The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047393	Pontibacillus sp. HMF3514 chromosome, complete genome	3976892	305615	354934	3976892	tRNA,protease,integrase	Bacillus_phage(23.08%)	44	321326:321346	374639:374659
WP_160104488.1|305615_306074_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_160098536.1|306070_306766_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_160104489.1|306771_307218_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_160098538.1|307214_308231_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.9	8.6e-66
WP_160098540.1|308499_309540_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	64.0	1.3e-125
WP_160098542.1|309555_311793_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	66.2	3.0e-297
WP_160098544.1|312272_314204_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.4	8.1e-57
WP_160098546.1|314485_314965_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_160104490.1|314984_315650_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_160098548.1|315808_317218_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_160098550.1|317365_317905_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160104491.1|318002_318212_-	DUF4305 domain-containing protein	NA	NA	NA	NA	NA
WP_160098552.1|318217_318922_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_160098554.1|319294_319579_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	49.5	3.9e-16
WP_160098556.1|319640_321275_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	55.7	1.4e-155
321326:321346	attL	AAATGCTAACATTTTGCTAAC	NA	NA	NA	NA
WP_027447339.1|321356_322568_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	53.2	1.3e-113
WP_160098558.1|323057_330185_+	DNRLRE domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	2.6e-07
WP_160098560.1|330200_330599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160098562.1|332079_333750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160098564.1|333815_334418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160098566.1|335071_335986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027447685.1|336212_336419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027447683.1|337108_337951_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.0	2.2e-27
WP_027447682.1|338073_338535_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027447681.1|338552_339059_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_027447680.1|339220_339436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036843975.1|339524_340178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027447694.1|340442_340919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027447695.1|341227_341971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160098568.1|342355_342784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036843669.1|342984_343407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027447697.1|343655_343862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027447698.1|344034_345084_-	DUF4030 domain-containing protein	NA	NA	NA	NA	NA
WP_027447699.1|345073_345604_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_027447700.1|346028_346481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027447701.1|346808_347294_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_027447702.1|347325_347787_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_027447703.1|347833_348436_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_027447704.1|348480_349137_+	phosphoribulokinase	NA	L7RCC2	Acanthamoeba_polyphaga_moumouvirus	26.9	4.2e-05
WP_036842025.1|349355_349628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027446303.1|349852_351067_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	52.7	2.3e-113
WP_027446304.1|351333_351567_-	helix-turn-helix domain-containing protein	NA	A0A0C5AN65	Paenibacillus_phage	56.2	1.1e-11
WP_027446305.1|352223_353798_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_027446306.1|353773_354934_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	22.8	2.0e-10
374639:374659	attR	AAATGCTAACATTTTGCTAAC	NA	NA	NA	NA
>prophage 2
NZ_CP047393	Pontibacillus sp. HMF3514 chromosome, complete genome	3976892	449650	459668	3976892		Prochlorococcus_phage(33.33%)	10	NA	NA
WP_160098691.1|449650_450142_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.0	3.3e-23
WP_160098693.1|450128_451274_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_160098695.1|451279_451999_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	40.4	5.0e-36
WP_160098697.1|451991_452243_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_160098699.1|452239_452923_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_160098701.1|452906_455132_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	38.6	1.3e-143
WP_160098703.1|455107_456520_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.6	1.3e-51
WP_160098705.1|456532_457555_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.9	2.4e-71
WP_160098707.1|457551_458157_+	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_160098709.1|458129_459668_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.5	1.1e-77
>prophage 3
NZ_CP047393	Pontibacillus sp. HMF3514 chromosome, complete genome	3976892	2107168	2157358	3976892	coat,tRNA,protease	Bacillus_phage(22.22%)	58	NA	NA
WP_160101655.1|2107168_2108371_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	49.8	1.7e-44
WP_160101657.1|2108383_2109523_-	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_160101659.1|2109527_2109941_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_160101661.1|2109955_2110756_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_160104596.1|2110748_2111108_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_160101663.1|2111332_2112217_+	DUF2179 domain-containing protein	NA	M1Q1P6	Streptococcus_phage	43.7	3.7e-65
WP_160101665.1|2112632_2112791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160101667.1|2113185_2113869_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
WP_160101669.1|2113941_2114736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160104597.1|2114802_2115390_-	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_160101671.1|2115486_2116260_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_160101673.1|2116294_2116969_-	cytochrome b6	NA	NA	NA	NA	NA
WP_160101675.1|2116972_2117488_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_160101677.1|2117621_2118089_-	DUF2487 family protein	NA	NA	NA	NA	NA
WP_081673029.1|2118218_2118767_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	48.0	7.4e-40
WP_160101679.1|2118814_2120071_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_160101681.1|2120083_2120962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160101683.1|2121017_2122316_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_160101685.1|2122345_2123446_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	28.2	6.8e-24
WP_160101687.1|2123527_2124616_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_160101689.1|2124615_2125782_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.4	9.6e-45
WP_160101691.1|2125899_2126673_-	methyltransferase	NA	NA	NA	NA	NA
WP_027447430.1|2126802_2127249_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.8	6.3e-29
WP_160101693.1|2127345_2128323_-	heptaprenyl diphosphate synthase component II	NA	NA	NA	NA	NA
WP_160101695.1|2128334_2129066_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_160101697.1|2129069_2129867_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_027447426.1|2130188_2130422_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_036843149.1|2130533_2130806_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	74.4	2.5e-28
WP_160101699.1|2131280_2132759_-	stage IV sporulation protein A	NA	NA	NA	NA	NA
WP_160101701.1|2133009_2133732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160101703.1|2133753_2133951_-	DUF2768 family protein	NA	NA	NA	NA	NA
WP_160101705.1|2134912_2135167_-	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_160101707.1|2135356_2136379_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_160101709.1|2136394_2137705_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_160101711.1|2137899_2138502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160101713.1|2138610_2138745_+	YpzI family protein	NA	NA	NA	NA	NA
WP_160101715.1|2138833_2139865_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_160104598.1|2139880_2141008_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_160101717.1|2141115_2141697_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_160101719.1|2141709_2142384_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_160101721.1|2142531_2142732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160101723.1|2142788_2143454_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_160101725.1|2143589_2144927_-	germination protein YpeB	NA	NA	NA	NA	NA
WP_160101727.1|2144945_2145767_-	spore cortex-lytic enzyme	NA	A0A172JHR8	Bacillus_phage	44.2	5.6e-23
WP_160101729.1|2146532_2147222_-|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_160101731.1|2147312_2148281_+	asparaginase	NA	NA	NA	NA	NA
WP_160101733.1|2148439_2149417_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_160101735.1|2149516_2150797_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_160101737.1|2151175_2151757_-	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_160101739.1|2151870_2152779_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.1e-07
WP_160101741.1|2152872_2153607_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_160101743.1|2153607_2153991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160101745.1|2154049_2154682_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_160101747.1|2154848_2155064_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_160101749.1|2155060_2155324_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_160101752.1|2155371_2155941_+|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
WP_160101755.1|2156109_2156772_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_160101758.1|2156776_2157358_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP047393	Pontibacillus sp. HMF3514 chromosome, complete genome	3976892	3224680	3232676	3976892		Streptococcus_phage(33.33%)	9	NA	NA
WP_081672930.1|3224680_3225292_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.4	1.8e-55
WP_160104670.1|3225346_3226120_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_160103627.1|3226119_3227073_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.8	4.8e-18
WP_160103629.1|3227388_3227643_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_160103631.1|3227800_3228748_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.2	2.3e-52
WP_160103633.1|3228801_3229779_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	35.1	4.7e-53
WP_160103635.1|3229782_3230667_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.8	1.3e-06
WP_160103637.1|3230681_3231155_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_160103639.1|3231728_3232676_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.9	9.7e-88
