The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044549	Hydrogenophaga sp. BPS33 chromosome, complete genome	6325781	476910	483763	6325781		Enterobacteria_phage(42.86%)	8	NA	NA
WP_159588943.1|476910_477600_-	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.9	1.0e-09
WP_159596782.1|477625_478717_-	aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.0	1.4e-42
WP_159588945.1|478727_479096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159588947.1|479105_480284_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.8	1.2e-15
WP_159588949.1|480333_480888_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.5	2.3e-49
WP_159588951.1|480884_481778_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.6	1.5e-98
WP_159588953.1|481796_482696_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	32.0	1.3e-20
WP_159588956.1|482692_483763_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	48.8	7.1e-87
>prophage 2
NZ_CP044549	Hydrogenophaga sp. BPS33 chromosome, complete genome	6325781	1499798	1545501	6325781	transposase,integrase	Leptospira_phage(40.0%)	33	1500307:1500366	1528376:1528668
WP_159590746.1|1499798_1499993_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
1500307:1500366	attL	CGGTGGAGGAAGGCGTGAGCGCACTCGTCTCACCGACTTTTGAAGATGTCGATCCTCCAA	NA	NA	NA	NA
WP_159590482.1|1500637_1501725_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	7.1e-42
WP_159590748.1|1503750_1504389_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_159590750.1|1504750_1505503_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_159590752.1|1505499_1506645_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_159590754.1|1506648_1507137_+	acyl dehydratase	NA	NA	NA	NA	NA
WP_159590756.1|1507143_1509288_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_159590758.1|1509281_1510049_+	citryl-CoA lyase	NA	NA	NA	NA	NA
WP_159590760.1|1510201_1510942_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159590762.1|1511173_1512721_-	acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	30.9	1.1e-08
WP_159590764.1|1513003_1513885_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_159590766.1|1513895_1515020_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_159590768.1|1515335_1516124_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_159590770.1|1516144_1517317_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_159590772.1|1517319_1518111_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_159590774.1|1518432_1519872_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_159590776.1|1521270_1523439_-	prepilin peptidase	NA	V5LQX0	Emiliania_huxleyi_virus	49.2	8.1e-05
WP_159590777.1|1523456_1524626_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_159590778.1|1524983_1525835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159590779.1|1526432_1527626_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_159596851.1|1527633_1528347_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.1	5.3e-22
WP_159590780.1|1529149_1531255_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
1528376:1528668	attR	CGGTGGAGGAAGGCGTGAGCGCACTCGTCTCACCGACTTTTGAAGATGTCGATCCTCCAAGAATTGTGAAAAACGAAAGAATGAGCGTGAACTTGCGCTTTGCGGACAGCTTTCAAAAAGGCGCGCGCGCACGCGAATACCACTTGCGTGGAAATGCAGCATTTCTGCGGTATGAAATACTCCCTGCGGTGAGACTGGATACTCGTAGAGGTTCATGGCTCTCCACCGAGAGATTAAATCCGTCACTGCATCGGGTCGCTGCGTGTGTGCGCGGGAGAACGACGTGTGGGAAG	NA	NA	NA	NA
WP_159590781.1|1531251_1532979_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_159590782.1|1532989_1533955_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_159590783.1|1533965_1535357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159590784.1|1535378_1536302_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159590785.1|1536532_1537468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159590787.1|1537516_1538992_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_159590788.1|1539000_1540404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159590790.1|1540413_1541799_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_159590792.1|1541979_1542840_+	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
WP_159590794.1|1543164_1544523_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_159590796.1|1544661_1545501_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	3.5e-81
>prophage 3
NZ_CP044549	Hydrogenophaga sp. BPS33 chromosome, complete genome	6325781	2036417	2094369	6325781	tail,tRNA,protease,plate	uncultured_Mediterranean_phage(50.0%)	46	NA	NA
WP_159596881.1|2036417_2037203_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_159592033.1|2037265_2039896_-	fimbrial protein FimV	NA	NA	NA	NA	NA
WP_159592036.1|2040148_2041276_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_159592039.1|2041353_2042439_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_159592042.1|2042561_2043209_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_159592045.1|2043224_2043386_-	entericidin EcnAB	NA	NA	NA	NA	NA
WP_159592048.1|2043425_2044847_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_159592051.1|2044875_2045802_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159592054.1|2045983_2047279_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_159592057.1|2047275_2047593_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_159592060.1|2047615_2048320_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_159592063.1|2048423_2050229_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_159592066.1|2050233_2050599_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_159592069.1|2050651_2051083_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_159592072.1|2051237_2052038_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_159592075.1|2052254_2053241_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_159596882.1|2053330_2054239_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_159592078.1|2054300_2056904_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_159592081.1|2057054_2057864_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159592084.1|2057999_2058410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159592087.1|2058532_2058691_+	DUF3309 family protein	NA	NA	NA	NA	NA
WP_159592090.1|2058795_2061663_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_159592093.1|2061715_2062627_+|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.1	4.3e-08
WP_159592096.1|2062656_2063658_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_159596883.1|2063660_2064737_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_159596884.1|2064760_2065813_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_159592099.1|2065932_2069520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159592102.1|2069638_2070094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159592105.1|2070151_2072257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159592108.1|2072307_2073540_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_159592111.1|2073581_2074592_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_159592114.1|2074615_2080225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159592117.1|2081651_2081837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159592120.1|2082492_2082951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159592123.1|2083324_2083915_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_159592126.1|2083911_2084733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159592129.1|2084802_2086572_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	28.5	6.8e-50
WP_159592132.1|2086603_2087047_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_159592135.1|2087066_2088692_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_159592138.1|2088691_2089330_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_159592141.1|2089333_2090338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159592144.1|2090365_2090539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159592147.1|2090552_2091644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159592150.1|2091640_2092327_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_159592153.1|2092333_2093983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159592156.1|2093979_2094369_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
>prophage 4
NZ_CP044549	Hydrogenophaga sp. BPS33 chromosome, complete genome	6325781	4564843	4624580	6325781	transposase	Escherichia_phage(22.22%)	39	NA	NA
WP_159590796.1|4564843_4565683_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	3.5e-81
WP_159595278.1|4565694_4565979_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159595279.1|4566109_4567159_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_159595280.1|4567444_4568284_-	response regulator	NA	NA	NA	NA	NA
WP_159595281.1|4568283_4572357_-	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	40.9	1.7e-40
WP_159595282.1|4573295_4575185_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_159597034.1|4575372_4575747_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_159595283.1|4575898_4576327_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_159595284.1|4576595_4577318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159591368.1|4577502_4578724_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	38.8	1.8e-49
WP_159595285.1|4578999_4579575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159595286.1|4581492_4585098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159595287.1|4585411_4586335_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_159595288.1|4586359_4586548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159595289.1|4586549_4586981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159595290.1|4587094_4587640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159595291.1|4587823_4588267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159595292.1|4588358_4589195_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	39.5	5.5e-42
WP_159595293.1|4589615_4592417_+	UvrD-helicase domain-containing protein	NA	A0A1V0SAV1	Catovirus	23.5	7.5e-11
WP_159595294.1|4592413_4593745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159595295.1|4593741_4600008_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_159595296.1|4600004_4600640_-	4Fe-4S cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_159595297.1|4600636_4602445_-	AAA domain-containing protein	NA	A0A2L0V0F4	Agrobacterium_phage	32.9	5.7e-36
WP_159595298.1|4602474_4603587_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_159595299.1|4604495_4606106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159595300.1|4606047_4606728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159595301.1|4606731_4607595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159595302.1|4608265_4608838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159590482.1|4609234_4610322_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	7.1e-42
WP_159595303.1|4611374_4611863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597035.1|4612231_4613212_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	74.6	4.2e-126
WP_159595304.1|4613512_4617022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159595305.1|4617014_4617485_+	response regulator	NA	NA	NA	NA	NA
WP_159595306.1|4617481_4618729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159595307.1|4618775_4619237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159595308.1|4620520_4621297_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_159595309.1|4621283_4621505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159595310.1|4621497_4623120_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_159590431.1|4623348_4624580_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	83.6	4.0e-134
>prophage 5
NZ_CP044549	Hydrogenophaga sp. BPS33 chromosome, complete genome	6325781	5813085	5821231	6325781		Acinetobacter_phage(50.0%)	8	NA	NA
WP_159589020.1|5813085_5814276_-	elongation factor Tu	NA	M4M9V7	Vibrio_phage	70.6	2.0e-05
WP_159596312.1|5814782_5815514_-	uracil-DNA glycosylase	NA	A0A286RUF9	Beluga_whale_alphaherpesvirus	57.9	4.5e-48
WP_159596313.1|5815521_5816322_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	51.3	7.2e-60
WP_159596314.1|5816336_5817389_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	46.7	7.0e-79
WP_159596315.1|5817404_5818043_-	LysE family transporter	NA	NA	NA	NA	NA
WP_159596316.1|5818056_5819130_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_159596317.1|5819126_5819735_-	anthranilate/aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	63.4	3.6e-67
WP_159596318.1|5819731_5821231_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	29.6	3.5e-39
>prophage 1
NZ_CP044550	Hydrogenophaga sp. BPS33 plasmid pBPS33-1, complete sequence	339634	82505	149879	339634	transposase	Shigella_phage(28.57%)	56	NA	NA
WP_159595278.1|82505_82790_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	49.4	6.2e-14
WP_159590796.1|82801_83641_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	3.5e-81
WP_159597175.1|84585_85962_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	9.3e-39
WP_159590796.1|86330_87170_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	3.5e-81
WP_159595278.1|87181_87466_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	49.4	6.2e-14
WP_159597246.1|87937_88972_+	porin	NA	NA	NA	NA	NA
WP_159597247.1|90407_90752_+	CzcE family metal-binding protein	NA	NA	NA	NA	NA
WP_159597248.1|91072_91765_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	3.0e-30
WP_159597249.1|91819_93151_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	22.3	1.1e-12
WP_159597250.1|93162_93447_-	CopK family periplasmic copper-binding protein	NA	NA	NA	NA	NA
WP_159597251.1|93574_95122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597252.1|95542_96532_+	porin	NA	NA	NA	NA	NA
WP_159597253.1|96664_97012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597254.1|96992_97679_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	2.8e-28
WP_159597255.1|97675_99010_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_159597256.1|99235_99580_+	CzcE family metal-binding protein	NA	NA	NA	NA	NA
WP_159597257.1|99683_102158_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	39.6	4.9e-115
WP_159597258.1|102492_103548_+	porin	NA	NA	NA	NA	NA
WP_159597259.1|103707_104460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597260.1|105222_107295_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_159597261.1|107688_108030_+	CzcE family metal-binding protein	NA	NA	NA	NA	NA
WP_159597262.1|108256_109531_+	TolC family protein	NA	NA	NA	NA	NA
WP_159597415.1|109556_110843_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_159597263.1|110855_114062_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	24.4	7.1e-74
WP_159597264.1|114304_114991_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	9.7e-29
WP_137922426.1|117200_118595_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_159597265.1|118956_119283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597266.1|119514_119871_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_159597267.1|119851_120241_-	addiction module toxin RelE	NA	NA	NA	NA	NA
WP_159597268.1|120257_120479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597269.1|120686_120965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597270.1|121674_123546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597271.1|123542_124058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597272.1|124045_125047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597273.1|125385_126675_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_159597274.1|127244_128051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597275.1|128394_130905_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_159597276.1|130969_133318_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_159597277.1|133912_134722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597278.1|134746_136738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597279.1|136780_137008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597280.1|137316_138273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597281.1|138315_138522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597282.1|138863_139187_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_159597283.1|139176_139560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_159597416.1|141069_141339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597284.1|141579_142176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597285.1|142168_143218_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_159597286.1|143373_144060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597287.1|144178_145429_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	35.4	1.1e-17
WP_159597288.1|145741_145960_-	hypothetical protein	NA	Q6QIC9	Burkholderia_phage	46.2	5.1e-08
WP_159597289.1|146601_147072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597290.1|147135_147567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597291.1|147909_148125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597292.1|148268_148685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597293.1|148743_149879_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.5	9.3e-53
>prophage 2
NZ_CP044550	Hydrogenophaga sp. BPS33 plasmid pBPS33-1, complete sequence	339634	161571	228982	339634	transposase	Salmonella_phage(83.33%)	53	NA	NA
WP_003049965.1|161571_164487_-|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
WP_159597306.1|164601_164955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597307.1|165002_165827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597417.1|165798_166707_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_159597308.1|166944_167886_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_159597309.1|167963_168917_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_159597310.1|168991_170272_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_159597311.1|170361_170841_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159597312.1|170868_171204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597313.1|171217_172087_-	UPF0280 family protein	NA	NA	NA	NA	NA
WP_003158660.1|172380_175296_-|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
WP_159597306.1|175410_175764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597307.1|175811_176636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597308.1|177754_178696_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_159597309.1|178773_179727_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_159597310.1|179800_181081_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_159597311.1|181170_181650_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159597312.1|181677_182013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597313.1|182026_182896_-	UPF0280 family protein	NA	NA	NA	NA	NA
WP_159597306.1|186223_186577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597307.1|186624_187449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597417.1|187420_188329_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_159597308.1|188566_189508_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_159597309.1|189585_190539_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_159597310.1|190613_191894_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_159597311.1|191983_192463_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159597312.1|192490_192826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597313.1|192839_193709_-	UPF0280 family protein	NA	NA	NA	NA	NA
WP_003049965.1|194002_196918_-|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
WP_159597314.1|197461_198211_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_159597315.1|198222_199158_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_159597316.1|200751_201896_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.4	9.8e-42
WP_028604925.1|203721_204528_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159597317.1|204634_205615_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_028604927.1|205642_206806_+	butyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_159597318.1|206819_207593_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_159597319.1|207589_208729_+	thiolase family protein	NA	NA	NA	NA	NA
WP_159597320.1|208738_209146_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_159597321.1|209135_210356_+	CoA transferase	NA	NA	NA	NA	NA
WP_159597322.1|211968_212646_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_028604935.1|212654_213293_+	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
WP_028604936.1|213966_214800_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003049965.1|215257_218173_-|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
WP_159597306.1|218287_218641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597307.1|218688_219513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159597417.1|219484_220393_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_159597308.1|220630_221572_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_159597309.1|221649_222603_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_159597310.1|222677_223958_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_159597311.1|224047_224527_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159597312.1|224554_224890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597313.1|224903_225773_-	UPF0280 family protein	NA	NA	NA	NA	NA
WP_003049965.1|226066_228982_-|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
>prophage 1
NZ_CP044551	Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence	106879	13997	81894	106879	transposase	Salmonella_phage(44.44%)	51	NA	NA
WP_003158660.1|13997_16913_+|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
WP_053281476.1|17970_19035_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	29.5	3.0e-37
WP_053281475.1|19894_20809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053281474.1|20985_21192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597433.1|21629_23168_+|transposase	IS91-like element ISPps1 family transposase	transposase	NA	NA	NA	NA
WP_159597434.1|23838_24879_+	EamA family transporter	NA	NA	NA	NA	NA
WP_159597435.1|24995_26414_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_159597436.1|32197_32602_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	43.2	3.1e-27
WP_068673276.1|32619_33126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083944095.1|33171_33480_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068673274.1|33931_34630_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_068673272.1|34622_35801_-	muconate cycloisomerase family protein	NA	NA	NA	NA	NA
WP_068673271.1|35802_36882_-	maleylacetate reductase	NA	NA	NA	NA	NA
WP_068673269.1|36891_37227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083944094.1|37240_37789_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_159597437.1|37847_38795_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_068673263.1|39178_39925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597438.1|40427_41075_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003158660.1|41193_44109_+|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
WP_032490114.1|44394_45408_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_083944717.1|45419_46064_-	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_159597439.1|46060_47410_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_159597440.1|47446_48208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159597441.1|48326_49805_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_068685872.1|50082_52431_+	indolepyruvate ferredoxin oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_011114060.1|57067_58117_-	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	31.2	3.2e-07
WP_011114061.1|58113_58878_-	ParA family protein	NA	NA	NA	NA	NA
WP_011114062.1|58874_59183_-	KorA protein	NA	NA	NA	NA	NA
WP_011114064.1|59289_59619_-	DUF2761 domain-containing protein	NA	NA	NA	NA	NA
WP_011114065.1|59620_59947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011114066.1|60155_60392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011114067.1|60549_60807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011114068.1|60823_62032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011296181.1|62043_62307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011114069.1|62306_62735_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	38.8	6.3e-10
WP_011114070.1|62907_63171_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_011114071.1|63157_63439_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003049965.1|64155_67071_+|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
WP_068683781.1|67316_67943_-	lytic transglycosylase domain-containing protein	NA	I1VXB7	Halocynthia_phage	43.4	5.9e-09
WP_083944708.1|67930_68569_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_083944709.1|68498_68729_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068683784.1|68915_69194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068683789.1|69268_69502_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068683790.1|69510_70020_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_068683792.1|70266_71133_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_068683794.1|71129_71735_-	autoinducer synthase	NA	NA	NA	NA	NA
WP_083944710.1|71808_72594_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159597442.1|72750_74460_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_159597443.1|74491_75316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068685872.1|75593_77942_+	indolepyruvate ferredoxin oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_003158660.1|78978_81894_+|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
