The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	4502	83677	4632948	tRNA,transposase	Escherichia_phage(22.22%)	57	NA	NA
WP_076611341.1|4502_5420_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315394.1|7008_7815_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_088814226.1|7894_9394_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_005315396.1|9694_10132_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_159364526.1|11046_11643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042467892.1|12312_15204_-	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_058406839.1|15252_16014_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_088814343.1|16256_17393_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|18457_19375_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315093.1|20149_21730_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_005315094.1|21834_22416_+	thymidine kinase	NA	A0A0F6TIQ8	Escherichia_coli_O157_typing_phage	52.7	1.6e-48
WP_011898640.1|23964_24426_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_159364527.1|25119_26223_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.1	7.5e-31
WP_159364528.1|26834_27026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|27048_27966_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364529.1|29814_30948_+	hydrogenase 2 small subunit	NA	NA	NA	NA	NA
WP_159364530.1|30950_31958_+	hydrogenase 2 operon protein HybA	NA	A0A077SL61	Escherichia_phage	29.4	7.1e-20
WP_005315106.1|31950_33138_+	Ni/Fe-hydrogenase cytochrome b subunit	NA	NA	NA	NA	NA
WP_005315108.1|33134_34838_+	hydrogenase 2 large subunit	NA	NA	NA	NA	NA
WP_042468245.1|34837_35338_+	HyaD/HybD family hydrogenase maturation endopeptidase	NA	NA	NA	NA	NA
WP_005315112.1|35319_35847_+	hydrogenase-2 assembly chaperone	NA	NA	NA	NA	NA
WP_088814218.1|35962_37570_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011898645.1|37554_38565_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005315119.1|38554_39370_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_042468243.1|39363_40152_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	32.6	1.5e-09
WP_005315125.1|40151_40793_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_042468242.1|41009_42065_-	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_005315136.1|42066_42408_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_159364531.1|42417_43422_-	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_159364532.1|43507_44626_-	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_005315143.1|44619_44871_-	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_042468241.1|44876_47303_-	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_042468240.1|47299_49219_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.7e-14
WP_005315148.1|49223_50693_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_005315151.1|51265_51757_-	hydrogenase maturation peptidase HycI	NA	NA	NA	NA	NA
WP_005315153.1|51756_52170_-	HycH family protein	NA	NA	NA	NA	NA
WP_159364533.1|52162_52978_-	NADH-quinone oxidoreductase subunit NuoB	NA	NA	NA	NA	NA
WP_042468239.1|52977_53535_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_005315165.1|53544_55263_-	hydrogenase large subunit	NA	NA	NA	NA	NA
WP_011898650.1|55342_56296_-	hydrogenase 3 membrane subunit	NA	NA	NA	NA	NA
WP_042468238.1|56297_58181_-	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
WP_042468237.1|58180_58876_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_159364534.1|59412_61281_-	low affinity potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	31.3	4.9e-67
WP_076611341.1|61539_62457_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364535.1|63263_63422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|63451_64369_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364953.1|64743_65958_-|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
WP_088814405.1|66023_67286_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005321603.1|67485_67911_-	chaperonin	NA	NA	NA	NA	NA
WP_034283822.1|68107_69499_+	T3SS effector protein-tyrosine-phosphatase AopH	NA	NA	NA	NA	NA
WP_076611341.1|70332_71250_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_085941484.1|72065_73216_-|transposase	IS3-like element ISAs32 family transposase	transposase	U5P429	Shigella_phage	63.4	3.1e-96
WP_085941483.1|73963_75241_-	ROK family protein	NA	NA	NA	NA	NA
WP_159364537.1|75182_76328_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_088814201.1|76337_77138_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_058406585.1|79004_81668_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_005309688.1|82015_83677_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	79.5	7.8e-266
>prophage 2
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	483417	591684	4632948	integrase,protease,transposase	Burkholderia_virus(14.29%)	91	564679:564693	593317:593331
WP_076611341.1|483417_484335_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005311027.1|486395_486887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005311031.1|487119_487317_+	DUF4250 domain-containing protein	NA	NA	NA	NA	NA
WP_159364601.1|487704_490182_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	47.1	2.0e-15
WP_017412837.1|490245_491631_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_005311038.1|491795_492224_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	37.6	9.7e-11
WP_159364602.1|492365_495179_+	response regulator	NA	A0A1V0SGX0	Hokovirus	34.7	6.7e-68
WP_005311041.1|497108_498860_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.7	1.0e-45
WP_085941617.1|498979_499489_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_005311045.1|499634_499868_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_159364603.1|500043_500448_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_159364604.1|500444_502229_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_005311051.1|502322_502673_-	phasin family protein	NA	NA	NA	NA	NA
WP_005311053.1|502990_503554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011898780.1|503632_504388_+	DUF429 domain-containing protein	NA	NA	NA	NA	NA
WP_034281663.1|504765_505629_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_159364605.1|505653_505995_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005311062.1|506112_507231_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_159364606.1|507476_507983_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011898778.1|508179_508611_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_005311069.1|508597_509110_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_159364966.1|509189_509450_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|509468_510386_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364607.1|510882_511191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005311073.1|511232_512078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005311075.1|512217_512550_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	56.7	2.0e-27
WP_005311077.1|512654_513038_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005311079.1|513070_513517_+	acetyltransferase	NA	NA	NA	NA	NA
WP_159364608.1|513588_514980_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.1	2.0e-49
WP_005311083.1|515208_515685_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	33.3	2.1e-14
WP_159364967.1|515866_516571_+	SM-20 protein	NA	NA	NA	NA	NA
WP_159364609.1|516762_517752_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_005311088.1|517814_518228_-	VOC family protein	NA	NA	NA	NA	NA
WP_005311089.1|518393_519158_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005311090.1|519356_520136_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_005311091.1|520184_521072_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005311094.1|523269_524907_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_017412051.1|525098_525818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364610.1|525904_527968_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_017413057.1|531160_531841_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_155268755.1|531916_532060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814343.1|532556_533693_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|533964_534882_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|535034_535952_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005311113.1|536109_536451_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_005311115.1|537125_538013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364613.1|538023_538932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814108.1|539838_540756_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_034283822.1|541011_542403_+	T3SS effector protein-tyrosine-phosphatase AopH	NA	NA	NA	NA	NA
WP_159364614.1|543016_544048_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005315454.1|544211_544583_+	VOC family protein	NA	NA	NA	NA	NA
WP_011898674.1|544855_545254_+	GFA family protein	NA	NA	NA	NA	NA
WP_005315459.1|545275_545560_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005315464.1|547057_547582_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_005315466.1|547664_548600_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005315468.1|548612_549701_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	45.6	7.5e-84
WP_159364615.1|549821_550664_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005315472.1|550987_552391_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.5	3.4e-44
WP_005315475.1|552503_553193_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_159364616.1|553192_553597_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|554061_554979_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005322157.1|555154_555568_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_011898689.1|555726_557703_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_005315696.1|557783_558344_+	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_010674759.1|558417_558594_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_005315688.1|558756_560391_-	DUF3466 family protein	NA	NA	NA	NA	NA
WP_011898688.1|560399_562310_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.7	3.2e-53
WP_005315677.1|562381_562621_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_085941607.1|562620_564789_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	28.2	1.9e-14
564679:564693	attL	GCCGGCGACAGTCTC	NA	NA	NA	NA
WP_076611341.1|565494_566412_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042467334.1|566854_567181_+	helix-turn-helix transcriptional regulator	NA	Q6J1N3	Burkholderia_virus	33.0	2.7e-05
WP_088814376.1|567579_567828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042467337.1|568572_568851_+	hypothetical protein	NA	A4JWW9	Burkholderia_virus	44.6	1.8e-10
WP_017411731.1|569164_570442_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159364619.1|571229_572126_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005311538.1|572174_574145_-	SDR family oxidoreductase	NA	A0A2C9DTC1	Eastern_grey_kangaroopox_virus	30.1	1.1e-08
WP_102665712.1|574390_574969_+	phasin family protein	NA	NA	NA	NA	NA
WP_159364620.1|575062_576247_+	patatin family protein	NA	NA	NA	NA	NA
WP_005311528.1|576928_577729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102665239.1|577808_579239_-	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_085941456.1|579542_579920_-	poly(3-hydroxybutyrate) depolymerase	NA	NA	NA	NA	NA
WP_005311522.1|580149_580893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005311521.1|580968_582414_-	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_159364621.1|582424_583552_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_159364622.1|583563_584439_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_005311519.1|584586_585219_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_005311518.1|585196_585805_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_159364623.1|585907_588460_+	MCE family protein	NA	NA	NA	NA	NA
WP_159364624.1|588591_590010_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_005311516.1|590213_590486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814231.1|590655_591684_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
593317:593331	attR	GAGACTGTCGCCGGC	NA	NA	NA	NA
>prophage 3
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	726801	768584	4632948	integrase,tRNA,transposase	Synechococcus_phage(100.0%)	32	748242:748301	768614:769678
WP_076611341.1|726801_727719_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364643.1|728641_729808_+	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
WP_102665693.1|729873_730638_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_159364969.1|730829_733103_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_159364644.1|734142_734907_-	siderophore ferric iron reductase	NA	NA	NA	NA	NA
WP_005310925.1|735002_737138_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_085941620.1|737430_738423_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005310923.1|738633_739374_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_021138227.1|739459_740365_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005310920.1|741547_742618_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_159364645.1|742714_743878_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_076611341.1|746376_747294_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011898763.1|747893_748205_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
748242:748301	attL	GGGCGTTGTTTCCTAAATCGATGCAGCTTGAATGGAACTAATTGAAAACCCAGTGATCTG	NA	NA	NA	NA
WP_076611341.1|748330_749248_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005311149.1|749597_750110_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_085941615.1|750322_750700_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	52.5	1.1e-15
WP_159364647.1|750952_755380_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_005311141.1|755407_756145_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_005311139.1|756125_757460_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_005311137.1|757553_758330_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_034281583.1|758458_759229_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_005311133.1|759364_760120_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_005311131.1|760267_761239_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_088814108.1|763556_764474_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017413136.1|764564_764873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320977.1|764894_765395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017413138.1|765421_765775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320982.1|765852_766266_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005320985.1|766262_766493_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017413139.1|766561_766948_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159368364.1|766860_767250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|767666_768584_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
768614:769678	attR	CAGATCACTGGGTTTTCAATTAGTTCCATTCAAGCTGCATCGATTTAGGAAACAACGCCCATGGGAGCCGTAAAAGTTGGTCACACACTTCTCGTAGTCTCCCGGCACCAGGGCCGAATAGGCGGTCTGAAAACCCACCAGCTCACATTCGAAGGAGTAACCGCCGGGTCTGTCTGGGTAGTACTTCCAGTTGCCATCCCAGTTGGTATAAAGCACATCAGTGGCGCCGTTCAGATTCAGGCTGCCGTAGGGGGTCTGCTGCCAGCAGGTGTTCTTCTCGTCGGCCTTGACGGGGATCTGGTAATGCTCGGCCAGCCCCTCCCAATAACGGATCCGGCTGACCGGTTGCCCCTTGTCCTTGTTTTGTTCACCACACTCTATGCCACCATTGATGACGTTGATGGTGGTGCCAAAGCCATAGCCGATGCCGGCCGCTATCTCGCGCTGGGAGGGCACCCAGGTGCGGTCAATCACATGCAGCATGGCGGGCTTGGGCGCCTGGGGGGTGAGGAAAAACCAGATGGCGGATGCCAGGTTCAACCAGGAGTCGGCCACCAGCCCCGGGTTGTTGAGCAGCACAGAGGCATCGCCGTCAAACATCGCCTCGGAGAAGGCGCCGTAATTGAAGTGATAAGAGAGCTGCTTTGCGCCGCGACCGAAATAGCCCTGCCCCGTACTGCAGGGCCACTTCTTGTTCTGCCAGTCATTTTGCCCGCACCCAGTGGTGTAACCCGCCTGCCCCTCTGACCAGCCCATTTCACGCACATGCACCAGTGCCTGTTGCCACTCCTCCAGCGCCAGCGGATTATCAGAAATATTGTCTTTGCTGATATGACCACCCGTCTCCTGGGAAAAATGGGCGAAGGCGGTCACTATGGATTTTTTGCAGATGGCATCCGAATCCCGACCATCGGTATATTCACCACAAAAAGCAGGGAATTTACCTATGGCCCGCAAGAATCGTTCATAGGTATATTCCGGCGCTGCCATCTGGGTTAAATATTCCCAGTCAGACTCCGTGAACACCCGCTCGACCCGTTTGACATTATCCGGGTTGCTGGCCGC	NA	NA	NA	NA
>prophage 4
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	890259	924631	4632948	bacteriocin,protease,tRNA,transposase	uncultured_Mediterranean_phage(18.18%)	29	NA	NA
WP_159364670.1|890259_891006_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_005310748.1|891229_892750_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	1.2e-87
WP_005310746.1|892771_893260_-|bacteriocin	bacteriocin production protein	bacteriocin	NA	NA	NA	NA
WP_005310745.1|893447_894743_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.0	7.5e-91
WP_017411682.1|895099_896443_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.2	3.4e-78
WP_042467874.1|896561_897170_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_159364671.1|897247_899773_-	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.6e-89
WP_005300047.1|899975_900467_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_073536599.1|901131_901323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310734.1|901541_902492_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.8	9.5e-59
WP_005310731.1|903899_904370_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005310730.1|904389_905097_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_159364672.1|905093_905798_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005300033.1|905866_906085_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005310727.1|906153_908406_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.1	1.2e-168
WP_005310725.1|908465_908783_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.1	5.3e-14
WP_005300025.1|909012_909231_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_005310722.1|909341_910205_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	30.9	8.7e-27
WP_005310720.1|910761_911013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941623.1|911063_911799_-|transposase	IS1-like element ISAs8 family transposase	transposase	A0A0U2RK18	Escherichia_phage	65.2	5.8e-80
WP_005310714.1|912110_912398_-	type VI secretion system PAAR protein	NA	G4KK81	Yersinia_phage	39.4	4.6e-09
WP_005310712.1|912430_912616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364673.1|912689_914126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005310708.1|919049_919655_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_005310706.1|919654_921193_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_155268744.1|921195_921336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|922635_923553_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364674.1|923575_923731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|923713_924631_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	930261	1082698	4632948	tRNA,transposase	uncultured_Caudovirales_phage(17.65%)	119	NA	NA
WP_076611341.1|930261_931179_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310661.1|932207_932405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017412578.1|932500_933397_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005310657.1|933509_934091_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_017412577.1|934095_934659_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_042468140.1|934673_936953_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_159364675.1|936956_938009_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_005310649.1|938132_938765_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_017412575.1|938838_939597_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_005310645.1|939615_940257_+	endonuclease III	NA	NA	NA	NA	NA
WP_005310643.1|940359_940773_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_159364971.1|940845_941709_-	OmpA family protein	NA	NA	NA	NA	NA
WP_159364676.1|941789_943763_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	1.9e-32
WP_085941471.1|943848_944583_+	ribonuclease T	NA	NA	NA	NA	NA
WP_159364677.1|944834_946157_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_159364972.1|946425_947640_-|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
WP_159364678.1|949536_950010_-	molybdopterin-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017412353.1|950344_952222_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.4	2.6e-60
WP_005310625.1|952403_952865_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_005310623.1|952969_953458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364973.1|953457_956649_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_042468147.1|956704_957616_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_042468148.1|957902_959438_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	41.7	2.0e-37
WP_005310617.1|959614_960736_+	alkene reductase	NA	NA	NA	NA	NA
WP_005310615.1|960837_961857_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_017412358.1|962076_962826_+	HAD-IIA family hydrolase	NA	NA	NA	NA	NA
WP_005310611.1|962846_964466_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005310609.1|964555_964924_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_159364679.1|965117_966782_+	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	40.6	8.2e-90
WP_005310605.1|966904_968401_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_159364327.1|969513_970431_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310595.1|970727_971228_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005310593.1|971289_971913_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_088814258.1|971996_972668_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_088814259.1|972708_973707_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_139697064.1|974864_975977_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_005310586.1|976235_976868_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011898835.1|976885_977545_-	TIGR01621 family pseudouridine synthase	NA	NA	NA	NA	NA
WP_076611341.1|978154_979072_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310581.1|980426_981989_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	45.3	5.6e-32
WP_011898838.1|982481_983138_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	53.1	4.0e-48
WP_042468686.1|983302_985456_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_005310577.1|985482_985824_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_042468689.1|985882_986653_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_088814262.1|986853_988101_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_005310570.1|988115_988979_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_042468693.1|989098_989908_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_011898842.1|990074_992213_-	pilus assembly protein TapV	NA	NA	NA	NA	NA
WP_005310564.1|992491_993508_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_159364680.1|993675_994809_-	DUF3410 domain-containing protein	NA	NA	NA	NA	NA
WP_042468696.1|995177_995900_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_159364681.1|995984_996815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|997623_998541_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|999707_1000625_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|1000857_1001775_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364974.1|1001838_1002831_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005310548.1|1005697_1006159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011898844.1|1006177_1008055_-	S8 family serine peptidase	NA	A0A1V0S9L2	Catovirus	20.8	5.2e-16
WP_159364683.1|1008583_1009501_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|1009933_1010851_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364684.1|1010895_1013295_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.0	3.1e-175
WP_005310537.1|1013621_1014434_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_005310536.1|1014557_1014845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469111.1|1015209_1016586_+	amino acid permease	NA	NA	NA	NA	NA
WP_058394668.1|1018131_1018599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310510.1|1018830_1019316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310508.1|1019437_1019887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364685.1|1019990_1022888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310504.1|1022887_1023727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310502.1|1023829_1025254_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005310500.1|1025289_1025850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468587.1|1025870_1027184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310495.1|1027280_1028927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412350.1|1029052_1030255_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.8e-22
WP_159364686.1|1030375_1031785_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_005310491.1|1031894_1032362_-	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_042468585.1|1032559_1033240_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	8.7e-30
WP_042468584.1|1033267_1035709_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_159364687.1|1035663_1036773_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_011898849.1|1036972_1037926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468582.1|1038445_1038934_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	39.8	7.4e-15
WP_159364327.1|1040386_1041304_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_073531738.1|1042231_1042846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310476.1|1043109_1043901_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_159364683.1|1044057_1044975_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310474.1|1045078_1045435_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_085941476.1|1045953_1046310_+	DUF3802 family protein	NA	NA	NA	NA	NA
WP_017411371.1|1046665_1047298_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_017411372.1|1047568_1048897_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_058406197.1|1050771_1051860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005310455.1|1056714_1057473_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005310453.1|1057641_1057959_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005310451.1|1058166_1059459_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_085941477.1|1059537_1060173_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011899080.1|1060485_1061517_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159364689.1|1062617_1062785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|1062767_1063685_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315078.1|1063845_1064253_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_042468675.1|1064319_1064883_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_005315061.1|1064879_1065110_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_085941448.1|1065111_1065825_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	39.4	1.4e-17
WP_034282960.1|1065844_1066552_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.1	2.9e-84
WP_085941447.1|1066575_1067265_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005315050.1|1067215_1067773_+	rhombosortase	NA	NA	NA	NA	NA
WP_159364690.1|1067846_1068548_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_005315046.1|1068658_1069825_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_005315045.1|1069834_1070119_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_159364691.1|1070275_1070560_-	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	37.8	2.2e-11
WP_159364692.1|1070652_1072323_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_005315040.1|1072417_1073110_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_005315038.1|1073358_1073952_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.5	1.3e-42
WP_159364693.1|1074097_1075072_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_139696973.1|1075145_1076021_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005315028.1|1076114_1077323_+	MFS transporter	NA	NA	NA	NA	NA
WP_085941598.1|1077367_1077913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315024.1|1077915_1078680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315023.1|1078869_1079595_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_042468681.1|1079685_1081623_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.1	6.3e-17
WP_011899080.1|1081666_1082698_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	1091154	1235038	4632948	protease,tRNA,transposase	Tupanvirus(25.0%)	104	NA	NA
WP_076611341.1|1091154_1092072_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315309.1|1092781_1094152_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	36.7	5.3e-34
WP_005315308.1|1094216_1095584_-	heme anaerobic degradation radical SAM methyltransferase ChuW/HutW	NA	NA	NA	NA	NA
WP_088814220.1|1095831_1097442_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.8	1.6e-26
WP_005315306.1|1097535_1098591_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.9	5.2e-82
WP_159364694.1|1098819_1100103_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005315304.1|1100273_1101362_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.9	1.1e-87
WP_005315303.1|1101586_1102516_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_085941450.1|1102610_1103372_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_005315298.1|1103489_1105139_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_100766231.1|1105151_1105244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005315297.1|1105594_1106542_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_017412312.1|1106693_1107155_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_042468070.1|1107170_1107923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468071.1|1108179_1109418_+	siderophore amonabactin export MFS transporter	NA	NA	NA	NA	NA
WP_042468072.1|1109475_1111449_+	siderophore amonabactin TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	34.9	2.4e-16
WP_005315288.1|1111519_1112536_+	amonabactin ABC transporter permease subunit 2	NA	NA	NA	NA	NA
WP_011898657.1|1112550_1113618_+	amonabactin ABC transporter permease subunit 1	NA	NA	NA	NA	NA
WP_017412316.1|1113617_1114433_+	amonabactin ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.3	2.3e-13
WP_005315278.1|1114491_1115217_-	amonabactin biosynthesis phosphopantetheinyl transferase AmoD	NA	NA	NA	NA	NA
WP_005315275.1|1115375_1116320_+	amonabactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_159364695.1|1116402_1118013_-	amonabactin biosynthesis glycine adenylation protein AmoH	NA	A0A2K9L3I8	Tupanvirus	27.9	5.8e-40
WP_159368365.1|1118009_1124270_-	amonabactin biosynthesis non-ribosomal peptide synthetase AmoG	NA	A0A2K9KZV5	Tupanvirus	24.2	5.5e-70
WP_005315268.1|1124278_1125028_-	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_159368366.1|1125057_1128153_-	amonabactin biosynthesis non-ribosomal peptide synthetase AmoF	NA	A0A2K9L3I8	Tupanvirus	25.2	7.0e-42
WP_005315266.1|1128149_1129058_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_042468075.1|1129082_1130753_-	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_034282536.1|1130749_1131943_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_005315260.1|1132267_1132819_+	lipoprotein	NA	NA	NA	NA	NA
WP_159364697.1|1132965_1134966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005315254.1|1136525_1138169_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005315253.1|1138131_1138626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315249.1|1138806_1139169_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_100224073.1|1139282_1141076_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.0	2.5e-23
WP_042468808.1|1141072_1142377_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_159364975.1|1142563_1142956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080697425.1|1143027_1144056_-	ferrochelatase	NA	NA	NA	NA	NA
WP_017412939.1|1144107_1144752_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005315220.1|1144798_1144993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315218.1|1145009_1146923_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.5	4.5e-116
WP_005315205.1|1147937_1148762_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_159364698.1|1148774_1150889_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_005315184.1|1151251_1151650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364699.1|1151716_1152853_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011898652.1|1153016_1155161_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	NA	NA	NA	NA
WP_076611341.1|1156278_1157196_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159368367.1|1157244_1159290_-	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	45.2	4.9e-20
WP_088814343.1|1159835_1160972_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_159364701.1|1160980_1161154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814108.1|1161323_1162241_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364703.1|1162244_1164170_-	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	27.3	3.0e-51
WP_159364704.1|1164199_1165420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468945.1|1168438_1170064_-	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_005313105.1|1170468_1171209_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042468944.1|1171301_1173068_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_088814108.1|1173825_1174743_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005313097.1|1175695_1176439_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_005313094.1|1176442_1177420_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_085941630.1|1177544_1178261_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_005313088.1|1178264_1179803_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_005313085.1|1179806_1180772_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_042469000.1|1180918_1181521_-	peroxiredoxin C	NA	NA	NA	NA	NA
WP_088814343.1|1181726_1182863_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_159364976.1|1182966_1184001_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088814193.1|1184016_1184748_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_005319295.1|1184760_1185144_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	4.4e-07
WP_005319297.1|1185255_1185975_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_088814192.1|1186003_1186837_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_005319300.1|1186844_1188263_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_159364705.1|1188279_1190382_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_042468830.1|1190489_1191335_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_042468835.1|1191421_1192219_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_005319310.1|1192298_1192568_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_034282679.1|1192595_1193375_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_005319315.1|1193361_1193745_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_017412373.1|1193806_1194199_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_005319319.1|1194248_1195319_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017412372.1|1195328_1195847_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_159364706.1|1199757_1200564_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017412370.1|1200632_1201694_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_159364977.1|1201686_1203372_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_011898507.1|1203448_1203766_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_005319340.1|1203923_1204832_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_159364707.1|1204898_1206650_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_159364708.1|1206742_1207528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005319346.1|1207726_1208095_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005319348.1|1208346_1208655_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_005319350.1|1208651_1209176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005319352.1|1209160_1209343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102665398.1|1209382_1210579_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005319357.1|1210811_1212140_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_005319359.1|1212302_1212770_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021138415.1|1213918_1215277_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_159364709.1|1215650_1216619_-	glucokinase	NA	NA	NA	NA	NA
WP_159364710.1|1216959_1217823_+	transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_017412636.1|1217986_1219426_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_005319373.1|1219486_1220533_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042468563.1|1220548_1223614_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.2	3.3e-68
WP_005319376.1|1223788_1226113_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005319378.1|1226161_1226815_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159364699.1|1227649_1228786_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|1229719_1230856_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|1231731_1232649_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314540.1|1233661_1235038_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.5	8.7e-45
>prophage 7
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	1310267	1344325	4632948	transposase	Morganella_phage(33.33%)	30	NA	NA
WP_076611341.1|1310267_1311185_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|1311762_1312680_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364980.1|1312783_1313587_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_005320221.1|1313677_1313998_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_005320223.1|1313997_1314411_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_005320225.1|1314454_1314997_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_042467270.1|1315008_1316661_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017412806.1|1316900_1317797_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005320231.1|1317832_1318525_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_159364727.1|1318698_1319895_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|1320064_1320982_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412982.1|1321336_1322230_+	EamA family transporter	NA	NA	NA	NA	NA
WP_042469080.1|1324317_1324710_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_005320238.1|1324804_1325362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320240.1|1325612_1325861_+	TIGR02647 family protein	NA	NA	NA	NA	NA
WP_011898543.1|1325847_1326153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005331438.1|1326257_1326467_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	60.0	1.1e-15
WP_043143953.1|1326672_1327764_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_076611341.1|1327996_1328914_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_085044777.1|1329014_1329953_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005320258.1|1330094_1331081_-	alpha-ketoacid dehydrogenase subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	28.8	1.8e-07
WP_159364729.1|1331183_1332278_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_005320264.1|1332552_1333578_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_017412738.1|1333857_1334067_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_017412739.1|1334588_1335482_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_011898541.1|1335655_1339498_-	DEAD/DEAH box helicase	NA	G8DDA1	Micromonas_pusilla_virus	30.3	6.4e-45
WP_005319007.1|1339722_1340376_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_159364730.1|1340530_1342231_-	ligase	NA	NA	NA	NA	NA
WP_159364981.1|1342248_1343040_-	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_088814108.1|1343407_1344325_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	1652579	1723938	4632948	integrase,protease,tRNA,transposase	Cronobacter_phage(15.38%)	59	1664749:1664766	1699129:1699146
WP_005312386.1|1652579_1653284_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_042468298.1|1653359_1654481_-	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_042468296.1|1654538_1655702_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_005312374.1|1655706_1656549_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_005312371.1|1656716_1657685_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.8	1.4e-68
WP_005303128.1|1658127_1658385_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_159364785.1|1658429_1660157_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	30.4	1.4e-15
WP_159364786.1|1660200_1660710_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_005312360.1|1660798_1661761_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.3	1.8e-17
WP_005312357.1|1661823_1662642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312353.1|1662879_1663428_+	cytochrome b	NA	NA	NA	NA	NA
WP_005312349.1|1663456_1664107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364787.1|1664284_1668037_-	AAA family ATPase	NA	NA	NA	NA	NA
1664749:1664766	attL	CGGAACCGATAAGCTCGG	NA	NA	NA	NA
WP_042468655.1|1668033_1669260_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_005312341.1|1669364_1669793_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005312334.1|1669972_1670884_+	recombination-associated protein RdgC	NA	A0A1I9KF67	Aeromonas_phage	51.7	2.8e-84
WP_017412621.1|1673197_1673476_+	transporter	NA	NA	NA	NA	NA
WP_159364788.1|1673505_1674849_+	cation:proton antiport protein	NA	NA	NA	NA	NA
WP_159364789.1|1675257_1676439_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_005312324.1|1676516_1676741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011898977.1|1677044_1678457_+	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_159364790.1|1678604_1681775_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_052521845.1|1681901_1682582_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1W6JPG6	Morganella_phage	45.1	6.0e-47
WP_076611341.1|1682655_1683573_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011898473.1|1683911_1684103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155268748.1|1684212_1684359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017411356.1|1684423_1684897_+	transcriptional regulator SlyA	NA	NA	NA	NA	NA
WP_017411357.1|1684898_1685954_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_005316891.1|1685964_1686993_+	DUF2955 domain-containing protein	NA	NA	NA	NA	NA
WP_005316893.1|1687148_1687907_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005316896.1|1688030_1688390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017411359.1|1688493_1688664_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_005316900.1|1688764_1689277_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.3	6.3e-49
WP_005316902.1|1689279_1689555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468393.1|1689609_1691727_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.0	8.4e-265
WP_042468392.1|1692134_1693142_+	sugar ABC transporter ATPase	NA	NA	NA	NA	NA
WP_017411361.1|1693209_1695216_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.0	1.2e-138
WP_017411362.1|1695316_1696444_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_159364792.1|1696459_1699834_-	AAA family ATPase	NA	NA	NA	NA	NA
1699129:1699146	attR	CGGAACCGATAAGCTCGG	NA	NA	NA	NA
WP_011898471.1|1699942_1700707_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_005316916.1|1700847_1701462_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_005316919.1|1701558_1701810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005316921.1|1701927_1702473_-	DUF882 domain-containing protein	NA	NA	NA	NA	NA
WP_017411363.1|1702622_1704107_-	L,D-transpeptidase family protein	NA	Q9ZXL6	Pseudomonas_virus	38.1	2.5e-05
WP_159364793.1|1704187_1704958_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_088814343.1|1705095_1706232_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_042468390.1|1706569_1707115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005316928.1|1707171_1708206_+	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	50.7	1.0e-82
WP_005316930.1|1708202_1708574_+	GtrA family protein	NA	NA	NA	NA	NA
WP_005316932.1|1708573_1709749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005316933.1|1710098_1711298_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005316934.1|1711408_1712731_+	peptidoglycan DD-metalloendopeptidase family protein	NA	V5R8R0	Arthrobacter_phage	52.2	2.8e-16
WP_005316935.1|1712979_1714101_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_088814343.1|1714279_1715416_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|1717249_1718167_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005316939.1|1719078_1719354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005316941.1|1719850_1721842_-	transketolase	NA	NA	NA	NA	NA
WP_005316943.1|1722184_1723336_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.8	1.2e-129
WP_005316946.1|1723404_1723938_+|protease	SprT family zinc-dependent metalloprotease	protease	A0A060AI19	Cronobacter_phage	31.0	6.8e-06
>prophage 9
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	2430785	2461734	4632948	protease,tRNA,transposase	Cafeteria_roenbergensis_virus(25.0%)	29	NA	NA
WP_159364884.1|2430785_2431703_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315988.1|2432841_2434221_+	ATP-dependent RNA helicase DbpA	NA	E3T5E1	Cafeteria_roenbergensis_virus	33.1	1.7e-48
WP_005315990.1|2434335_2434626_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005315995.1|2434936_2435335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814343.1|2436737_2437874_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_042468800.1|2438403_2438622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941516.1|2438732_2439656_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_017412591.1|2439846_2441202_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_159364885.1|2441238_2442957_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_159364886.1|2442946_2443705_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_005316007.1|2443867_2444728_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_005316010.1|2444727_2445645_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_159364887.1|2445655_2447110_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	29.5	6.9e-08
WP_076611341.1|2447113_2448031_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005313563.1|2448199_2448616_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005313565.1|2448659_2449154_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	51.5	6.3e-22
WP_005313567.1|2449475_2450672_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_005313569.1|2450854_2451811_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005313573.1|2451872_2452406_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_159364889.1|2452473_2453037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005313582.1|2453249_2454383_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.7	4.9e-46
WP_159364890.1|2454392_2455655_-	GntP family permease	NA	NA	NA	NA	NA
WP_005313593.1|2455774_2456890_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_005313595.1|2457098_2457473_+	YacL family protein	NA	NA	NA	NA	NA
WP_005313598.1|2457523_2457823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005313601.1|2457999_2458830_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_076611341.1|2459417_2460335_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364999.1|2460379_2460709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|2460816_2461734_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	2506063	2577250	4632948	protease,tRNA,transposase	Tupanvirus(11.76%)	60	NA	NA
WP_076611341.1|2506063_2506981_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159368369.1|2507780_2508410_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_088814343.1|2508488_2509625_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_042468913.1|2510101_2511238_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L470	Tupanvirus	31.1	2.2e-30
WP_042468912.1|2511234_2512239_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	L7RD47	Acanthamoeba_polyphaga_moumouvirus	28.0	1.1e-12
WP_005318307.1|2512460_2514290_-	maltodextrin glucosidase	NA	NA	NA	NA	NA
WP_005318309.1|2514296_2515145_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_005318311.1|2515282_2515702_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_005318313.1|2515914_2517276_-	molecular chaperone	NA	NA	NA	NA	NA
WP_159364898.1|2517453_2518443_-	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	42.9	3.0e-63
WP_102665157.1|2518520_2518982_-	CreA family protein	NA	A0A2I7SAK3	Vibrio_phage	36.2	1.3e-13
WP_005318320.1|2519156_2520011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005318322.1|2520061_2520448_-	DnaK suppressor protein	NA	NA	NA	NA	NA
WP_005318324.1|2520937_2522269_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_042468411.1|2522463_2523825_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011898245.1|2523879_2524977_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011898246.1|2525092_2526178_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042468409.1|2526254_2527409_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	1.5e-26
WP_005318334.1|2527405_2528311_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005318337.1|2528307_2529150_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005318340.1|2529195_2529900_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_005318344.1|2530420_2530948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941554.1|2531072_2531528_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_005318348.1|2531670_2533494_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	7.4e-84
WP_005318352.1|2533595_2533898_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005318356.1|2535441_2535729_+	DUF3630 family protein	NA	NA	NA	NA	NA
WP_005318359.1|2535899_2536574_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	63.7	3.5e-63
WP_005318362.1|2536845_2537331_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_159364899.1|2537476_2539330_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.4	1.4e-37
WP_005318369.1|2539400_2540825_-	magnesium transporter	NA	NA	NA	NA	NA
WP_005318371.1|2540975_2542382_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_005318373.1|2542394_2543207_-	nitrite transporter NirC	NA	NA	NA	NA	NA
WP_005318375.1|2543258_2543576_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_085941392.1|2543682_2546262_-	nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_042468281.1|2546519_2547440_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159364900.1|2547630_2549025_+	MFS transporter	NA	NA	NA	NA	NA
WP_005318386.1|2549098_2550427_-	HslU--HslV peptidase ATPase subunit	NA	A0A173GFL6	Erwinia_phage	28.9	3.4e-46
WP_005318389.1|2550491_2551025_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_005318391.1|2551216_2552044_-	cell division protein	NA	NA	NA	NA	NA
WP_159364901.1|2552047_2553799_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	35.7	2.1e-83
WP_085941393.1|2554019_2554679_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011898253.1|2554760_2555381_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	26.7	2.3e-05
WP_005318399.1|2555373_2556051_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_005318402.1|2556114_2556930_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_159364902.1|2557188_2558151_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_005318405.1|2558302_2559283_-	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_159364903.1|2559374_2560523_-	galactokinase	NA	NA	NA	NA	NA
WP_042468290.1|2560519_2561578_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_159364904.1|2561661_2562675_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.8	1.4e-84
WP_159364905.1|2562879_2563830_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_042468286.1|2564048_2567126_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	53.1	0.0e+00
WP_005318413.1|2567360_2568347_+	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_159364906.1|2568400_2569921_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.2	1.4e-11
WP_017412477.1|2569937_2570948_+	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_159364907.1|2570999_2572727_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.2	3.2e-12
WP_159364953.1|2572901_2574116_+|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
WP_005318419.1|2574664_2575033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364908.1|2575034_2575682_-	AAA family ATPase	NA	Q2A085	Sodalis_phage	47.5	1.4e-45
WP_005318424.1|2575781_2575958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814343.1|2576113_2577250_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	2609306	2676414	4632948	tRNA,transposase	Bacillus_phage(22.22%)	56	NA	NA
WP_076611341.1|2609306_2610224_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|2611060_2611978_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005318259.1|2612815_2613220_-	glyoxalase	NA	NA	NA	NA	NA
WP_005318257.1|2613209_2613974_-	AAC(3) family N-acetyltransferase	NA	NA	NA	NA	NA
WP_034283961.1|2613970_2614201_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_005318252.1|2615743_2616283_-	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_042467733.1|2616373_2617516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005318248.1|2617688_2618822_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_005318245.1|2618958_2619666_+	two-component system response regulator RstA	NA	W8CYM9	Bacillus_phage	30.8	5.5e-27
WP_005318243.1|2619703_2621029_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	1.6e-16
WP_011898228.1|2621038_2621266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412011.1|2621345_2622602_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_087757448.1|2622781_2624239_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_005318234.1|2624384_2624600_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_042467737.1|2624747_2626955_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_017412009.1|2627042_2628158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005318229.1|2628210_2628765_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005318227.1|2628841_2629294_+	HPP family protein	NA	NA	NA	NA	NA
WP_005318225.1|2629350_2630457_-	porin OmpA	NA	NA	NA	NA	NA
WP_159364915.1|2630772_2632293_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_005318219.1|2632370_2634212_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_042467742.1|2634361_2635303_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_005318216.1|2635315_2635606_-	acetolactate synthase 2 small subunit	NA	NA	NA	NA	NA
WP_159364916.1|2635602_2637399_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	29.2	5.8e-57
WP_011707861.1|2637485_2637584_-	ilvBEDA operon leader peptide	NA	NA	NA	NA	NA
WP_011898225.1|2637783_2639298_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005318207.1|2640472_2640970_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_011898224.1|2640966_2641617_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_017412156.1|2641691_2642327_+	nicotinamidase	NA	NA	NA	NA	NA
WP_017412157.1|2642416_2643595_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_159364917.1|2643719_2644565_+	putative selenate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005318196.1|2644561_2645323_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.4	2.3e-15
WP_005318191.1|2646957_2647566_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_017412161.1|2647943_2648933_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_005318186.1|2649017_2650469_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_005318183.1|2650665_2650929_-	YihD family protein	NA	NA	NA	NA	NA
WP_085941553.1|2650959_2652075_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_005318178.1|2652198_2652588_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_159364918.1|2652588_2655006_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.0	1.9e-111
WP_005318174.1|2655195_2655849_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_159364919.1|2655924_2656641_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_005318170.1|2656931_2657795_+	YicC family protein	NA	NA	NA	NA	NA
WP_017412166.1|2657962_2659027_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_005318164.1|2659001_2660054_-	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
WP_159364920.1|2660050_2660734_-	LPS biosynthesis glycosyltransferase	NA	A0A1V0SJT4	Klosneuvirus	29.4	6.9e-11
WP_005318160.1|2660730_2661942_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_005318158.1|2661948_2663709_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_076611341.1|2664120_2665038_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|2665364_2666501_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_159364976.1|2666604_2667639_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005318153.1|2668523_2669483_-	ADP-glyceromanno-heptose 6-epimerase	NA	A0A2K9L0I7	Tupanvirus	26.6	7.0e-17
WP_005318149.1|2669629_2670274_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042467749.1|2670327_2671518_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.7	1.7e-36
WP_005318146.1|2671586_2672615_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.7e-19
WP_085941552.1|2672854_2673268_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_076611341.1|2675496_2676414_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	2680587	2743071	4632948	protease,tRNA,transposase	Pandoravirus(16.67%)	46	NA	NA
WP_005318136.1|2680587_2681424_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	34.4	2.1e-17
WP_085941541.1|2687448_2688042_-	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_021140667.1|2687980_2689438_-	potassium uptake protein TrkH	NA	NA	NA	NA	NA
WP_159364921.1|2689474_2690092_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	38.7	6.9e-26
WP_159364922.1|2690091_2691414_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_159364923.1|2691603_2693541_+	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_017412571.1|2693745_2695893_+	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_005320563.1|2695914_2697078_+	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_085941542.1|2697352_2698087_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_159364924.1|2698138_2699584_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_005320576.1|2699719_2700958_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005320579.1|2701032_2701224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941543.1|2701420_2701669_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	72.2	2.9e-07
WP_005320589.1|2701688_2702036_+	RidA family protein	NA	NA	NA	NA	NA
WP_042468577.1|2702157_2702814_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_005320595.1|2703008_2703455_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005320598.1|2703676_2704600_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_005320601.1|2704609_2706679_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_076611341.1|2706814_2707732_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364953.1|2708106_2709321_-|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
WP_088814405.1|2709386_2710649_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005321603.1|2710848_2711274_-	chaperonin	NA	NA	NA	NA	NA
WP_034283822.1|2711470_2712862_+	T3SS effector protein-tyrosine-phosphatase AopH	NA	NA	NA	NA	NA
WP_076611341.1|2713695_2714613_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005320605.1|2715256_2715754_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005320608.1|2717034_2717799_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005320617.1|2719525_2719882_+	molecular chaperone	NA	NA	NA	NA	NA
WP_005320619.1|2720033_2721260_-	amino acid permease	NA	NA	NA	NA	NA
WP_088814339.1|2721550_2722768_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_042468882.1|2722885_2723227_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_005320623.1|2723278_2724445_-	NADH:flavorubredoxin reductase NorW	NA	NA	NA	NA	NA
WP_005320624.1|2724441_2726007_-	anaerobic nitric oxide reductase flavorubredoxin	NA	NA	NA	NA	NA
WP_005320633.1|2726178_2727708_+	nitric oxide reductase transcriptional regulator NorR	NA	NA	NA	NA	NA
WP_011899241.1|2727797_2728505_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088814343.1|2728780_2729917_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_159364925.1|2730074_2731664_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_076611341.1|2732402_2733320_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005320642.1|2734137_2735142_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	33.1	9.5e-33
WP_088814406.1|2735595_2736699_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005320646.1|2736762_2737689_+	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_005320647.1|2737685_2738954_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_042468107.1|2738950_2739727_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.8	1.6e-11
WP_005320652.1|2740327_2741176_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017411789.1|2741154_2741748_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005320656.1|2741917_2742241_+	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_017411790.1|2742237_2743071_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
>prophage 13
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	3308766	3352261	4632948	protease,transposase	uncultured_Caudovirales_phage(28.57%)	33	NA	NA
WP_159364942.1|3308766_3309294_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_005314151.1|3309386_3309959_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A076YN96	Rhizobium_phage	30.4	3.2e-09
WP_005314150.1|3310235_3311000_+	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_005314149.1|3311079_3313740_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_159364301.1|3313825_3315682_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_005314147.1|3315842_3317270_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.7e-41
WP_042468131.1|3317399_3318356_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.9	5.0e-15
WP_005314145.1|3318352_3318535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364302.1|3318670_3320317_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	60.2	3.1e-17
WP_017411941.1|3320480_3322391_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	1.0e-19
WP_005314141.1|3322649_3324908_+	patatin-like phospholipase domain-containing protein	NA	A0A1V0SFX9	Hokovirus	27.4	2.0e-06
WP_159364303.1|3325136_3327734_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_088814343.1|3328836_3329973_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_088814108.1|3330824_3331742_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468135.1|3332260_3333010_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_011898295.1|3333186_3334110_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159364305.1|3334181_3335093_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	26.3	1.3e-12
WP_005314128.1|3335170_3335788_+	LysE family transporter	NA	NA	NA	NA	NA
WP_159364306.1|3335905_3337300_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_088814347.1|3337380_3338499_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_076611341.1|3340445_3341363_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314121.1|3341636_3342146_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_005314120.1|3342198_3342570_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011898298.1|3342739_3343402_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_005314116.1|3343996_3344329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005314114.1|3344459_3344975_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_005314112.1|3345436_3345655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314110.1|3345667_3346192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314108.1|3346211_3346706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314106.1|3346772_3347219_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|3347683_3348601_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314084.1|3349666_3351010_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_159364308.1|3351343_3352261_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	3448746	3493683	4632948	transposase	Bacillus_phage(28.57%)	33	NA	NA
WP_159364279.1|3448746_3449664_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468899.1|3450137_3451409_+	membrane protein	NA	NA	NA	NA	NA
WP_005320515.1|3451497_3452751_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.0	5.8e-48
WP_159364321.1|3454026_3455259_+	MFS transporter	NA	NA	NA	NA	NA
WP_005320525.1|3455278_3455737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364322.1|3455917_3456826_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_159364323.1|3456879_3457320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011899092.1|3457321_3457654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320532.1|3457758_3458319_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_088814398.1|3458585_3459206_+	ribonuclease	NA	NA	NA	NA	NA
WP_017412815.1|3459278_3459557_+	Pathogenicity locus	NA	NA	NA	NA	NA
WP_159368373.1|3460782_3461055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469009.1|3466858_3467254_+	NUDIX domain-containing protein	NA	A0A0H4J2U2	Stenotrophomonas_phage	37.5	3.2e-08
WP_088814354.1|3467311_3468541_-	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	29.6	3.5e-05
WP_017412757.1|3468597_3469278_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	3.1e-27
WP_005318615.1|3469427_3470582_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	71.9	6.8e-35
WP_157669187.1|3475036_3475177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364324.1|3475163_3477317_+	AsmA family protein	NA	NA	NA	NA	NA
WP_005318627.1|3477491_3478031_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_159364325.1|3478103_3478838_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.9	4.7e-05
WP_088814343.1|3479293_3480430_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005318633.1|3481452_3481731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005318634.1|3481735_3481939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364326.1|3482319_3482538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364327.1|3482520_3483438_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|3483972_3485109_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005318641.1|3485359_3486139_+	sorbitol-6-phosphate dehydrogenase	NA	W8CYX9	Bacillus_phage	50.9	2.2e-05
WP_076611341.1|3486197_3487115_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005318643.1|3487292_3487649_+	glucitol operon activator	NA	NA	NA	NA	NA
WP_011899087.1|3487738_3488503_+	DNA-binding transcriptional repressor	NA	NA	NA	NA	NA
WP_088814148.1|3488737_3491620_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_005318651.1|3491862_3492309_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_076611341.1|3492765_3493683_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	3525678	3560548	4632948	transposase	Tupanvirus(33.33%)	29	NA	NA
WP_159364338.1|3525678_3526815_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|3528458_3529595_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3530668_3531586_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364332.1|3532046_3532484_-	VOC family protein	NA	NA	NA	NA	NA
WP_005318743.1|3534181_3534778_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_017413068.1|3534884_3535247_-	DUF2061 domain-containing protein	NA	NA	NA	NA	NA
WP_005318747.1|3535439_3535646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364333.1|3535857_3536742_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3536786_3537704_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364334.1|3537868_3538210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005318756.1|3539008_3539863_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_085941653.1|3539856_3540300_-	DUF2390 domain-containing protein	NA	NA	NA	NA	NA
WP_005318760.1|3540310_3542221_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.6e-73
WP_005318762.1|3542375_3542786_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005318764.1|3542864_3543320_-	NfeD family protein	NA	NA	NA	NA	NA
WP_005318765.1|3543316_3544240_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_005318769.1|3546020_3546974_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_005318771.1|3546985_3548401_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	28.5	4.6e-33
WP_005318772.1|3548405_3550130_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_159364335.1|3550301_3550892_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_159364336.1|3551486_3552503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|3552527_3553445_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364337.1|3553493_3554096_-	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_011898961.1|3554100_3555315_-|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
WP_159364338.1|3555356_3556493_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_159364339.1|3556673_3557003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364340.1|3557253_3557577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|3557653_3558571_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3559630_3560548_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	3608048	3617966	4632948	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_005318886.1|3608048_3608795_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	9.7e-67
WP_005318888.1|3608799_3609417_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	9.0e-34
WP_159364944.1|3609419_3609983_+	DedA family protein	NA	NA	NA	NA	NA
WP_159364349.1|3609992_3611039_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	41.3	7.9e-14
WP_017411567.1|3611086_3612070_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	9.9e-35
WP_005318896.1|3612155_3613169_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	1.5e-107
WP_005309452.1|3613348_3613564_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_159364350.1|3613579_3614023_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	1.7e-26
WP_005318901.1|3614111_3615899_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	3.4e-73
WP_082187144.1|3616112_3617966_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 17
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	3734530	3798909	4632948	tRNA,transposase	Streptococcus_phage(25.0%)	55	NA	NA
WP_042469031.1|3734530_3735946_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_159364946.1|3739724_3742724_+	chitinase	NA	A0A1X9VNM7	Mimivirus	29.1	2.6e-25
WP_159364367.1|3743019_3744237_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005317900.1|3744248_3744884_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_159364368.1|3744900_3745308_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005317894.1|3745375_3745903_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_159364369.1|3745913_3747278_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_159364370.1|3747274_3748039_-	DUF3450 family protein	NA	NA	NA	NA	NA
WP_159364371.1|3748147_3750754_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.4	3.9e-38
WP_076611341.1|3752006_3752924_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412677.1|3753600_3754644_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005317877.1|3756636_3757695_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.8	1.5e-07
WP_159364372.1|3757691_3758693_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	3.2e-20
WP_159364373.1|3758896_3759016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317866.1|3759414_3760866_-	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_005317863.1|3761456_3761762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317860.1|3761797_3762265_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_159364374.1|3762375_3763644_+	esterase FrsA	NA	NA	NA	NA	NA
WP_005317854.1|3763704_3764097_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_011898405.1|3764323_3765427_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.2	9.0e-61
WP_042468553.1|3765524_3766778_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.5	2.7e-93
WP_005317845.1|3766933_3767569_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_005317842.1|3767636_3768065_-	universal stress protein	NA	NA	NA	NA	NA
WP_005317837.1|3768273_3769020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317835.1|3769104_3769473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317834.1|3769600_3770110_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_042468555.1|3770307_3771399_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_076611341.1|3772228_3773146_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814298.1|3773849_3774785_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_005317820.1|3775034_3775790_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	29.1	5.1e-23
WP_005317818.1|3775827_3776043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|3777329_3778247_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364375.1|3778295_3778718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364376.1|3778899_3779619_+	beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_005317806.1|3779603_3780362_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_085941422.1|3780358_3780646_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_005317801.1|3780649_3780898_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_005317798.1|3780866_3781505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468706.1|3781501_3782872_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_159364377.1|3782855_3783227_+	hydroxymyristoyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_005317790.1|3783223_3784927_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_005317787.1|3784913_3786476_+	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	31.8	6.4e-52
WP_005317781.1|3786600_3787026_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_020379605.1|3787022_3787637_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_005317775.1|3787687_3790063_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_085941573.1|3790065_3790623_+	DUF3261 domain-containing protein	NA	NA	NA	NA	NA
WP_159364378.1|3790619_3791801_+	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_005317766.1|3791797_3792259_+	hotdog family protein	NA	NA	NA	NA	NA
WP_005317763.1|3792268_3792994_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_005317759.1|3793085_3794312_+	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_011898412.1|3794402_3794819_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_005317752.1|3794855_3795386_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_085044777.1|3795562_3796501_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3796601_3797519_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|3797772_3798909_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	3877211	3917905	4632948	protease,tRNA,transposase	Micromonas_pusilla_virus(25.0%)	34	NA	NA
WP_005317541.1|3877211_3879161_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	41.8	4.9e-118
WP_005317538.1|3879223_3880069_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.9	2.5e-18
WP_159364394.1|3880086_3881421_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_159364395.1|3881551_3882316_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_005317530.1|3882316_3882643_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_005317527.1|3883072_3883531_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_005317524.1|3883545_3885048_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_042467425.1|3885068_3887765_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	4.8e-23
WP_005317518.1|3887820_3888255_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_005317516.1|3888256_3889216_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_005317514.1|3889360_3889630_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_159364396.1|3889797_3891939_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_042467430.1|3892070_3893291_+	MFS transporter	NA	NA	NA	NA	NA
WP_005317508.1|3893287_3894370_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_005317505.1|3894507_3894861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941575.1|3895038_3895413_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|3897099_3898017_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364397.1|3898039_3898810_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_085941423.1|3899039_3900425_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_051163830.1|3900547_3901318_+	patatin family protein	NA	NA	NA	NA	NA
WP_076611341.1|3901391_3902309_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005317473.1|3903010_3903985_+	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_076611341.1|3904105_3905023_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364947.1|3905090_3905942_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_005317468.1|3905941_3907225_+	N-glycosyltransferase	NA	NA	NA	NA	NA
WP_042468717.1|3907490_3908411_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_011898434.1|3908494_3908812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317460.1|3909017_3910358_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_159364399.1|3910357_3911752_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_005317454.1|3911948_3912467_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_011898435.1|3912672_3913584_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.6	8.3e-28
WP_076611341.1|3913786_3914704_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364401.1|3916272_3916626_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_088814343.1|3916768_3917905_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	3923632	3976100	4632948	protease,tRNA,transposase	Stx2-converting_phage(20.0%)	50	NA	NA
WP_159364402.1|3923632_3924283_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_076611341.1|3925104_3926022_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364404.1|3927227_3928124_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_159364405.1|3928123_3929128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159368376.1|3929510_3930155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364407.1|3930251_3931250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|3931344_3932262_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3932707_3933625_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159368377.1|3933647_3934049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159368378.1|3934052_3934895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814343.1|3934962_3936099_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_159364411.1|3936177_3937131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364412.1|3938107_3939196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364413.1|3939714_3941400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042467797.1|3941495_3942476_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_042467798.1|3942561_3943239_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_005317360.1|3943320_3943584_-	YbeD family protein	NA	NA	NA	NA	NA
WP_159364414.1|3943863_3945054_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	42.0	6.5e-81
WP_011898443.1|3945249_3946200_-	septal ring lytic transglycosylase RlpA family protein	NA	NA	NA	NA	NA
WP_042467799.1|3946141_3947140_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_005317349.1|3947139_3948243_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_005317346.1|3948235_3950152_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_017411988.1|3950199_3950667_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005317340.1|3950686_3951028_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005317337.1|3951213_3951858_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005317335.1|3951934_3952966_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_005317332.1|3952965_3953112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317329.1|3953125_3953608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317327.1|3953774_3956351_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.9e-188
WP_005317324.1|3956496_3957003_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_042467801.1|3957089_3958634_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_005317320.1|3958912_3959797_-	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_005317318.1|3959892_3960357_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_005317316.1|3960353_3961397_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.6	2.4e-47
WP_005317314.1|3961453_3962887_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_005317312.1|3963154_3964318_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_042467803.1|3964493_3965153_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_005317308.1|3965356_3966313_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_005317306.1|3966298_3967261_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005317304.1|3967376_3967601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317302.1|3967597_3968251_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_005317295.1|3968313_3968916_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_005317292.1|3969144_3969564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317289.1|3969798_3970191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317286.1|3970261_3971218_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.9	3.1e-25
WP_159364415.1|3971345_3972098_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_005317282.1|3972217_3972784_-	elongation factor P	NA	NA	NA	NA	NA
WP_042467805.1|3972829_3974017_-	elongation factor P maturation arginine rhamnosyltransferase EarP	NA	NA	NA	NA	NA
WP_042467807.1|3974149_3975193_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.7	5.9e-102
WP_005317263.1|3975596_3976100_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
>prophage 20
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	3997563	4065288	4632948	tRNA,transposase	Synechococcus_phage(16.67%)	58	NA	NA
WP_011899080.1|3997563_3998595_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159364421.1|3998658_4000089_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_159364422.1|4000185_4001010_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	31.9	3.1e-13
WP_005317152.1|4001057_4001912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017413017.1|4002088_4002865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317141.1|4002932_4003832_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005317139.1|4003960_4004821_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005317138.1|4004903_4005539_+	DsbA family protein	NA	NA	NA	NA	NA
WP_159364423.1|4005764_4007393_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.0	2.7e-21
WP_159364948.1|4007428_4008451_+	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_159364424.1|4008512_4010999_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_088814290.1|4011284_4012358_+	type IV pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011898454.1|4013516_4014047_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_042468062.1|4016447_4016966_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_159364425.1|4016980_4018060_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_159364426.1|4018052_4019648_+	cell division protein DamX	NA	NA	NA	NA	NA
WP_017412038.1|4019718_4020591_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	5.5e-69
WP_005317108.1|4020907_4021582_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_005317106.1|4021568_4022237_+	phosphoglycolate phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	28.4	5.6e-05
WP_005317104.1|4022275_4023280_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005317103.1|4023403_4023619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317102.1|4023640_4024222_+	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	63.7	1.7e-71
WP_005317101.1|4024499_4025717_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.1	2.6e-24
WP_005317100.1|4025792_4026812_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_159364427.1|4026896_4028366_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005317093.1|4028496_4029294_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_159364428.1|4029471_4030044_-	beta-phosphoglucomutase family hydrolase	NA	A0A1D8KPI1	Synechococcus_phage	27.7	4.0e-12
WP_159364429.1|4030230_4031595_+	MFS transporter	NA	NA	NA	NA	NA
WP_076611341.1|4035661_4036579_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005311784.1|4036876_4038223_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.6	2.6e-78
WP_005311785.1|4038726_4038969_-	YheU family protein	NA	NA	NA	NA	NA
WP_088814108.1|4039641_4040559_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005311789.1|4041262_4042246_-	hydrolase	NA	NA	NA	NA	NA
WP_005311791.1|4042317_4043217_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_005311793.1|4043399_4044086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011899030.1|4044125_4044332_+	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_021138314.1|4044486_4045122_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005311800.1|4045196_4045412_-	SlyX family protein	NA	NA	NA	NA	NA
WP_159364432.1|4045426_4046395_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_011899028.1|4046514_4047321_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_159364433.1|4047473_4048880_+	response regulator	NA	NA	NA	NA	NA
WP_005311807.1|4048904_4049774_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017412614.1|4049887_4050223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005311811.1|4050330_4050669_-	DUF2956 domain-containing protein	NA	NA	NA	NA	NA
WP_005311813.1|4050755_4052594_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_017412914.1|4052819_4054385_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_042468443.1|4054583_4055438_-	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_005311820.1|4055623_4055725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364434.1|4055875_4057270_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	70.8	1.8e-178
WP_085941643.1|4057370_4057445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005311825.1|4057618_4058692_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	4.3e-23
WP_005311827.1|4058759_4059008_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	55.3	3.0e-20
WP_005311829.1|4059009_4060371_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	76.2	1.7e-165
WP_159364949.1|4060610_4061315_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_088814343.1|4061418_4062555_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_159364435.1|4062868_4063102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|4063017_4063935_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|4064151_4065288_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	4328281	4378521	4632948	protease,tRNA,transposase	uncultured_Caudovirales_phage(33.33%)	43	NA	NA
WP_159364484.1|4328281_4329199_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364485.1|4329837_4330755_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468377.1|4330877_4332086_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_159364486.1|4332118_4333270_-	hyaluronidase	NA	NA	NA	NA	NA
WP_005312960.1|4333311_4335039_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_017411705.1|4335318_4335465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312966.1|4335461_4336151_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_005312969.1|4336147_4337275_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005312972.1|4337294_4337645_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_042468381.1|4337861_4338773_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011898931.1|4339088_4339460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312985.1|4339762_4340419_-	diphthine--ammonia ligase	NA	NA	NA	NA	NA
WP_017411707.1|4340580_4341924_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_159364487.1|4342291_4343692_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	37.2	2.9e-80
WP_005312993.1|4343862_4344237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364488.1|4344233_4345046_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_159364489.1|4345181_4346456_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.0	3.5e-16
WP_005313000.1|4346648_4347737_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_042468382.1|4347733_4348930_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_085941631.1|4348919_4349735_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_005313009.1|4349878_4350559_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_005313012.1|4350673_4351546_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_159364490.1|4351622_4353335_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	55.8	2.0e-14
WP_042468387.1|4353545_4355354_-	MOSC domain-containing protein	NA	A0A222YX16	Synechococcus_phage	40.8	5.0e-08
WP_159364491.1|4355706_4357353_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076611341.1|4359879_4360797_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005313020.1|4362176_4362392_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_005313022.1|4362677_4363268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364493.1|4363279_4364626_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_159364494.1|4364761_4366585_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.4	2.0e-17
WP_005313033.1|4366655_4367249_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_005313036.1|4367238_4367496_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_017411716.1|4367630_4368545_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	39.5	2.3e-49
WP_005313042.1|4368713_4368995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364495.1|4369029_4370214_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_005313047.1|4370231_4370750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005313049.1|4370730_4371333_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159364496.1|4371353_4372787_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005313055.1|4373000_4373294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364954.1|4373363_4373675_-	protein NlpC	NA	NA	NA	NA	NA
WP_076611341.1|4373780_4374698_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005313062.1|4376465_4377374_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_159364497.1|4377489_4378521_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	4403714	4458820	4632948	tRNA,transposase	Bodo_saltans_virus(16.67%)	44	NA	NA
WP_076611341.1|4403714_4404632_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|4405062_4405980_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005319184.1|4406589_4407720_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_017412873.1|4407896_4409267_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.3	1.1e-111
WP_042468762.1|4409442_4410054_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_005319178.1|4410251_4411358_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_011898520.1|4411676_4412138_-	NUDIX hydrolase	NA	A0A023W5N2	Serratia_phage	62.2	8.5e-05
WP_088814280.1|4412152_4413127_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_005319170.1|4413197_4413965_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_005319168.1|4413965_4414271_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_005319166.1|4414484_4415891_-	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_159364506.1|4417500_4418418_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011898521.1|4418873_4419626_+	phosphotransferase	NA	NA	NA	NA	NA
WP_076611341.1|4421013_4421931_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314572.1|4422493_4422802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034282846.1|4424725_4425472_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017412979.1|4425587_4426334_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005314576.1|4426407_4426911_-	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_005314577.1|4426907_4427915_-	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_005314579.1|4429143_4429701_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_085941442.1|4429945_4430320_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_005314583.1|4430394_4430622_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_159364507.1|4430618_4432889_+	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_017412111.1|4432885_4433128_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_076611341.1|4433384_4434302_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364955.1|4434324_4434786_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_017412109.1|4434919_4436191_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_159364508.1|4436464_4437610_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_005314602.1|4437669_4438026_-	DMT family protein	NA	NA	NA	NA	NA
WP_005314604.1|4438137_4438869_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005314605.1|4438972_4439980_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_034282866.1|4440078_4440849_+	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	30.3	6.0e-11
WP_017412107.1|4440965_4442027_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4VUY9	Pandoravirus	50.0	9.2e-87
WP_005314618.1|4442181_4442562_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_005314621.1|4442746_4443979_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	6.9e-110
WP_005314623.1|4444207_4444861_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_005314624.1|4445116_4445725_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005314627.1|4445879_4447214_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_017412106.1|4447624_4448593_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005314633.1|4448840_4449653_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_005314635.1|4450330_4451482_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.9	1.4e-48
WP_017412104.1|4451498_4454723_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_005314639.1|4455255_4456914_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_159364279.1|4457902_4458820_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	4468789	4534672	4632948	protease,transposase	Vibrio_phage(25.0%)	44	NA	NA
WP_087757302.1|4468789_4469221_+|protease	protease	protease	NA	NA	NA	NA
WP_076611341.1|4470344_4471262_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314672.1|4471437_4471917_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_005314674.1|4471979_4472567_+	methyltransferase	NA	NA	NA	NA	NA
WP_159364510.1|4472569_4472980_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_159364511.1|4473073_4474489_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005314684.1|4474501_4478959_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_005314700.1|4479559_4480495_+	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_005314720.1|4480912_4483057_+	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.9	6.3e-26
WP_017412894.1|4483049_4484468_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005314727.1|4484503_4485829_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_005314730.1|4485950_4486712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314739.1|4486715_4488641_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_159368383.1|4488900_4494591_+	retention module-containing protein	NA	NA	NA	NA	NA
WP_042468729.1|4494677_4495235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814343.1|4495357_4496494_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_159364957.1|4496597_4497263_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_159364958.1|4497373_4498530_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	50.2	5.2e-83
WP_076611341.1|4498554_4499472_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_102665338.1|4499716_4500724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314771.1|4503133_4503313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468640.1|4503666_4504860_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_159364512.1|4505022_4506498_+	YfcC family protein	NA	NA	NA	NA	NA
WP_005314787.1|4508159_4508372_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_159364513.1|4508433_4508697_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.5	5.2e-23
WP_042468643.1|4508894_4510340_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_042468644.1|4510445_4512206_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	40.9	1.9e-92
WP_005314797.1|4512307_4513345_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_005314799.1|4513348_4513687_-	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_159364514.1|4513975_4515397_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_159364515.1|4515539_4516244_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_005314809.1|4516319_4517996_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	55.9	8.4e-159
WP_076611341.1|4518600_4519518_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314815.1|4520766_4523442_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_085941443.1|4523737_4524466_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_005314822.1|4524638_4525274_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_042468196.1|4525556_4527176_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021139963.1|4527274_4528195_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_159364516.1|4528209_4529121_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_005314832.1|4529153_4530140_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-15
WP_005314835.1|4530136_4530250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468189.1|4530250_4531246_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.2e-19
WP_034282953.1|4531548_4532493_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	36.3	9.2e-38
WP_076611341.1|4533754_4534672_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP047374	Aeromonas salmonicida subsp. salmonicida strain J409 chromosome, complete genome	4632948	4552794	4608922	4632948	protease,transposase	Klosneuvirus(30.0%)	44	NA	NA
WP_076611341.1|4552794_4553712_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017411553.1|4555258_4555663_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_159364521.1|4555989_4556865_-	OmpA family protein	NA	NA	NA	NA	NA
WP_005314938.1|4558087_4558705_-	membrane protein	NA	NA	NA	NA	NA
WP_005314942.1|4558725_4559460_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_011898627.1|4559456_4560047_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	34.5	1.1e-15
WP_005314948.1|4560104_4560842_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_011898628.1|4560841_4561744_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_017411549.1|4561716_4562538_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017411548.1|4562540_4563338_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_076611341.1|4563893_4564811_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_159364959.1|4564814_4565702_-	TonB family protein	NA	NA	NA	NA	NA
WP_159364522.1|4566359_4567277_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412971.1|4567474_4568938_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.6	5.3e-93
WP_005315336.1|4569021_4570602_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_088814221.1|4571015_4571255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364523.1|4572241_4572895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814343.1|4572903_4574040_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_159368384.1|4574153_4574318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005315340.1|4574622_4575996_+	protein kinase	NA	NA	NA	NA	NA
WP_042467896.1|4576219_4576867_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_159364524.1|4577170_4579945_-	insulinase family protein	NA	A0A1V0SJA4	Klosneuvirus	27.0	6.8e-89
WP_017411860.1|4580107_4580575_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_005315346.1|4580708_4580915_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_005315348.1|4581115_4582036_+	DMT family transporter	NA	NA	NA	NA	NA
WP_042467895.1|4582083_4583700_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005315352.1|4584083_4585118_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	46.5	4.2e-76
WP_159364525.1|4585206_4588671_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_005315356.1|4588680_4589256_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_005315358.1|4589332_4590568_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_087755599.1|4590560_4591322_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	42.1	2.0e-35
WP_005315361.1|4591321_4592563_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_011898663.1|4593339_4593774_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_005315366.1|4594202_4595513_+	trigger factor	NA	NA	NA	NA	NA
WP_085941601.1|4595620_4596223_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.5	5.4e-60
WP_017411865.1|4596351_4597626_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.5	9.6e-131
WP_021140372.1|4597767_4600122_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.0	3.6e-224
WP_005315375.1|4600361_4600634_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	5.0e-21
WP_088814373.1|4600788_4602699_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005315379.1|4602939_4604532_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.4	1.1e-56
WP_042467894.1|4604768_4606424_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_005315383.1|4606420_4606732_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_005315390.1|4606840_4607467_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_076611341.1|4608004_4608922_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP047375	Aeromonas salmonicida subsp. salmonicida strain J409 plasmid p1AsJ409, complete sequence	99881	7364	52975	99881	transposase	Vibrio_phage(62.5%)	50	NA	NA
WP_159364953.1|7364_8579_-|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
WP_155268746.1|8804_8942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159365022.1|9041_10586_-	T3SS effector inositol phosphatase Ati2	NA	NA	NA	NA	NA
WP_159365023.1|10629_11079_-	Ati1 family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_076611341.1|11423_12341_-|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_011899437.1|12923_13952_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_017411843.1|14585_15251_-	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_159365000.1|15229_15856_-	type III secretion system sorting platform protein AscK	NA	NA	NA	NA	NA
WP_005320809.1|15852_16581_-	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_005320806.1|16599_16938_-	EscI/YscI/HrpB family type III secretion system inner rod protein	NA	NA	NA	NA	NA
WP_005320804.1|16937_17492_-	YopR family type III secretion effector	NA	NA	NA	NA	NA
WP_005320802.1|17488_17842_-	YscG family type III secretion protein	NA	NA	NA	NA	NA
WP_042468159.1|17841_18099_-	EscF/YscF/HrpA family type III secretion system needle major subunit	NA	NA	NA	NA	NA
WP_159365001.1|18091_18304_-	EscE/YscE/SsaE family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_159365002.1|18266_19571_-	EscD/YscD/HrpQ family type III secretion system inner membrane ring protein	NA	NA	NA	NA	NA
WP_005320794.1|19567_21406_-	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_159365003.1|21393_21819_-	YscB family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_017411837.1|21834_22650_-	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_159365004.1|22769_23585_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042468163.1|23930_24332_-	type III secretion system chaperone YscW	NA	NA	NA	NA	NA
WP_005320785.1|24328_24562_-	T3SS regulon translocated regulator ExsE family protein	NA	NA	NA	NA	NA
WP_017411835.1|24564_25008_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_159365005.1|25143_26040_-	type III secretion system translocon subunit AopD	NA	NA	NA	NA	NA
WP_159365006.1|26052_27246_-	type III secretion system translocon subunit AopB	NA	NA	NA	NA	NA
WP_042468166.1|27193_27730_-	CesD/SycD/LcrH family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_017411832.1|27739_28825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159365007.1|28834_29119_-	type III secretion protein	NA	NA	NA	NA	NA
WP_005320772.1|29158_29614_-	type III secretion system regulator LcrR	NA	NA	NA	NA	NA
WP_042468167.1|29610_31728_-	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_020379598.1|31708_32059_-	type III secretion system chaperone AscY	NA	NA	NA	NA	NA
WP_005320766.1|32055_32421_-	type III secretion system protein AscX	NA	NA	NA	NA	NA
WP_005320764.1|32417_32789_-	type III secretion chaperone SycN	NA	NA	NA	NA	NA
WP_005320760.1|32785_33067_-	TyeA family type III secretion system gatekeeper subunit	NA	NA	NA	NA	NA
WP_042468168.1|33047_33926_-	YopN family type III secretion system gatekeeper subunit	NA	NA	NA	NA	NA
WP_159365025.1|34115_35438_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_017411827.1|35434_35896_+	type III secretion system central stalk protein AscO	NA	NA	NA	NA	NA
WP_005320747.1|37446_38373_+	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_042468169.1|38369_39023_+	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_005320743.1|39024_39291_+	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_005320741.1|39287_40076_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_005320739.1|40072_41131_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_017411822.1|42064_42445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011899444.1|44768_45629_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.8	5.3e-08
WP_076611341.1|45924_46842_-|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_159365008.1|47020_47311_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_042469195.1|47310_47949_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	44.8	4.9e-43
WP_076611341.1|48792_49710_-|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_159365010.1|50354_50486_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|50556_51474_-|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_076611341.1|52057_52975_+|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
