NA	NA	NA	NA
WP_159929261.1|240442_241534_+	monooxygenase	NA	NA	NA	NA	NA
WP_159929263.1|241530_241848_+	monooxygenase	NA	NA	NA	NA	NA
WP_159929265.1|241859_242891_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_159929267.1|243129_244629_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_159929269.1|244656_245766_+	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.1e-29
WP_159929495.1|246007_247600_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	50.7	8.9e-134
WP_159929271.1|248750_249050_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_159929497.1|249863_250190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929273.1|250000_251149_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	31.2	3.0e-22
WP_159925569.1|256700_258224_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
252986:253002	attR	CGGCCGCCGCGTTCGCC	NA	NA	NA	NA
WP_159929275.1|258223_258805_+	DUF779 domain-containing protein	NA	NA	NA	NA	NA
252986:253002	attR	CGGCCGCCGCGTTCGCC	NA	NA	NA	NA
WP_159929277.1|258851_259094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929279.1|260821_261880_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_159929487.1|262720_263517_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.9	2.6e-25
WP_159929281.1|265284_268866_+	protein kinase	NA	F2WL08	Lausannevirus	29.4	8.7e-20
WP_159929283.1|270555_271332_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_159929285.1|271616_272765_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	31.2	3.0e-22
WP_159929497.1|272575_272902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929287.1|273053_273626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929289.1|274459_276040_+	methane monooxygenase	NA	NA	NA	NA	NA
WP_159929291.1|276238_277456_+	toluene hydroxylase	NA	NA	NA	NA	NA
WP_159929293.1|277561_277996_+	MmoB/DmpM family protein	NA	NA	NA	NA	NA
WP_159929295.1|278359_279394_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4R1G0	Synechococcus_phage	34.0	6.6e-05
WP_159929297.1|279393_279981_+	methane monooxygenase	NA	NA	NA	NA	NA
WP_159929299.1|280056_281643_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	50.8	1.8e-134
WP_159929301.1|281805_283329_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_159929499.1|283516_284317_+	cobalamin biosynthesis protein CbiM	NA	NA	NA	NA	NA
WP_159929303.1|284313_284691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929305.1|284694_285465_+	cobalt ECF transporter T component CbiQ	NA	NA	NA	NA	NA
WP_159929307.1|285461_286232_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	2.1e-16
WP_159929501.1|287014_287269_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159929505.1|290602_290806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929309.1|290784_291558_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	40.9	2.1e-35
WP_159929503.1|291454_292654_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.7	2.4e-30
WP_159929507.1|293303_294332_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054246426.1|294328_294667_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_159929311.1|294663_297066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929313.1|300630_301884_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_159929315.1|302319_303015_+	response regulator	NA	NA	NA	NA	NA
WP_159929509.1|303117_304611_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_159929503.1|305203_306403_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.7	2.4e-30
WP_159929317.1|307554_308565_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159929319.1|308669_308969_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_159929510.1|309640_310999_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.5	3.9e-29
WP_159929321.1|312463_313003_-	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_109330702.1|313006_313594_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_054248916.1|314882_316418_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	26.0	7.0e-19
WP_159929323.1|316983_317265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929325.1|317355_318636_-	monooxygenase	NA	NA	NA	NA	NA
WP_159929326.1|318640_319411_-	methane monooxygenase/ammonia monooxygenase subunit A	NA	NA	NA	NA	NA
WP_159929327.1|319619_320498_-	ammonia monooxygenase	NA	NA	NA	NA	NA
WP_159929328.1|323670_324963_+	NDMA-dependent methanol dehydrogenase	NA	NA	NA	NA	NA
WP_159929329.1|325023_326244_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_159929330.1|326247_327774_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_159929331.1|327909_328347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929332.1|328343_329711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082359731.1|331177_332872_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_054246178.1|332868_333681_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.1	2.5e-23
WP_159929333.1|335930_336938_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	40.1	1.5e-46
WP_159929334.1|341570_342992_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_159929336.1|342994_343690_+	response regulator	NA	NA	NA	NA	NA
WP_159929338.1|345487_346351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929340.1|346357_346747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929342.1|346700_347267_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159929344.1|348912_349962_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_159929346.1|350600_350843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929348.1|351010_351535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929350.1|351589_352237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929352.1|352237_352942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929354.1|352994_353528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929356.1|353539_354193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929358.1|354189_354642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929360.1|355175_355589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929362.1|357351_358029_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_159929364.1|358028_359153_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_159929366.1|359149_359539_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	48.1	6.1e-12
WP_159929368.1|359616_360192_-	DinB family protein	NA	NA	NA	NA	NA
WP_159929511.1|360249_360573_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_159929512.1|363993_365193_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_082359752.1|365393_366422_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054246426.1|366418_366757_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054246427.1|366783_366978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054246428.1|366925_369094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929370.1|369250_370612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929372.1|370521_371049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929374.1|371154_373200_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_159929376.1|373196_373529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929513.1|373705_374002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054248223.1|374060_375320_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	29.9	1.1e-30
WP_159929378.1|375454_376318_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	1.3e-17
WP_159929380.1|376317_377229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929382.1|378121_379231_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP046575	Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence	353952	191113	245817	353952	integrase,protease	Gordonia_phage(37.5%)	34	222283:222307	250037:250061
WP_159929768.1|191113_192031_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_159929770.1|192027_192552_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_159929772.1|193369_194308_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_159929774.1|195084_195888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929776.1|196096_196897_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_159929778.1|197168_198566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929780.1|199907_201695_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	40.4	5.6e-12
WP_159929782.1|202436_204203_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	37.5	1.1e-10
WP_159929784.1|204640_205372_-	DUF3105 domain-containing protein	NA	NA	NA	NA	NA
WP_159929970.1|205981_207277_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_159929786.1|207740_208700_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_159929788.1|208696_209077_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_159929790.1|209597_209813_+	heavy metal transporter	NA	NA	NA	NA	NA
WP_159929792.1|209935_211852_+	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_159929794.1|212429_212927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929796.1|216295_216685_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_159929798.1|217063_217207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929800.1|217249_218197_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_159929802.1|218193_218562_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_159929804.1|218801_219137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929806.1|220267_220666_+	DUF2784 family protein	NA	NA	NA	NA	NA
222283:222307	attL	CGATCGCCGACCATATGCGCACCGA	NA	NA	NA	NA
WP_159929808.1|223161_224685_-	NlpC/P60 family protein	NA	A0A0K0NL58	Gordonia_phage	45.6	2.0e-18
WP_159929972.1|229296_229623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929810.1|234029_234701_+	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	54.6	1.4e-24
WP_159929812.1|235578_235923_-	hypothetical protein	NA	A0A1B3AZW1	Gordonia_phage	32.7	1.7e-05
WP_159929974.1|235919_236171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929814.1|236248_238249_-	cutinase family protein	NA	A0A166Y6Q9	Gordonia_phage	32.5	9.8e-05
WP_159929816.1|238464_239262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929818.1|239261_241094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929819.1|241095_241428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929820.1|241726_242464_+	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	45.7	3.5e-53
WP_159929821.1|242624_243857_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159929822.1|243853_244789_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159929823.1|244785_245817_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D2W4Z2	Ralstonia_phage	24.9	5.0e-05
250037:250061	attR	TCGGTGCGCATATGGTCGGCGATCG	NA	NA	NA	NA
>prophage 2
NZ_CP046575	Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence	353952	249663	286987	353952	integrase,transposase,protease	Bacillus_phage(22.22%)	41	239554:239573	291037:291056
239554:239573	attL	GCGATGATCGCCGCACGCCA	NA	NA	NA	NA
WP_159929600.1|249663_250922_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.7	9.4e-30
WP_159929826.1|250931_252161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929828.1|252157_252355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929976.1|252878_254110_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.2	3.4e-32
WP_159929830.1|254102_255197_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_159929832.1|255208_256468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929834.1|256464_257553_-	AAA family ATPase	NA	A0A0M7QAZ4	Escherichia_phage	29.0	4.2e-18
WP_159929978.1|258100_258835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043791394.1|259222_259570_+	Lsr2 family protein	NA	A0A160DEV0	Gordonia_phage	35.3	1.7e-13
WP_005569781.1|259771_260038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043791389.1|260034_260364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929836.1|260353_260860_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005569777.1|260976_261501_+	DUF2441 domain-containing protein	NA	A0A142K9J4	Gordonia_phage	35.0	3.3e-13
WP_159929838.1|261990_262260_-	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	62.9	1.9e-17
WP_159929840.1|262743_263376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929842.1|263404_264130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929844.1|264126_264993_-	hypothetical protein	NA	A0A0N7CDP5	Skermania_phage	34.8	8.8e-27
WP_159929846.1|264992_265409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159927971.1|265873_266476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159927973.1|266472_269109_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_087560597.1|269090_270272_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159929848.1|270945_271800_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0N7CD74	Skermania_phage	30.0	5.1e-19
WP_159929850.1|271986_272412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929852.1|272618_272759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061042814.1|272976_273333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929854.1|273548_273695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929856.1|273861_274473_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_159929980.1|275018_275723_-	DUF1524 domain-containing protein	NA	NA	NA	NA	NA
WP_159929982.1|275777_276335_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_159929858.1|276502_276919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929860.1|277047_277995_-	peptidoglycan endopeptidase	NA	A0A1J0GW44	Streptomyces_phage	47.0	2.2e-15
WP_159929862.1|278267_278462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929864.1|278518_279406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929866.1|279405_280443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929868.1|280882_281836_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_159929870.1|282297_282633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929872.1|282742_283621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929874.1|283685_284549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159929876.1|284787_285315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929878.1|285414_286005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159929880.1|286171_286987_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
291037:291056	attR	GCGATGATCGCCGCACGCCA	NA	NA	NA	NA
